Targeting the MMP-14/MMP-2/integrin α_vβ₃ axis with multispecific N-TIMP2–based antagonists for cancer therapy

Abstract

The pathophysiological functions of the signaling molecules matrix metalloproteinase-14 (MMP-14) and integrin α_vβ₃ in various types of cancer are believed to derive from their collaborative activity in promoting invasion, metastasis, and angiogenesis, as shown in vitro and in vivo. The two effectors act in concert in a cell-specific manner through the localization of pro-MMP-2 to the cell surface, where it is processed to intermediate and matured MMP-2. The matured MMP-2 product is localized to the cell surface via its binding to integrin α_vβ₃. The MMP-14/MMP-2/integrin α_vβ₃ axis thus constitutes an attractive putative target for therapeutic interventions, but the development of inhibitors that target this axis remains an unfulfilled task. To address the lack of such multitarget inhibitors, we have established a combinatorial approach that is based on flow cytometry screening of a yeast-displayed N-TIMP2 (N-terminal domain variant of tissue inhibitor of metalloproteinase-2) mutant library. On the basis of this screening, we generated protein monomers and a heterodimer that contain monovalent and bivalent binding epitopes to MMP-14 and integrin α_vβ₃. Among these proteins, the bi-specific heterodimer, which bound strongly to both MMP-14 and integrin α_vβ₃, exhibited superior ability to inhibit MMP-2 activation and displayed the highest inhibitory activity in cell-based models of a MMP-14-, MMP-2-, and integrin α_vβ₃-dependent glioblastoma and of endothelial cell invasiveness and endothelial capillary tube formation. These assays enabled us to show the superiority of the combined target effects of the inhibitors and to investigate separately the role each of the three signaling molecules in various malignant processes.

Introduction

A variety of cancers are believed to stem from the dysregulation of signaling pathways that mediate cell behavior, i.e. proliferation, survival, migration, and invasion. Among the signaling molecules that have been implicated in the etiology of different cancers are integrin α_vβ₃ and matrix metalloproteinase-14 (MMP-14, also known as membrane–type-1 matrix metalloproteinase). Integrin α_vβ₃, like all integrins, binds to extracellular matrix (ECM)² proteins, thereby promoting cell adhesion to the ECM and activating the signaling pathways involved in the progression of the cell cycle (1) and in angiogenesis (2, 3). MMP-14 is associated with proteolysis, angiogenesis, and cell migration and invasion in the ECM, with elevated levels being correlated with malignancy in different types of cancer (4, 5). In those cancers, it is the catalytic site on the extracellular domain of MMP-14 that drives invasion by enabling MMP-14 to function as a pericellular collagenase (6) and as an activator of pro-MMP-2 (7, 8). A number of studies on a variety of human cancers have shown a correlation between the proteolytic activities of MMP-14 and activated MMP-2, on the one hand, and the extent of endothelial cell invasion, on the other; these studies have also shown a direct link between these two MMPs and pericellular degradation, leading to angiogenesis and metastasis (8–11). For many human tumors, poor prognosis has thus been correlated with the dysregulation and overexpression of integrin α_vβ₃ (12, 13) and MMP-14 and MMP-2 (10), indicating that this axis could constitute an important target for therapeutic intervention.

The concept for designing such a therapeutic intervention may be drawn from numerous papers demonstrating cross-talk between biological processes mediated by MMP-14, integrin α_vβ₃, and their ligands, particularly pathways responsible for angiogenesis (14, 15) and metastasis (16, 17). In addition, recent studies have demonstrated a functional interaction between MMP-14 and integrin α_vβ₃. For example, it is known that integrin α_vβ₃, which is highly expressed on vascular sprouts (endothelial cells) during angiogenesis and on tumor cells (e.g. breast cancer, glioblastoma, and melanoma), localizes MMP-14 at the cell migration front (18) and attracts secreted MMP-2 to the cell surface, thereby promoting cell invasiveness (19, 20). In addition, MMP-14 and integrin α_vβ₃ associate on primary endothelial cells and together play a role in endothelial cell migration (18). A cooperative role of MMP-14 and integrin α_vβ₃ in activating pro-MMP-2 has also been reported (21), as has the co-immunoprecipitation of an MMP-14/integrin α_vβ₃/MMP-2 complex from glioma cells (20, 22, 23). Finally, MMP-14 has been shown to participate catalytically in the maturation of the integrin α_v subunit and to correlate with β₃ chain proteolytic cleavage and processing, both of which lead to functional activation of integrin α_vβ₃, thus modulating the adhesive, migratory, and metastatic behavior of tumor cells (23, 24).

MMP-14 and integrin α_vβ₃ work in concert to facilitate the processing and maturation of MMP-2 (21). This maturation is initiated by activation of pro-MMP-2 into intermediate MMP-2 in a process that is facilitated by two molecules of MMP-14 and one molecule of FL-TIMP2, the full-length molecule of tissue inhibitor of metalloproteinases 2 (TIMP2). Through its N-terminal domain, FL-TIMP2 binds to the catalytic site of one MMP-14 molecule, leading to MMP-14 inhibition. Through its C-terminal domain, cell-surface localized FL-TIMP2 binds to pro-MMP-2, thereby bringing it into the proximity of a second (catalytically active) MMP-14 molecule, which processes pro-MMP-2 into the MMP-2 intermediate form (21, 25, 26). Conversion of the intermediate MMP-2 into matured MMP-2 takes place in an integrin α_vβ₃-dependent process, but the details of this specific maturation mechanism remain to be elucidated (21, 23). It is the latter two forms of MMP-2 (i.e. intermediate and matured) that are able to degrade ECM components and to promote invasiveness (27, 28). Importantly, although MMP-2 is a secreted protein, localization of matured MMP-2 on cancer and endothelial cell surfaces, via integrin α_vβ₃, was found to increase cell invasiveness and angiogenesis (19, 29).

Given the complexity and redundancy of the MMP-14, MMP-2, and integrin α_vβ₃ signaling networks that result from the cross-talk between these effectors, it is likely that multicomponent therapeutics capable of perturbing parallel nodes of these critical pathways that are associated with angiogenesis and metastasis would be a promising means to combat drug resistance in various cancers, including melanoma (22), glioma (20), and breast cancer (21). Indeed, such a notion has attracted considerable attention for other systems and has accelerated the development of mixture therapeutics targeted at other cross-reactive signaling networks, such as vascular endothelial growth factor–epidermal growth factor receptor inhibitors (30, 31), many of which have already been introduced into pre-clinical and clinical practice (30). Nonetheless, despite their significant clinical success, mixture therapeutics have several well known limitations, including additive on- and off-target toxicity (32, 33). Moreover, their use is limited by the requirement to provide preclinical data demonstrating that the mixture has greater than additive activity or more durable responses than those obtained with mono-therapy (34). These limitations may be overcome by exploiting the enormous potential of combinatorial approaches for engineering multispecificity into natural protein ligands (35–37).

In this paper, we demonstrate that concurrent targeting of MMP-14 and integrin α_vβ₃ with bi-specific inhibitors offers enhanced therapeutic benefits compared with the respective mono-treatments. We show that these bi-specific inhibitors are the first reported proteins that target all the known functions that result from cross-talk between MMP-14 and integrin α_vβ₃, namely cancer cell invasion, angiogenesis, and MMP-2 activation and localization to the cell surface. The bi-specific inhibitors were derived from the 127-amino acid N-terminal domain of WT TIMP-2 (N-TIMP2_WT) and that of an N-TIMP2 variant, designated N-TIMP2_5M, which was previously designed by our group for high affinity and specificity toward MMP-14 in preference to other MMPs (38). An overriding consideration in the design of the above inhibitors was the need for specificity, because MMP family members are also found in nonmalignant cells, and some MMPs, such as MMP-8 and MMP-12, exhibit anti-tumorigenic functions (39–41). It is thus not surprising that inhibitors with narrow or single MMP specificity have greater therapeutic potential than nonspecific inhibitors (42–44). As we have shown previously, specificity toward MMP-14 in preference to other MMPs can be obtained by utilizing N-TIMP2_5M (38), but cell specificity can best be achieved by tailoring the inhibitors for binding specificity to both MMP-14 and its co-localized receptor integrin α_vβ₃.

One of the main challenges that we had to address was engineering specificity for integrin α_vβ₃ binding, because the Arg-Gly-Asp (RGD) tripeptide motif typical of many natural ECM ligands, including fibronectin, vitronectin, fibrinogen, and osteopontin, is also recognized by other integrins, including those containing the α_v subunit and integrins α₅β₁ and α_iibβ₃ (45). To generate mutated N-TIMP2 variants with binding specificity toward integrin α_vβ₃, we exploited the substantial differences between the above ligands in the three-dimensional orientations of flexible solvent-exposed loops containing the RGD motif; these differences are a function of the particular amino acid residues flanking the RGD sequence and hence dictate the integrin-binding affinity and specificity of the ligands (46).

N-TIMP2 shows extensive sequence diversity both within and between species (47), as its exposed loops are highly tolerant to substitution or to incorporation of additional amino acids (38, 47–49). To achieve high target affinity and specificity, we exploited these attributes of N-TIMP2 for use as a versatile platform for the development of both bivalent single-domain and heterodimeric MMP-14/integrin α_vβ₃ inhibitors that were generated from affinity high-throughput screens of an N-TIMP2_RGD–loop library with random amino acid changes. The engineered bi-specific proteins were expressed as soluble proteins and were shown to bind simultaneously to both MMP-14 and integrin α_vβ₃, with different inhibitory and antagonistic activities, both in vitro and in cells. The bi-specific monomeric and heterodimeric inhibitors displayed superior therapeutic potential to that of MMP-14 and integrin α_vβ₃ mono-treatments. In addition, the availability of both mono- and bi-specific proteins allowed us to dissect out the role of each target in cell invasion and angiogenesis and to design inhibitors with superior potencies for each of these two cancerous processes, separately and together.

Results

N-TIMP2_RGD loop library construction and screening

An N-TIMP2_RGD yeast surface display (YSD) loop library was designed in such a way that positions 51–59 at the apex of loop B–C in N-TIMP2, which naturally binds integrin α₃β₁, were replaced with a sequence comprising an RGD motif flanked on each side by three additional random amino acids (XXXRGDXXX) (Fig. 1A and Fig. S1). To isolate high-affinity bi-specific N-TIMP2 binders for the MMP-14 catalytic domain (MMP-14_CAT, residues 112–292) (50) and integrin α_vβ₃, six rounds of flow-cytometry sorting were performed, the first one for high-expressing clones (expression sort, ES) and the other five (sorts 1–5) for binding to soluble integrin α_vβ₃ (Fig. 1, A and B). In each round of sorting (sorts 1–5), the concentration of integrin α_vβ₃ was reduced, and the cell population binding integrin α_vβ₃ was enriched (Fig. 1B). Nine different clones were identified after sort 5 (Table 1). One of the nine clones, namely clone 2, designated N-TIMP2_{WT, RGD} (Fig. S2), was chosen for further purification as a soluble protein on the basis of its strong integrin α_vβ₃ binding. This clone was then purified as a free N-terminal protein (which is crucial for MMP inhibition; Fig. S3), having a His tag and a c-Myc tag, both at the C terminus of the protein.

Figure 1.

Strategy for screening the N-TIMP2_RGD library. A, YSD system. N-TIMP2_RGD proteins were displayed on yeast. Expression of the N-TIMP2_RGD proteins was detected by targeting the c-Myc epitope tag, expressed at the C terminus of the protein, with an antibody labeled with PE, and binding to integrin α_vβ₃ was detected by FITC staining. B, flow cytometry analysis of the sorted library tested against 50 nm integrin α_vβ₃. In the expression sort (ES), the entire N-TIMP2_RGD protein–expressing cell population was sorted (black gate). In sort 1 (S1), the yeast cell population binding to integrin α_vβ₃ was collected (black gate). In sort 2 (S2) to sort 5 (S5), the integrin α_vβ₃ high-affinity population was collected (black gate). The population binding integrin α_vβ₃ was enriched as the sorting progressed from S2 to S5. C, N-TIMP2 protein variants. N-TIMP2_{WT, RGD} is the bi-specific protein isolated after sort 5. N-TIMP2_{5M, RGD} is N-TIMP2_{WT, RGD} with five mutations (5M); this mutant showed improved binding to MMP-14 (38). N-TIMP2_HD is a heterodimer composed of N-TIMP2_5M and N-TIMP2_{WT, RGD} proteins conjugated via a peptide linker. N-TIMP2_WT and N-TIMP2_5M are mono-specific binders for MMP-14. Ala–N-TIMP2_{WT, RGD} has a reduced affinity toward MMP-14 and a high affinity toward integrin α_vβ₃.

N-TIMP2 variants exhibit different affinities toward MMP-14 and integrin α_vβ₃

To optimize the inhibitory activity of the N-TIMP2 variants and to dissect out the contribution of each target receptor to tumor progression, we generated a pool of N-TIMP2 variants with different affinities for each target. We have recently shown that insertion of five point mutations, namely I35M, N38D, S68N, V71G, and H97R, into N-TIMP2 (generating N-TIMP2_5M) increases its affinity toward MMP-14 by 890-fold (38). In this study, we therefore incorporated these mutations into the bi-specific monomer, N-TIMP2_{WT, RGD}, thereby generating the N-TIMP2_{5M, RGD} variant (Fig. 1C). We also engineered Ala–N-TIMP2_{WT, RGD}, a protein variant having high affinity toward integrin α_vβ₃ and reduced inhibition activity toward MMP-14, by inserting an alanine residue before the cysteine residue at position 1 (Fig. 1C). We note that alanine insertion in TIMP2 was previously shown to abolish binding to MMP and its inhibition (51). N-TIMP2_WT and N-TIMP2_5M served as mono-specific binders with different affinities to MMP-14 but no affinity to integrin α_vβ₃. In addition, an N-TIMP2 heterodimer (N-TIMP2_HD), composed of N-TIMP2_5M at the N terminus fused via a flexible peptidic linker to N-TIMP2_{WT, RGD} at the C terminus, was designed so as to reduce the mutual effects of the N-TIMP2_5M and N-TIMP2_{WT, RGD} mutations on each other's activity.

The bi-specific monomer N-TIMP2_{WT, RGD} was shown to bind both integrin α_vβ₃ and MMP-14_CAT, with K_D values of 64.8 nm (Fig. 2A) and 838 nm (Fig. 2C), respectively (Table 1). Moreover, N-TIMP2_{WT, RGD} was capable of binding both receptors simultaneously, as determined by a co-injection surface plasmon resonance (SPR) assay (Fig. 2E). We have previously shown that the insertion of the five mutations into N-TIMP2_5M improved the affinity to MMP-14_CAT compared with N-TIMP2_WT (38). As expected, binding to integrin α_vβ₃ was not detected for the TIMP2_WT and N-TIMP2_5M mono-specific MMP-14 variants (Fig. S4A). In agreement with these results, the insertion of the five mutations into N-TIMP2_{5M, RGD} significantly increased the affinity toward MMP-14_CAT by ∼400-fold (K_D of 2 nm), although the affinity toward integrin α_vβ₃ was decreased (K_D of 531 nm) but not completely abolished (Table 1 and Fig. S4, C and D). The results of a comparison of the K_D values obtained for the two monomeric bi-specific binders, N-TIMP2_{WT, RGD} and N-TIMP2_{5M, RGD}, for both integrin α_vβ₃ and MMP-14_CAT implied that by increasing the affinity to one target, the affinity to the other is reduced. However, by separating the two binding domains of each monomer in the engineered bi-specific heterodimer (N-TIMP2_HD), we were able to generate a protein that had high affinity to both integrin α_vβ₃ and MMP-14_CAT (K_D of 130 and 0.78 nm, respectively, see Table 1 and Fig. 2, B and D). Similarly to N-TIMP2_{WT, RGD}, N-TIMP2_HD was able to bind both receptors simultaneously, as determined by a co-injection SPR assay (Fig. 2F).

Figure 2.

SPR sensorgrams and the inhibitory activity of the N-TIMP2_{WT, RGD} and N-TIMP2_HD variants. N-TIMP2_{WT, RGD} (A) and N-TIMP2_HD (B) binding to integrin α_vβ₃ is shown. N-TIMP2_{WT, RGD} (C) and N-TIMP2_HD (D) binding to MMP-14_CAT is shown. Dual binding of N-TIMP2_{WT, RGD} (E) and N-TIMP2_HD (F) to integrin α_vβ₃ and MMP-14_CAT is shown. E and F, variants were allowed to flow over integrin α_vβ₃ immobilized on the chip, followed by MMP-14_CAT (blue) or buffer (control 1, red) injection at 300 s. There was an increase in response units (RU) for the variants after MMP-14_CAT injection, which indicates that these variants bind simultaneously to both receptors. In control 2 (green), a buffer was allowed to flow over the integrin α_vβ₃ immobilized chip, followed by MMP-14 injection at 300 s. In control 3 (yellow), a buffer was allowed to flow over the integrin α_vβ₃ immobilized chip throughout the entire experiment. Substrate degradation velocity at different concentrations of N-TIMP2_{WT, RGD} (0–100 nm) (G) and N-TIMP2_HD (0–0.2 nm) (H) were fitted to Morrison's equation (Equation 2) to obtain K_i values.

Table 1.

Binding kinetics of N-TIMP2 variants

ND means binding not detected at 1 μm concentration; NA means not available; NT means not tested.

N-TIMP2 variant	MMP-14 kinetics				Integrin αvβ3 kinetics
	Ki	KD	Kon	Koff	KD	Kon	Koff
	nm	nm	104 ms−1	10−5 s−1	nm	104 ms−1	10−3 s−1
N-TIMP2WT	2.01 ± 0.2	4.68 ± 0.01	11.4	53.6	ND
N-TIMP25M	0.011 ± 0.003	0.603 ± 0.001a	6.2	3.74	ND
N-TIMP2WT, RGD	35.76 ± 2.28	838 ± 12.7	NA	NA	64.8 ± 0.46	1.71 ± 0.01	1.11 ± 0.01
Ala–N-TIMP2WT, RGD	132.6 ± 8.55	NT			197 ± 1.1	4.71 ± 0.08	9.28 ± 0.35
N-TIMP25M, RGD	b	2.08 ± 0.02	8.39 ± 0.21	17.4 ± 0.13	561 ± 276	NA	NA
N-TIMP2HD	0.077 ± 0.023	0.78 ± 0.01	7.6 ± 0.12	5.97 ± 0.09	130 ± 21.1	NA	NA

^a Data were taken from Arkadash et al. (38).

^b K_i values could not be determined accurately. Complete inhibition was detected at 0.8 nm.

In agreement with the SPR binding results, the ability of the N-TIMP2 variants to inhibit MMP-14_CAT catalytic activity, as reflected by the K_i values, was as follows (best to worst): N-TIMP2_5M, N-TIMP2_HD, N-TIMP2_WT, N-TIMP2_{WT, RGD}, and Ala–N-TIMP2_{WT, RGD} (Table 1). Ala–N-TIMP2_{WT, RGD} showed low inhibitory activity toward MMP-14_CAT, although it retained its ability to bind to integrin α_vβ₃ (Table 1 and Fig. S4B).

In summary, three important points emerge from these results. 1) The three engineered bi-specific proteins bind to both targets but with different affinities: N-TIMP2_{WT, RGD} binds strongly to integrin α_vβ₃ but weakly to MMP-14; N-TIMP2_{5M, RGD} binds strongly to MMP-14 but weakly to integrin α_vβ₃; and N-TIMP2_HD binds strongly to both receptors. 2) N-TIMP2_{WT, RGD} and N-TIMP2_HD can bind simultaneously to both receptors. 3) There was good correlation between the K_D (SPR) and K_i (inhibition of MMP-14 catalytic activity) potencies.

N-TIMP2 variants inhibit MMP-2 activation in the U87MG cell line

A major outcome of the cross-talk between MMP-14 and integrin α_vβ₃ is the processing/maturation of pro-MMP-2 to intermediate and subsequently fully matured MMP-2 forms. The MMP-2 processing/maturation mechanism takes place in two consecutive steps. In the first step, processing of the 68-kDa pro-MMP-2 by MMP-14 into the 64-kDa MMP-2 intermediate form is followed by conversion of the MMP-2 intermediate form to the matured 62-kDa MMP-2 form. In the second, more rapid, step, it is the interaction of the intermediate MMP-2 with integrin α_vβ₃ that facilitates, via an as-yet-unknown mechanism, the autocatalytic processing of the intermediate MMP-2 to the fully matured MMP-2 (21). Because MMP-2, MMP-14, and integrin α_vβ₃ work in concert, it is not a trivial task to separate out the specific and overall contributions of the intermediate and matured forms of MMP-2 to cancer cell invasion and angiogenesis (52). To address this problem, we evaluated the ability of the mono-specific (inhibiting MMP-14 or integrin α_vβ₃) versus the bi-specific (inhibiting both proteins) N-TIMP2 variants to inhibit the activation (maturation process) of MMP-2. For this purpose, we used a gelatin zymography assay, because all MMP-2 forms can cleave gelatin (53), but only the intermediate and the matured species can degrade the ECM components, such as collagen, gelatin, and fibronectin (53, 54), and promote cell invasion, with the matured form being more potent than the intermediate form (55).We utilized two controls for this assay as follows: (i) recombinant FL-TIMP2, a protein that is endogenously expressed in U87MG glioblastoma cells and is known to induce the formation of the matured MMP-2 and cell invasion (56), and (ii) cyclic RGD (cRGD), a known inhibitor of integrin α_vβ₃ (57). In this assay, U87MG cells (expressing both MMP-14 and integrin α_vβ₃, Fig. S5) were treated with 100 nm of each protein variant for 48 h. The culture supernatant, which contained the secreted pro/intermediate/matured MMP-2 forms, was loaded onto a gelatin gel, and the different MMP-2 forms were eluted as white bands on the gel. In addition, different concentrations of FL-TIMP2 and cRGD were tested for their pro-MMP-2 activation function. All the strong inhibitors of MMP-14, namely N-TIMP2_WT, FL-TIMP2, N-TIMP2_5M, N-TIMP2_{5M, RGD}, and N-TIMP2_HD, significantly inhibited the processing of endogenous pro-MMP-2 to the intermediate form (Fig. 3, A and B). However, FL-TIMP2, when added at a lower concentration (10 nm), activated processing of the pro-MMP-2 to the active forms (Fig. S6). Importantly, exposure to Ala–N-TIMP2_{WT, RGD}, which binds strongly to integrin α_vβ₃ and possesses a lower MMP-14 inhibition potency, significantly increased the amount of the intermediate MMP-2 form by inhibiting its processing to the matured form; the same was true for cRGD at a concentration of 1 μm (Fig. S7). Thus, whereas Ala–N-TIMP2_{WT, RGD} did not reduce the total amount of the ECM-reactive MMP-2 forms (i.e. both intermediate and matured forms that are able to degrade the ECM component) relative to the untreated control, it did increase the ratio between the intermediate (less ECM reactive) product and the matured product. Although N-TIMP2_{WT, RGD} did not significantly inhibit the processing of the intermediate MMP-2, it did exhibit the same tendency to inhibit intermediate MMP-2 processing as the Ala–N-TIMP2_{WT, RGD} variant, with the ratios between the intermediate and matured forms of MMP-2 being 2.1 and 2, for N-TIMP2_{WT, RGD} and Ala–N-TIMP2_{WT, RGD}, respectively, compared with 1.1 for the untreated control. Because the intermediate MMP-2 form is less ECM-reactive than the fully matured form, it was to be expected that the increase in the intermediate/matured MMP-2 ratio would be reflected in reduced ECM degradation and decreased invasion, as will indeed be shown in this paper. Among all the variants, N-TIMP2_HD exhibited the strongest inhibition effect on MMP-2 activation, giving the largest decrease in both the intermediate and the matured forms relative to the other variants.

Figure 3.

Inhibition of pro-MMP-2 activation by N-TIMP2 variants. A, gelatin zymography gel results. The U87MG supernatant was loaded on gelatin zymography gel. Lane 1 represents untreated U87MG cells, and lanes 2–8, respectively, represent treatment with 100 nm of the following N-TIMP2 variants: N-TIMP2_WT; FL-TIMP2; N-TIMP2_5M; N-TIMP2_{WT, RGD}; N-TIMP2_{5M, RGD}; Ala–N-TIMP2_{WT, RGD}; and N-TIMP2_HD. Lane 9 represents treatment with cRGD (100 nm). B, quantification of the percentage of each MMP-2 form, i.e. pro/intermediate/matured (band intensity of each MMP-2 state, i.e. pro-MMP-2 (68 kDa), intermediate MMP-2 (64 kDa), and matured MMP-2 (62 kDa), was divided by the total band intensity of all the MMP-2 forms). Error bars represent S.E. Pro-MMP-2 processing and the total amount of the catalytically active MMP-2 were significantly inhibited by N-TIMP2_WT (p < 0.05), FL-TIMP2 (p < 0.01), and N-TIMP_5M, N-TIMP2_{5M, RGD}, and N-TIMP2_HD (p < 0.001). Processing of the intermediate form was significantly inhibited by Ala–N-TIMP2_{WT, RGD} (p < 0.05). The amount of the matured form of MMP-2 was significantly reduced by N-TIMP2_5M and N-TIMP2_{5M, RGD} (p < 0.05), N-TIMP2_HD (p < 0.01), and N-TIMP2_WT (p < 0.001). Statistical analysis was performed by Student's t test compared with the untreated control; n = 3.

MMP-2 docking on the U87MG cell surface is impaired by an integrin α_vβ₃ inhibitor

The catalytic activity of MMP-2 localized on the cell surface via integrin α_vβ₃ mediation is known to promote cell invasiveness and angiogenesis (19, 23, 29). We therefore tested the ability of our inhibitors to prevent the interaction between matured MMP-2 and integrin α_vβ₃. Because the SPR results indicated that our bi-specific proteins can simultaneously engage MMP-14 and integrin α_vβ₃, Ala–N-TIMP2_{WT, RGD} (which binds strongly to integrin α_vβ₃ and has low MMP-14 inhibition activity) was selected as the variant to compete with MMP-2 for binding to membrane-anchored integrin α_vβ₃. In keeping with our expectations that the competitive binding would inhibit MMP-2–induced ECM degradation (19), flow cytometry showed that there was indeed a reduction of recombinant matured MMP-2 levels on the surface of the U87MG cells 2 h after treatment with 2 μm Ala–N-TIMP2_WT, RGD (67% reduction, Fig. 4A). To confirm that the matured form of MMP-2 was indeed removed by Ala–N-TIMP2_{WT, RGD}, gelatin zymography was performed on the U87MG cell lysate, which contained the cell-surface–bound MMP-2; it was indeed found that only matured MMP-2 was removed from the cell surface (Fig. 4, B–D). To determine whether Ala–N-TIMP2_{WT, RGD} prevents matured MMP-2 binding specifically to integrin α_vβ₃, a solid-phase assay was performed. Purified recombinant integrin α_vβ₃ was immobilized on a 96-well ELISA plate, followed by overnight incubation with either Ala–N-TIMP2_{WT, RGD} or cRGD (2 μm) and with a U87MG supernatant obtained after 48 h of growth, i.e. containing all the MMP-2 forms. Both Ala–N-TIMP2_{WT, RGD} and cRGD reduced the docking levels of pro-MMP-2 on integrin α_vβ₃ to a similar extent (∼57%, Fig. 4, E and F), whereas Ala–N-TIMP2_{WT, RGD} significantly inhibited the interaction of matured MMP-2 with integrin α_vβ₃ compared with cRGD treatment (66 and 42%, respectively, Fig. 4, E and G). The differences between the assay results can be explained by the fact that in the flow cytometry (Fig. 4A) recombinant matured MMP-2 was used, whereas in the zymography assays (Fig. 4, B–G) all the MMP-2 forms secreted from U87MG cells were present; among all these forms, matured MMP-2 constitutes only <5% (Fig. 3). Because the matured form binds integrin α_vβ₃, greater inhibition of MMP-2 cell-surface localization was observed in Fig. 4A compared with Fig. 4, B–G. In addition, Fig. 4, B–D, presents an assay performed on a U87MG cell lysate, which probably contains other binding receptors for MMP-2, whereas Fig. 4, E–G, shows an assay performed solely on the immobilized recombinant integrin α_vβ₃ receptor. Pro-MMP-2 can bind to other receptors on the cell surface, such as MMP-14 and lipoprotein receptor-related protein-2 (58), and therefore might not be affected by the binding of Ala–N-TIMP2_{WT, RGD} to integrin α_vβ₃. For this reason, only a small reduction was observed in Fig. 4, C and D (several integrins and MMP-14 being present), versus Fig. 4, F and G (integrin α_vβ₃ alone). Moreover, as mentioned previously, it is known that the form of MMP-2 that binds integrin α_vβ₃ is the mature form and not the pro-MMP-2 form. In Fig. 4, E–G, only integrin α_vβ₃ was present as a receptor in the system. Thus, there were no alternative receptors with which pro-MMP-2 could interact. Furthermore, whereas pro-MMP-2 was the dominant form of secreted MMP-2 (∼95%, Fig. 3), its binding to immobilized integrin α_vβ₃ was slightly higher than that of the mature form, which comprised less than 5% of the secreted MMP-2 forms. The above data thus attest to the preference in binding affinity of integrin α_vβ₃ for matured MMP-2 over pro-MMP-2.

Figure 4.

The Ala–N-TIMP2_{WT, RGD} variant disrupts matured MMP-2 cell-surface localization by binding to integrin α_vβ₃. A, Ala–N-TIMP2_{WT, RGD} removes matured MMP-2 from the U87MG cell surface as detected by flow cytometry analysis. A specific antibody against MMP-2 (clone CA-4001, Abcam) was utilized to detect MMP-2 on the U87MG cell surface. B, cell lysate gelatin zymography gel of untreated cells (left) and 2 μm treatment of Ala–N-TIMP2_{WT, RGD} (Ala, right). C, Ala–N-TIMP2_{WT, RGD} does not affect pro-MMP-2 localization on the cell surface. D, Ala–N-TIMP2_{WT, RGD} removes matured MMP-2 from the cell surface. E, integrin α_vβ₃–bound MMP-2 gelatin zymography gel of untreated cells and 2 μm treatment of Ala–N-TIMP2_{WT, RGD} and cRGD. F and G, Ala–N-TIMP2_{WT, RGD} and cRGD interfere with binding of pro-MMP-2 (F) and matured MMP-2 (G) to integrin α_vβ₃. The results were normalized to untreated cells. Error bars represent S.D. Statistical analysis was performed by Student's t test compared with the untreated control; ***, p < 0.0001, n = 3.

N-TIMP2 variants inhibit the invasion of U87MG cells

Because the invasiveness of cancer cells is influenced by the proteolytic activity of MMP-14 and by integrin α_vβ₃–mediated cell migration, the ability of the N-TIMP2 variants to inhibit the invasion of U87MG cells was evaluated in a Boyden chamber Matrigel® invasion assay (Fig. 5). In this assay, only the heterodimer, N-TIMP2_HD, and the mixture of N-TIMP2_5M and Ala–N-TIMP2_{WT, RGD} (Fig. 5, H, J and K) significantly inhibited the invasion of U87MG cells compared with untreated cells (Fig. 5, A and K), with the bi-specific N-TIMP2_HD heterodimer exhibiting the strongest inhibition effect (33% inhibition, Fig. 5, H and K). When U87MG cells were treated with a mixture of N-TIMP2_5M and Ala–N-TIMP2_{WT, RGD}, high inhibition activity was observed (26% inhibition, Fig. 5, I and K), although this inhibition activity was inferior to that of N-TIMP2_HD, as shown in Fig. 5. This superior inhibitory activity of N-TIMP2_HD over the mixture of N-TIMP2_5M and Ala–N-TIMP2_{WT, RGD} was statistically significant when the comparison was performed with untreated cells. However, when the two treatments were compared with one another, no statistically significant difference was observed (p = 0.1089). Compared with Ala–N-TIMP2_{WT, RGD} (Fig. 5G) and N-TIMP2_5M (Fig. 5D), each alone, N-TIMP2_HD exhibited a significantly stronger inhibition effect (Fig. 5K), a finding that implies a synergistic inhibition effect between N-TIMP2_5M and Ala–N-TIMP2_{WT, RGD}. This synergistic inhibition was also observed for the TIME cell line (Fig. 7, D, G, H, and J).

Figure 5.

Inhibition of invasion of U87MG cells by N-TIMP2 variants. A, untreated cells. Cells were treated with the following: N-TIMP2_WT (B); FL-TIMP2 (C); N-TIMP2_5M (D); N-TIMP2_{WT, RGD} (E); N-TIMP2_{5M, RGD} (F); Ala–N-TIMP2_{WT, RGD} (G); N-TIMP2_HD (H); N-TIMP2_5M and Ala–N-TIMP2_{WT, RGD} (I), and cRGD (J). K, quantification of invasive cells normalized to untreated cells. Error bars represent S.D. One-way ANOVA with Dunnett's multiple comparison with the untreated control was utilized for statistical analysis; *, p < 0.05; **, p < 0.005, n = 3. A comparison between treatment with N-TIMP2_HD versus all other treatments showed the statistically significant superior inhibition ability of N-TIMP2_HD when compared with N-TIMP2_WT, FL-TIMP2, and Ala–N-TIMP2_{WT, RGD} (p < 0.05), N-TIMP2_5M and cRGD (p < 0.005), and N-TIMP2_{5M, RGD} (p < 0.001).

Figure 7.

Inhibition of invasion of TIME cells by N-TIMP2 variants. A, untreated cells. B, N-TIMP2_WT. C, FL-TIMP2. D, N-TIMP2_5M. E, N-TIMP2_{WT, RGD}. F, N-TIMP2_{5M, RGD}. G, Ala–N-TIMP2_{WT, RGD}. H, N-TIMP2_HD. I, cRGD. J, quantification of invasive cells normalized to untreated cells. Error bars represent S.D. One-way ANOVA with Dunnett's multiple comparison with the untreated control was utilized for statistical analysis; **, p < 0.005; ***, p < 0.001, n = 3. A comparison between treatment with N-TIMP2_HD versus all other treatments showed the statistically significant superior inhibition of N-TIMP2_HD versus N-TIMP2_{WT, RGD}, N-TIMP2_{5M, RGD}, and Ala–N-TIMP2_{WT, RGD} (p < 0.05); N-TIMP2_WT and N-TIMP2_5M (p < 0.005); and FL-TIMP2 (p < 0.001).

N-TIMP2 variants inhibit in vitro angiogenesis in the TIME cell line

Endothelial cells form capillary-like structures when embedded in a Matrigel® matrix. This process, which simulates angiogenesis, involves endothelial cell migration, proliferation, and survival (59). Therefore, N-TIMP2 variants were evaluated for their ability to inhibit tube formation of TIME cells. Although FL-TIMP2 exhibited pro-angiogenic activity (Fig. 6, C, I, and J) and N-TIMP2_5M did not demonstrate any effect on angiogenesis (Fig. 6, D, I, and J) as compared with untreated cells (Fig. 6A), the other N-TIMP2 variants showed significant inhibition ability (Fig. 6, B and D–H). Compared with N-TIMP2_WT, which exhibits good anti-angiogenic activity (61% reduction in of the number of tube segments (Fig. 6, B and I) and 22% reduction in tube total length (Fig. 6J)), the strong integrin α_vβ₃ binders N-TIMP2_{WT, RGD} (82 and 35%, Fig. 6E), Ala–N-TIMP2_{WT, RGD} (92 and 56%, Fig. 6G), and N-TIMP2_HD (79 and 41%, Fig. 6H), exhibited a more pronounced inhibition effect. Moreover, whereas both N-TIMP2_RGD variants and N-TIMP2_WT did affect tube formation, at least in one parameter, i.e. tube total length or number of tube segments, cRGD (2 and 50 μm treatments) had no effect on tube formation (data not shown). In contrast to the strong MMP-14 inhibitor N-TIMP2_5M, N-TIMP2_WT, although having lower inhibition activity, exhibited strong inhibition of tube formation in TIME cells, a function that may not be related to MMP-14 inhibition but rather to its ability to activate integrin α₃β₁, previously shown to lead to inhibition of angiogenesis (60). Because specificity to integrin α_vβ₃ compared with other integrins was not tested, it should be noted that inhibition of tube formation might also be mediated by other RGD-binding integrins or integrin α₃β₁. Notably, the strong inhibition of tube formation seen for the strong integrin α_vβ₃ binders (i.e. N-TIMP2_{WT, RGD}, Ala–N-TIMP2_{WT, RGD}, and N-TIMP2_HD) indicates that integrin α_vβ₃ is a more important contributor than MMP-14 to tube formation. Furthermore, the agonistic effect of FL-TIMP2 may be due to pro-MMP-2 activation in TIME cells by FL-TIMP2 at a concentration of 2 μm, an effect previously shown by others (25, 56).

Figure 6.

Inhibition of tube formation by N-TIMP2 variants. A, untreated cells. B, N-TIMP2_WT. C, FL-TIMP2. D, N-TIMP2_5M. E, N-TIMP2_{WT, RGD}. F, N-TIMP2_{5M, RGD}. G, Ala–N-TIMP2_{WT, RGD}. H, N-TIMP2_HD. I, quantification of the number of tube segments normalized to untreated cells. J, quantification of tube total length normalized to untreated cells. Error bars represent S.D. Statistical analysis was performed by Student's t test compared with the untreated control; *, p < 0.05; ***, p < 0.0001, n = 6.

In angiogenesis, the invasion of endothelial cells is a crucial step that is mediated by both MMP-14 and integrin α_vβ₃. Thus, the ability of the N-TIMP2 variants to inhibit this process was evaluated in a Boyden chamber Matrigel® invasion assay (Fig. 7). Treatment with cRGD (Fig. 7I) significantly inhibited invasiveness in TIME cells, with 21% inhibition (Fig. 7J). Although none of the mono-specific variants significantly inhibited the invasion process, all the bi-specific variants, N-TIMP2_{WT, RGD} (Fig. 7E), N-TIMP2_{5M, RGD} (Fig. 7E) and N-TIMP2_HD (Fig. 7I), significantly inhibited this process, with 18, 14, and 28% of inhibition, respectively (Fig. 7J). Notably, in the invasion assay N-TIMP2_HD proved to be a superior inhibitor to the bi-specific monomers (i.e. N-TIMP2_{WT, RGD} and N-TIMP2_{5M, RGD}, p < 0.05) and to all the mono-specific proteins (i.e. N-TIMP2_WT, N-TIMP2_5M, and Ala–N-TIMP2_{WT, RGD}, p < 0.05).

N-TIMP2_HD inhibits U87MG xenograft tumor growth in mice

Nude mice bearing subcutaneous U87MG xenografts were injected intra-tumor with N-TIMP2_HD. The untreated control group was injected intra-tumor with PBS. The growth rate of the tumors was slower in the N-TIMP2_HD–treated group, thereby demonstrating the anti-tumor activity of the bi-specific protein in an in vivo model (Fig. 8).

Figure 8.

N-TIMP2_HD inhibits U87MG xenograft growth in mice. Tumor size in mice treated with 500 nm N-TIMP2_HD and in untreated (PBS) mice was monitored over 25 days. Measurements from days 4, 11, and 25 are shown. Each group contained five mice. At day 18, one mouse from the N-TIMP2_HD-treated group died during anesthesia. Error bars represent S.E. Statistical analysis was performed by Student's t test compared with the PBS-treated control; *, p < 0.05; **, p < 0.001.

Discussion

A potential risk in the therapeutic targeting of MMPs (and other enzymatic multifamilies) is that these proteins do not work in isolation but as part of complex enzymatic cascades, in which each MMP may cross-activate other MMPs and/or other proteins, which may compensate for their loss of function (61). An excellent example of such cross-reactivity is that of MMP-2 activation by MMP-14 (7, 21), a function that is facilitated by interaction of the former with integrin α_vβ₃ (21, 62, 63). Putative pathobiological roles have been ascribed to the MMP-14/MMP-2/integrin α_vβ₃ axis for a diverse array of cancers (20–22, 62), and this axis thus represents an attractive target for the development of novel cancer therapeutics.

We therefore evaluated the therapeutic potential of targeting this axis with novel bi-specific inhibitors acting against MMP-14 and integrin α_vβ₃. In parallel, studying these bi-specific inhibitors and their mono-specific counterparts allowed us to establish the roles of each target protein in important cancer pathways, such as MMP-2 activation, cancer, and endothelial cell invasion and tube formation.

From a practical point of view, the strength of dual-specificity targeting in anti-cancer therapeutics lies in its potential to abrogate the unwanted side effects of potent single-targeted MMP-14 or integrin α_vβ₃ inhibitors; such side effects are due to the roles that different MMPs and integrins play in homeostasis and other important normal biological functions, such as wound healing, cell adhesion, and cell differentiation (40, 64). It is likely that a dual-specific molecule would increase selectivity toward MMP-14 in preference to other MMPs via increased effective local concentrations due to the association of MMP-14 with integrin α_vβ₃. Moreover, a bi-specific inhibitor exhibiting synergistic effects only in cancerous tissues in which both MMP-14 and integrin α_vβ₃ are overexpressed and cross-react would contribute to target cell specificity. This notion is supported by the findings of Deryugina et al. (21) that MMP-14 and integrin α_vβ₃ are localized in close proximity on the cell surface, and their cross-reactivity and synergistic function strongly promote cancer cell invasion and maturation of pro-MMP-2 to active forms.

In keeping with the findings of Deryugina et al. (21), we showed by SPR that the bi-specific N-TIMP2 variants could simultaneously bind to MMP-14 and integrin α_vβ₃. We also showed that our wide range N-TIMP2 variants have different affinities and activities toward the two receptors (Table 1 and Fig. 2). A comparison of the inhibition of the two receptors separately and simultaneously aided us in defining the importance of the cross-talk between MMP-14 and integrin α_vβ₃ and in determining which of the two effectors plays the dominant role in a particular malignant process, namely MMP-2 activation, endothelial tube formation, and cancer cell invasion.

The superior inhibition of cancer and endothelial cell invasion by the heterodimeric variant N-TIMP2_HD (versus the mono-specific and other bi-specific monomers) may be attributed to its ability to bind both receptors with the highest affinity relative to the other engineered proteins. In N-TIMP2_HD (unlike in the other bi-specific N-TIMP2 monomers), the MMP-14 and integrin α_vβ₃ epitopes are relatively distant from one another, an arrangement that we believe allows optimal interaction with their respective targets. Indeed, the monomeric N-TIMP2_{WT, RGD}, which was less potent than N-TIMP2_HD in inhibiting cell invasion, showed decreased ability to simultaneously engage MMP-14 and integrin α_vβ₃ compared with N-TIMP2_HD (Fig. 2, E and F). In addition, the bi-specific N-TIMP2_HD was better than its mono-specific counterpart N-TIMP2_5M (solely a MMP-14 binder) in its ability to inhibit cellular MMP-2 activation and cell invasion (Figs. 3, 5, and 7), despite having MMP-14 binding and inhibition potencies similar to those of N-TIMP2_5M (Table 1). This finding is in agreement with the major role of integrin α_vβ₃ in MMP-2 activation, cell-surface localization, and cell invasion. The finding that N-TIMP2_HD was also a better inhibitor than Ala–N-TIMP2_{WT, RGD} (a strong integrin binder having reduced MMP-14 inhibition activity) illustrates the distinct contribution of MMP-14 to inhibiting MMP-2 activation and cell invasion. N-TIMP2_HD was also superior to N-TIMP2_5M and comparable with Ala–N-TIMP2_{WT, RGD} in its ability to inhibit tube formation; this finding indicates a more dominant role for integrin α_vβ₃ than MMP-14 in capillary tube formation. However, as described previously by Stratman et al. (65), in cellular three-dimensional and in vivo angiogenesis models, MMP-14 may also play a significant role in angiogenesis. Thus, it is possible that our engineered bi-specific variants could exhibit a superior effect to the mono-specific integrin α_vβ₃ binder in the inhibition of angiogenesis in vivo.

Compared with the bi-specific monomeric N-TIMP2_{5M, RGD}, Ala–N-TIMP2_{WT, RGD} exhibited inferior ability to inhibit MMP-2 activation, and N-TIMP2_5M exhibited reduced ability to inhibit the intermediate MMP-2 processing to the matured form (Fig. 3), despite their higher binding to integrin α_vβ₃ and MMP-14, respectively. This finding again highlights the utility of integrin α_vβ₃ and MMP-14 dual targeting for superior inhibition of MMP-2 activation/processing. Notably, N-TIMP2_HD exhibited better inhibition activity than N-TIMP2_{5M, RGD} in both MMP-2 activation/processing and biological assays, which supports our premise that distancing the mutated counterparts would result in better biochemical and biological inhibitory effects.

In contrast to N-TIMP2_HD, FL-TIMP2 exhibited agonistic activity in the endothelial tube formation assay (Fig. 6), which is probably due to the interaction of its C-terminal domain with the hemopexin of pro-MMP-2, thereby bringing pro-MMP-2 to the cell surface where it is activated by MMP-14 (26). At low concentrations, FL-TIMP2 serves as an MMP-2 activator, although at high concentrations it acts as an inhibitor due to its interaction with and inhibition of most MMP-14 receptors (Fig. S6) (25, 27, 56). Notably, the C-terminal domain is absent in the engineered N-TIMP2 variants, which does not allow them to activate MMP-2 and to act as agonists (66).

The difference between the zymography results (Fig. 3), in which FL-TIMP2 inhibited MMP-2 processing, and its agonistic activity in the tube formation assay may result from the different incubation times for these experiments (48 h for zymography and 18–20 h for the other assays). In the 48-h incubation, significant amounts of endogenous FL-TIMP2 could be produced, and the full-length protein could thus act as an inhibitor for MMP-14–induced MMP-2 activation (56, 67, 68). Shorter incubation times might result in lower FL-TIMP2 production, and the protein would thus act as an activator, as shown previously (56, 67, 68). Because FL-TIMP2 is endogenously expressed by cancer cells, our inhibitors can compete with it in binding to MMP-14, a process that would (i) inhibit pro-cancerous activity resulting from FL-TIMP2 activity at low concentrations, and (ii) occupy MMP-14 receptors, thereby lowering the concentrations at which FL-TIMP2 acts as an inhibitor. These actions, together with the direct inhibition of MMP-14 and integrin α_vβ₃, may provide additional benefits for our engineered variants in the inhibition of endothelial tube formation and cell invasion.

The influence of our N-TIMP2 variants on MMP-2 is perhaps best reflected in our findings that Ala–N-TIMP2_{WT, RGD} inhibited MMP-2 localization on the cell surface (Fig. 4). It is well known that matured MMP-2 is localized on the cell surface via integrin α_vβ₃ binding and that this docking increases cell invasiveness and angiogenesis (19, 29, 69). For technical reasons, we were not able to show that N-TIMP2_{WT, RGD} and N-TIMP2_HD have the same MMP-2 removal activity as Ala–N-TIMP2_{WT, RGD}. Nonetheless, it seems reasonable to extrapolate the inhibition of MMP-2 localization on the cell surface by Ala–N-TIMP2_{WT, RGD} to the bi-specific variants N-TIMP2_HD and N-TIMP2_{WT, RGD}, because these two variants are similar to Ala–N-TIMP2_{WT, RGD} in terms of integrin α_vβ₃ binding. We may therefore presume that N-TIMP2_HD will strongly inhibit MMP-2 activation and prevent the docking of the matured MMP-2 on the cell surface.

In summary, our results suggest that MMP-14 inhibition is related to pro-MMP-2 processing, whereas inhibition of integrin α_vβ₃ contributes to the inhibition of intermediate MMP-2 activation (Fig. 3 and Table 2). Inhibition of integrin α_vβ₃ also plays a significant role in hindering tube formation, as reflected in the finding that Ala–N-TIMP2_{WT, RGD}, N-TIMP2_{WT, RGD}, and N-TIMP2_HD were more active than N-TIMP2_{5M, RGD} and N-TIMP2_WT (Fig. 6 and Table 2). As we have shown here, tube formation is thus more closely influenced by integrin α_vβ₃ than by MMP-14 or MMP-2. In contrast, cell invasion is coupled to both integrin α_vβ₃ and MMP-14 activities, and simultaneous inhibition of the two receptors by N-TIMP2_HD results in superior inhibition (Figs. 5K and 7J and Table 2). In more specific terms, in addition to generating new molecules that bind MMP-14 and integrin α_vβ₃, this study has generated, for the first time, single molecules that successfully interfere with all the components of the MMP-14/MMP-2/integrin α_vβ₃ axis and inhibit their biological activity. The study therefore indicates the utility of initiating pre-clinical studies of our engineered MMP-14- and integrin α_vβ₃-binding N-TIMP2 variant proteins.

Table 2.

Summary of the variants' activities in different cellular assays

ND means inhibition was not detected.

Variant	Tube formation inhibitiona,b	Invasion inhibitionb of TIME cells	Invasion inhibitionb of U87MG cells	Matured MMP-2 percentagec	Intermediate MMP-2 percentage	Total active MMP-2
	%	%	%	%	%	%
FL-TIMP2	−10d	−11d	−5d	3	0.6	3.6
N-TIMP2WT	61	8	10	1.3	4.1	5.4
N-TIMP25M	1	8	8	2.5	0.5	3
N-TIMP2WT, RGD	82	18	20	2.3	4.7	7
N-TIMP25M, RGD	45	14	−2.5	1.7	1.1	2.8
Ala- N-TIMP2WT, RGD	92	8	13	2.4	4.9	7.3
N-TIMP2HD	79	28	33	1.6	0.4	2
cRGD	ND	21	12	2.8	3.5	6.3

^a Tube formation is measured as number of segments.

^b Percent of inhibition was compared with the untreated control.

^c For untreated cells, the percentages of the different MMP-2 forms are as follows: 3.9% for MMP-2 intermediate; 3.5% for MMP-2 matured; and 7.4% for total active MMP-2 (intermediate + matured).

^d − represents activation.

Viewing the findings of this study within the broader context of the current drive to develop targeted cancer therapies reveals the implications of our approach for the future. In broad terms, our study illustrates a protein engineering strategy for producing bi-specific protein monomers and heterodimers as selective tumor-targeting agents with therapeutic potential. Even more importantly, we foresee that our strategy will generate a technology that can be broadly applied to targeting membrane receptors and soluble antigens in a variety of diseases.

Experimental procedures

MMP-14_CAT protein production

The pET3a vector containing the human MMP-14 catalytic domain gene (MMP-14_CAT, residues 112–292) with a C-terminal His₆ tag (kindly provided by Irit Sagi, Weizmann Institute of Science, Israel) was expressed in Escherichia coli strain Bl21 (DE3) and purified as described previously (50). Following affinity chromatography using nickel-nitrilotriacetic acid-Sepharose beads (Invitrogen), CHAPS was added to a final concentration of 0.1% w/v, and the mixture was incubated for 3 days at 4 °C to digest the C-terminal hinge region of MMP-14 at residues 292–318. The protein was further purified on a gel-filtration Superdex 200 column (GE Healthcare) pre-equilibrated with buffer A (50 mm Tris, pH 7.5, 100 mm NaCl, 5 mm CaCl₂). The protein concentration was determined by UV-visible absorbance at 280 nm (extinction coefficient (ϵ₂₈₀) of 35,410 m⁻¹ cm⁻¹) using a NanoDrop spectrophotometer (ThermoFisher Scientific). The purity of the protein was determined by SDS-PAGE and MS analysis (MALDI-TOF Reflex-IV, Ilse Katz Institute for Nanoscale Science and Technology, BGU, Israel). MMP-14_CAT was labeled for 1 h at room temperature with DyLight-488 amine-reactive dye (ThermoFisher Scientific) in 0.05 m sodium borate buffer, pH 8.5, at a molar ratio of 1:5 (protein/dye). The labeled protein was washed free of unbound dye with buffer A in a Vivaspin (GE Healthcare) with a 5-kDa cutoff until no color was observed in the flow-through.

Construction and expression of yeast surface–displayed N-TIMP2_RGD library

Yeast surface display is a powerful directed evolution technology in which proteins are displayed on the yeast surface through genetic fusion to the yeast mating agglutinin protein Aga2p (70). Aga2p is disulfide-bonded to Aga1p, which is covalently linked to the yeast cell wall. The protein of interest is flanked by epitope tags, which are used to confirm expression of the construct on the yeast cell surface and to quantify surface expression levels. Fluorescence-activated cell sorting (FACS)-based high-throughput screening of tens of millions of yeast-displayed mutated proteins allows for the rapid isolation of variants with altered properties, such as increased target affinity. One of the benefits of yeast display over other protein engineering technologies, such as phage or mRNA display, is that multicolor FACS can be used to isolate clones with the desired target affinity by normalizing yeast expression levels with binding levels.

The pCTCON yeast surface display vector was digested and linearized with BamHI and Nhe-I. The N-TIMP2_WT gene was amplified using PCR with homologous primers for pCTCON plasmids. PCR assembly with overlapping primers was used to prepare an N-TIMP2_RGD library, in which positions 51–59 in N-TIMP2 were replaced with an RGD motif having three random amino acids flanking the motif on each side (underlined in the Ultra_RGD fragment, shown below). The assembly PCR products were amplified by PCR using homologous primers to the pCTCON construct: Fwd, 5′-GGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTAGCTGCAGCTGCTCCCCGGTG-3′, and Rev, 5′-GCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTCAGATGGATCTTGGAAAGCCAATGGTTTATCTGGCAAGGATCCCTCGCAGCCCATCTGGTACC-3′.

The amplified gene along with the digested pCTCON linear vector were transformed by electroporation into Saccharomyces cerevisiae strain EBY100 by using recombinant homology as described previously (71). The library size was 1.75 × 10⁷, as calculated by dilution plating on selective plates. The overlapping primers that were used for the assembly PCR were as follows: Ultra_1, 5′-TGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGAAGTG-3′; Ultra_2, 5′-GCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAG-3′; Ultra_RGD, 5′-GAGGATCCAGTATGAGATCAAGCAGATANNSNNSNNSAGGGGGGACNNSNNSNNSATAGAGTTTATCTACACGGCCCCCTC-3′, where n = A, C, T, or G and S = C or G; Ultra_3, 5′-CCTTCTTTCCTCCAACGTCCAGCGAGACCCCACACACTGCCGAGGAGGGGGCCGTGTAGATAAACTC-3′; Ultra_4, 5′-CACGATGAAGTCACAGAGGGTGATGTGCATCTTGCCGTCCCCCTCGGCCTTTCCTGCAATGAGATATTCCTTCTTTCCTCCAACGTCCAG-3′; and Ultra_5, 5′-CTCGCAGCCCATCTGGTACCTGTGGTTCAGGCTCTTCTTCTGGGTGGTGCTCAGGGTGTCCCAGGGCACGATGAAGTCACAGAGGGTG-3′.

Screening of the N-TIMP2_RGD library

The yeast-displayed N-TIMP2_RGD library was grown in selective medium (yeast nitrogen base (6.7 g/liter), Na₂HPO₄ (5.4 g/liter), NaH₂PO₄·H₂O (8.56 g/liter), dextrose (20 g/liter), Bacto Casamino acids (5 g/liter)) and induced for expression with galactose (20 g/liter), as described previously (72). Yeast cells, 2–20 × 10⁶, were sorted in each round against different concentrations of integrin α_vβ₃, as described previously with some modifications (4). Briefly, yeast cells were labeled with integrin α_vβ₃ (R&D Systems) and a 1:200 dilution of chicken anti-c-Myc antibody (Abcam) in integrin-binding buffer (IBB, 20 mm Tris, pH 7.5, 100 mm NaCl, 1 mm MgCl₂, 1 mm MnCl₂, 2 mm CaCl₂, and 1 mg/ml bovine serum albumin (BSA)) for 1 h at room temperature. Cells were washed and resuspended in ice-cold IBB containing a 1:25 dilution of FITC-labeled mouse anti-α_v integrin (BioLegend) and a 1:100 dilution of phycoerythrin (PE)-conjugated anti-chicken–IgY (Santa Cruz Biotechnology). After 30 min on ice, the cells were washed with IBB and sorted using a iCyt Synergy FACS apparatus (Sony Biotechnology). In the expression sort, only yeast cells expressing the intact N-TIMP2_RGD proteins were selected (using the anti-c-Myc antibody). For the subsequent integrin α_vβ₃ affinity sorts, the concentrations of integrin α_vβ₃ that were added to the yeast cells decreased with each sort, as follows: 500 nm (sorts 1 and 2), 200 nm (sort 3), 50 nm (sort 4), and 20 nm (sort 5). In each integrin–α_vβ₃–binding sort, 0.3–2% of the yeast high-affinity (normalized to expression) cell population was collected using a diagonal sorting gate. After each sort round, the yeast plasmid DNA was purified using the Zymoprep^TM yeast plasmid miniprep I kit (ZymoResearch). Thereafter, the plasmid was transformed into electrocompetent E. coli and grown overnight on ampicillin LB agar plates. Then, 20–40 colonies were transferred to ampicillin/LB culture medium and grown overnight at 37 °C. The plasmid was extracted from the bacteria using HiYield plasmid mini kit (RBC Bioscience) and was sequenced (Genetics Unit, National Institute of Biotechnology in the Negev, Ben-Gurion University of the Negev, Israel).

Construction of monomeric and dimeric N-TIMP2 variants

Using PCR, the alanine residue was added before Cys-1 of N-TIMP2_{WT, RGD} so as to generate a mono-specific integrin α_vβ₃-only binding variant (Ala–N-TIMP2_{WT, RGD}). The following primers were applied: alanine pPic Fwd, 5′-GGTATCTCTCGAGAAAAGAGCATGCAGCTGCTCCCCG-3′, and pPic Rev, 5′-GCTGGCGGCCGCCTCGCAGCCCATCTGGTA-3′. N-TIMP2_{5M, RGD} was generated by the insertion of the following five mutations into the N-TIMP2_{WT, RGD} gene: M35I, D38N, N68S, G71V, and R97H (Integrated DNA Technologies). N-TIMP2_HD comprising N-TIMP2_5M linked to N-TIMP2_{WT, RGD} with a flexible linker (SGGGGSGGGGSGGGGS) was generated by assembly PCR. First, the N-TIMP2_5M gene was amplified with the primers: pPic Fwd, 5′-GGTATCTCTCGAGAAAAGATGCAGCTGCTCCCCG-3′, and linker Rev, 5′-AGAACCACCACCACCAGAACCACCACCACCAGAACCACCACCACCACTCTCGCAGCCCATCTGGTACC-3′, generating the product N-TIMP2_5M-linker gene. The N-TIMP2_{WT, RGD} gene was amplified with the primers: Fwd linker, 5′-GGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTTGCAGCTGCTCCCCGGTG-3′, and pPic Rev, generating the product linker-N-TIMP2_{WT, RGD} gene. Then, assembly PCR was performed, using the linker–N-TIMP2_{WT, RGD} gene as the template and the N-TIMP2_5M–linker gene and pPic Rev as primers.

Production and purification of soluble N-TIMP2 proteins

N-TIMP2-soluble protein was produced by utilizing methylotrophic X33 Pichia pastoris according to the pPICZα protocol (Invitrogen) and as described previously with modifications (38). Briefly, the different N-TIMP2 genes were cloned into pPICZαA vector for expression in the X33 P. pastoris strain. Proteins were prepared with both c-Myc and His₆ tags at the C terminus for protein detection and purification, respectively. N-TIMP2 proteins were purified from the yeast growth medium by affinity column chromatography using nickel-nitrilotriacetic acid–Sepharose beads (Invitrogen) equilibrated in a mixture of 50 mm Tris, pH 7.5, 300 mm NaCl, and 10 mm imidazole and eluted with a mixture of 50 mm Tris, pH 7.5, 300 mm NaCl, and 300 mm imidazole. Thereafter, separation on a gel-filtration Superdex 75 column (GE Healthcare), equilibrated in 50 mm Tris, pH 7.5, 300 mm NaCl, and 5 mm CaCl₂ at a flow rate of 0.5 ml/min on an ÄKTA pure instrument, was performed. Protein size was verified by SDS-PAGE and MS analysis (Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Israel). Protein concentrations were determined by UV-visible absorbance at 280 nm, using a NanoDrop spectrophotometer (ϵ₂₈₀ of 13,325 m⁻¹ cm⁻¹ for N-TIMP2_WT, N-TIMP2_{WT, RGD}, Ala–N-TIMP2_{WT, RGD}, and N-TIMP2_{5M, RGD}, and 26,650 m⁻¹ cm⁻¹ for N-TIMP2_HD). Purification yields for all proteins were 0.2–4 mg/liter.

Surface plasmon resonance experiments

The binding between MMP-14_CAT and N-TIMP2 variants was detected using SPR spectroscopy on a ProteOn^TM XPR36 (Bio-Rad), as described previously (73) with modifications. Briefly, for MMP-14_CAT binding_, an HTG chip (Bio-Rad) was loaded with 150 μl of 10 mm NiSO₄ (pH 6.3) at a rate of 30 μl/min for 5 min. N-TIMP2 variants (0.0066–0.013 μg/μl, 150 μl) were then immobilized on the chip at a flow rate of 30 μl/min for 5 min; an empty channel was used as background. For determination of the affinity constants (K_D) of either N-TIMP2_{5M, RGD} or N-TIMP2_HD with MM-14_CAT, MMP-14_CAT was diluted in a mixture of 50 mm Tris, pH 7.5, 100 mm NaCl, and 5 mm CaCl₂ to 3.1, 6.3, 12.5, 25, or 50 nm. For N-TIMP2_{WT, RGD} and Ala–N-TIMP2_{WT, RGD}, the following concentrations of MM-14_CAT were used: 31.3, 62.5, 125, 250, and 500 nm_. The analyte, MMP-14_CAT, was allowed to flow over the chip at a flow rate of 25 μl/min for 981 s, followed by 20 min of dissociation. The response was monitored as a function of time at 25 °C, and the K_D values between the N-TIMP2 variants and MMP-14_CAT were determined. For measuring the binding constants between N-TIMP2 variants and integrin α_vβ₃, a GLC chip (Bio-Rad) was loaded with 150 μl of the amine-coupling reagents, 0.1 m N-hydroxysuccinimide and 0.4 m 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, at a rate of 30 μl/min for 5 min. Thereafter, 150 μl of 0.067 and 0.02 μg/μl of integrin α_vβ₃ and BSA, respectively, were immobilized to different channels at a flow rate of 30 μl/min for 5 min. The BSA channel was used as a control. N-TIMP2_{WT, RGD} was diluted in IBB, without BSA, to 12.5, 25, 50, 100, or 200 nm and allowed to flow over the chip at a flow rate of 30 μl/min for 818 s. N-TIMP2_{5M, RGD} was diluted to 9.4, 18.8, 37.5, 75, or 150 nm; Ala–N-TIMP2_{WT, RGD} was diluted to 12.5, 25, 50, 100, or 200 nm, and N-TIMP2_HD was diluted to 16.2, 32.4, 64.7, 129.4, or 258.8 nm. The three variants were allowed to flow over the chip at a rate of 40 μl/min for 613 s, followed by 20 min of dissociation. The K_D value between the N-TIMP2 variants and integrin α_vβ₃ was determined; the χ² values for all the analyses were less than 10%.

Dual receptor binding experiments with immobilized integrin α_vβ₃

Simultaneously, binding of N-TIMP2_{WT, RGD} and N-TIMP2_HDto both MMP-14 and integrin α_vβ₃ was tested using SPR. First, a GLC chip (Bio-Rad) was loaded with 0.02 μg/μl integrin α_vβ₃ and BSA as described previously. Then, IBB without BSA or 0.027 μg/μl of either N-TIMP2_{WT, RGD} or N-TIMP2_HD in IBB without BSA were allowed to flow over the chip at a flow rate of 30 μl/min for 300 s. Thereafter, 500 nm MMP-14 in IBB without BSA was allowed to flow over the chip at 30 μl/min for 437 s. The channel loaded with BSA served as a background control for integrin α_vβ₃ and MMP-14_CAT binding. Injections of IBB without BSA buffer followed by MMP-14_CAT in IBB without BSA served as a negative control. The dissociation of each complex in IBB without BSA was monitored for 600 s.

MMP-14_CAT inhibition studies

The K_m value for the purified MMP-14_CAT protein was determined by measuring MMP-14_CAT activity against different concentrations (0–25 μm) of the fluorogenic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH₂·TFA (Merck Millipore) and fitting the data to the Michaelis-Menten equation (Equation 1) using Prism (GraphPad Software). The calculated value of K_m (16.79 ± 4.986 μm) and its standard error (S.E.) are the average values that were obtained from three independent experiments.

The K_i determination was performed as described previously (38). The inhibition of the catalytic activity of MMP-14_CAT (0.005625 nm) against the fluorogenic substrate (7.5 μm) was tested using N-TIMP2_WT at 0.2–25 nm, N-TIMP2_{WT, RGD} and Ala–N-TIMP2_{WT, RGD} at 3.9–500 nm, and N-TIMP2_{5M, RGD} and N-TIMP2_HD at 0.0075–0.125 nm. The K_i calculation was performed by utilizing Morrison's equation (Equation 2), the classic competitive inhibition equation for tight binding, by using Prism (GraphPad Software). K_i and its S.E. values were the average values obtained from three independent experiments,

$$V=\frac{V_{\max }\left[\text{S}\right]}{K_m+\left[\text{S}\right]}$$ (Eq. 1)

where V is enzyme velocity; V_max is enzyme maximum velocity achieved at maximum substrate concentration; S is substrate concentration, and K_m is Michaelis-Menten constant,

$$\frac{V_i}{V_0}=1-\frac{\left(\left[E\right]+\left[\text{I}\right]+K_i^{\text{app}}\right)-\sqrt{{\left(\left[E\right]+\left[\text{I}\right]+K_i^{\text{app}}\right)}^2-4\left[E\right]\left[\text{I}\right]}}{2\left[E\right]}$$ (Eq. 2)

where V_i is enzyme velocity in the presence of inhibitor; V₀ is enzyme velocity in the absence of inhibitor; E is enzyme concentration; I is inhibitor concentration; S is substrate concentration; K_m is Michaelis-Menten constant, and K_i^app is the apparent inhibition constant, which is given by Equation 3,

$$K_i^{\text{app}}=K_i\left(1+\frac{\left[\text{S}\right]}{K_m}\right)$$ (Eq. 3)

where K_i is the inhibition constant.

Cell cultures

TIME cells (ATCC) were maintained in vascular cell basal medium (ATCC) supplemented with 2% fetal bovine serum (FBS) and growth factor supplements (ATCC). The U87MG glioblastoma cell line (ATCC) was maintained in DMEM (Biological Industries) supplemented with 10% FBS (ThermoFisher Scientific), 1% l-glutamine (Biological Industries), and 1% penicillin/streptomycin (Biological Industries).

MMP-14 and integrin α_vβ₃ expression in U87MG and TIME cell lines

MMP-14 and integrin α_vβ₃ expression on U87MG and TIME cells was evaluated using an Accuri C6 flow cytometer (BD Biosciences). For MMP-14 detection, rabbit anti-MMP-14 antibody (Abgent) was applied, followed by goat anti-rabbit IgG-PE staining (Santa Cruz Biotechnology). Integrin α_vβ₃ was detected using anti-integrin α_vβ₃ antibody FITC-conjugated (LM609, Chemicon).

Inhibition of MMP-2 activation

A gelatin zymography assay was utilized to assess the ability of N-TIMP2 variants and FL-TIMP2 (R&D Systems) to inhibit cellular MMP-2 activation. U87MG cells (1.9 × 10⁵) were grown on 96-well plates for 24 h. Then, cells were washed twice with serum-free DMEM and treated with 100 nm N-TIMP2 proteins in DMEM serum-free medium at 37 °C, 5% CO₂. In addition, different concentrations of FL-TIMP2 (1, 10, and 100 nm) and of cRGD (100 nm and 1 μm) were tested for their pro-MMP-2 activation activity. After 48 h, the medium was collected and centrifuged for 5 min at 10,000 × g. The medium was loaded on gelatin gel, washed for 1 h in 2.5% Triton X-100, and incubated overnight in a developer buffer (50 mm Tris, pH 7.4, 10 mm CaCl₂, and 0.02% NaN₃) at 37 °C, as described previously (74). Gels were stained with SimplyBlue^TM SafeStain (ThermoFisher Scientific) and captured with MiniBIS Pro (DNR Bio-Imaging Systems). The intensity of the white bands was quantified using ImageJ.

Inhibition of MMP-2 cell surface localization

Flow cytometry analysis was used to detect recombinant matured MMP-2 on the U87MG cell surface. U87MG cells were grown to 70–80% confluence. Cells (10⁵) were washed three times with IBB + 0.1% BSA, followed by 2 h of incubation with 100 nm recombinant matured MMP-2 (BioLegend) and 2 μm Ala–N-TIMP2_{WT, RGD} at 4 °C. Cells were washed three times with IBB + 0.1% BSA and then incubated with mouse monoclonal anti-MMP2 antibody (clone CA-4001, Abcam) for 1 h at 4 °C. Cells were washed three times with IBB + 0.1% BSA and were labeled for 30 min at 4 °C with PE-conjugated goat anti-mouse IgG (1:50 dilution, Sigma). Cells were washed three times with IBB + 0.1% BSA, and MMP-2 levels on cell surface were detected with an Accuri C6 flow cytometer (BD Biosciences).

To determine which form of MMP-2 was removed from the U87MG cell surface by Ala–N-TIMP2_{WT, RGD}, a cell lysate was subjected to gelatin zymography, as described previously (21). Briefly, U87MG cells (2 × 10⁵) were grown overnight on a 24-well plate. Then, the growth medium was replaced with a DMEM serum-free medium containing 2 μm Ala–N-TIMP2_{WT, RGD}. After a 48-h incubation, cells were washed three times with PBS. Thereafter, PBS (100 μl) was added to each well, and cells were scraped from the plate. Scraped cells from two wells were centrifuged, and the cell pellet was lysed with 35 μl of SDS sample buffer (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromphenol blue, and 0.125 m Tris HCl, pH 6.8) and incubated for 30 min at 37 °C. Thereafter, 50% glycerol (1:1 ratio) was added. The cell lysate (30 μl) was loaded on a gelatin gel, washed for 1 h in 2.5% Triton X-100, and incubated overnight in developer buffer at 37 °C.

To confirm that our inhibitor did indeed disrupt MMP-2 docking on integrin α_vβ₃, we utilized a solid-phase assay, as described previously (21). Wells of a 96-well ELISA plate were coated with 75 μl of integrin α_vβ₃ (2 μg/ml in PBS) and incubated overnight at 4 °C. The plate was washed three times with PBS, followed by blocking with 5% BSA. Then, 150 μl of U87MG serum-free medium obtained after 48 h of cell growth, which contained all the MMP-2 forms (pro/intermediate/matured), was added to each well, together with 2 μm of either Ala–N-TIMP2_{WT, RGD} or cRGD, and the plate was incubated overnight at 4 °C. The plate was washed three times with PBS. Thereafter, the bound MMP-2 was solubilized with 25 μl of SDS sample buffer, and the contents of the three wells were combined and loaded on gelatin zymography gels (30 μl). Gels were stained with SimplyBlue^TM SafeStain and captured with MiniBIS Pro. The bound MMP-2 was detected by the appearance of white bands, the intensity of which was quantified using ImageJ. All the assays of the inhibition of MMP-2 cell surface localization were performed in triplicate.

Boyden chamber invasion assay

An in vitro Boyden chamber assay was performed using ThinCert^TM 24-well inserts (Greiner Bio-One), as described previously with minor modifications (75). ThinCert^TM cell culture insert membranes were coated with Matrigel® diluted (1:30) with either DMEM without serum or vascular cell basal medium in the upper compartment. The lower compartment of the chamber was filled with 600 μl of either DMEM or vascular cell basal medium supplemented with 2% serum for U87MG or TIME cells, respectively. U87MG (1.5 × 10⁴) or TIME (2 × 10⁴) cells were treated with 100 nm N-TIMP2 variants in 200 μl of serum-free DMEM or 2 μm N-TIMP2 variants in 200 μl of vascular cell basal medium, respectively. A mixture of 100 nm of each N-TIMP2_{WT, RGD} and N-TIMP2_5M was also used as a treatment for the U87MG cell line. The treatments were added to the pre-coated ThinCert^TM cell culture inserts, which were then incubated for 20 h at 37 °C under 5% CO₂. Invasive cells were stained with Dipp Kwik Differential Stain Kit (American Mastertech Scientific) and were detected by EVOS FL Cell Imaging System (ThermoFisher Scientific) at ×20 magnification. The experiment was performed in triplicate; 15 fields were counted for each treatment, and the average of cells per field was determined.

Tube formation assay

A tube formation assay was utilized as described previously with minor modifications (76). Briefly, growth factor-reduced Matrigel® (GFR-Matrigel, Corning) was thawed overnight at 4 °C on ice. Thereafter, 150 μl of GFR-Matrigel were inserted into each well of 48-well plates, followed by centrifugation at 300 × g for 15 min at 4 °C and incubation at 37 °C for 1 h. TIME cells (3.25 × 10⁴) were then resuspended with 2 μm N-TIMP2 variants and FBS (2%) at a final volume of 200 μl, and the suspension was seeded on the Matrigel-coated plate. The plate was incubated at 37 °C under 5% CO₂ for 18 h and was monitored using EVOS FL Cell Imaging System at ×2 magnification. Six repetitions were performed, and the tube total lengths and the numbers of segments were analyzed and quantified using ImageJ Angiogenesis plug-in.

Xenograft model

U87MG cells (5 × 10⁶) in 100 μl of serum-free DMEM, in the presence or absence of 500 nm N-TIMP2_HD, were mixed with 100 μl of Matrigel and injected subcutaneously into 6-week-old male Hsd/athymic nude–Foxn1nu mice (Envigo), as described previously (77, 78). Tumor growth was monitored over 25 days. Tumor size was measured with a caliper three times a week, and each measurement was followed by an additional intra-tumor injection of 50 μl of PBS containing 500 nm N-TIMP2_HD to the treated group or 50 μl of PBS to the control group (a total of three injections per week for the entire experiment). Tumor volume was determined according to Equation 4,

$$V=\frac{L\times W^2}{2}$$ (Eq. 4)

where L is length, and W is width.

All the animal experiments were conducted using protocols approved by the Committee of Use and Care of Animals at Ben-Gurion University of the Negev, and the animals were housed and handled according to the Unit for Laboratory Animal Medicine guidelines at Ben-Gurion University.

Author contributions

G. Y. and V. A. data curation; G. Y. and N. P. formal analysis; G. Y. and N. P. validation; G. Y. and N. P. investigation; G. Y. and V. A. methodology; G. Y. and N. P. writing-original draft; G. Y., V. A., and N. P. writing-review and editing; N. P. conceptualization; N. P. resources; N. P. supervision; N. P. funding acquisition; N. P. visualization.