Abstract
Premise of the Study
Microsatellite primers were developed for the first time in the genus Filago (Gnaphalieae: Asteraceae). These markers will facilitate low‐scale phylogenetic, phylogeographic, and population genetic studies within the genus Filago.
Methods and Results
Ten pairs of polymorphic microsatellite primers (as well as five pairs of monomorphic primers) were identified and optimized on two species of Filago (F. gaditana and F. carpetana) using a microsatellite‐enrichment library method and 454 GS‐FLX technique. The polymorphic primers amplified tri‐ to hexanucleotide repeats and showed one to six alleles per locus for both species. Transferability was performed in 29 samples corresponding to nine representative species of Filago.
Conclusions
The results indicate the utility of the newly developed markers, which will be useful to delve into the phylogenetic relationships among the taxa within Filago. These microsatellites will enable studies of phylogeographic, reproductive, and genetic variation.
Keywords: Asteraceae, Evax, Filago, microsatellites
The genus Filago Loefl. ex L. (Asteraceae: Gnaphalieae) comprises ca. 45 species grouped into four subgenera (Galbany‐Cassals et al., 2010; Andrés‐Sánchez et al., 2011). It is composed of annual ephemeral plants that grow in open, often disturbed, dry habitats, but some species are stenoic and ecologically restricted to particular habitats such as salt marshes or small snowbeds at high altitudes. Some of the species are considered weeds (Carretero, 2004; Randall, 2007) and others are listed on either national or regional catalogs of endangered plants (Barreno et al., 1985; Moreno, 2008) due to their narrow distribution areas (Andrés‐Sánchez et al., 2013). Eight of the species traditionally included within the genus Evax Gaertn. represent a monophyletic group (hereafter named the Evax group) currently placed in Filago subg. Filago (Andrés‐Sánchez et al., 2015).
To develop microsatellite markers for Filago, we chose a small subclade within the Evax group, which includes F. carpetana (Lange) Chrtek & Holub and F. gaditana (Pau) Andrés‐Sánchez & Galbany. These species are characterized by disjunct distributions, restricted to the Iberian Peninsula and France, and to the Iberian Peninsula and northwestern Morocco, respectively. Considering that autogamy s.l. (i.e., including geitonogamy) has been frequently related to long‐distance dispersal and with the colonization of new areas (Obbard et al., 2006), these species represent a suitable model to develop biogeographic studies on annual plants in the western Mediterranean region (e.g., long‐distance dispersal events related to autogamy, effects of the absence of evident dispersal mechanisms). The development of codominant markers will allow for the collection of data on the prevalence of autogamy in the populations of Filago, as well as on gene flow.
Hypervariable genetic markers are also needed to overcome problems related to the scant variability detected in nuclear and plastid DNA markers (Galbany‐Cassals et al., 2010; Andrés‐Sánchez et al., 2015). The transferability of loci to other species would allow for the development of studies aimed to understand the phylogenetic relationships within the genus Filago.
METHODS AND RESULTS
Microsatellite development
Silica gel–dried leaf material from 11 samples of F. carpetana and F. gaditana were used for the preparation of the microsatellite library (Appendix 1). Total DNA was extracted following the cetyltrimethylammonium bromide (CTAB) extraction protocol (Doyle and Doyle, 1987) with minor modifications. The library was prepared by Genoscreen (Lille, France) and sequenced using a 454 GS‐FLX (Roche Diagnostics, Meylan, France) high‐throughput DNA sequencer (Malausa et al., 2011). The DNA was fragmented and enriched TG, TC, AAC, AAG, AGG, ACG, ACAT, and ACTC motifs. A total of 25,692 sequence reads were obtained (data available from the Dryad Digital Repository: https://doi.org/10.5061/dryad.94g0tc5; Gutiérrez‐Larruscain et al., 2018). These sequences were analyzed with the software QDD2 (Meglécz et al., 2014) revealing 3160 sequence reads with microsatellite motifs. From 63 primer pairs with A design (Meglécz et al., 2014), a total of 30 with low penalty values, different lengths, and repeat motifs were selected. These primers were ordered (Eurofins, Ebersberg, Germany) to check the variability of these loci in two samples of F. carpetana and two of F. gaditana. PCRs were performed in 12.5‐μL volume reactions, which contained 45.5 ng of DNA template, 1.25 μL of 1× PCR buffer (Biotools, Madrid, Spain), 1.5 mM MgCl2 (Biotools), 0.2 mM of each dNTP (Life Technologies, Carlsbad, California, USA), 0.33 mM of each primer, and 0.5 units of DNA Polymerase (Biotools). PCR was performed in an Eppendorf thermocycler (Mastercycler ProS; Eppendorf, Hamburg, Germany), using the following conditions: an initial denaturation step at 94°C for 2 min; followed by 30 cycles of 1 min at 94°C denaturation, 45 s at 55°C annealing, and 1 min 30 s at 72°C extension; with a final extension of 10 min at 72°C. PCR products were envisioned on a 2.5% agarose gel and sent to Macrogen Europe sequencing service (Amsterdam, The Netherlands). The obtained sequences were examined to assess homology and correct amplification. Fifteen primers were selected and tested in three populations of F. carpetana and three populations of F. gaditana (Appendix 1; primers discarded and reasons for discarding are shown in Appendix 2). The sequence‐specific forward primers were marked using the universal primer M13(–21) 5′‐TGTAAAACGACGGCCAGT‐3′ (Schuelke, 2000) labeled with 5‐FAM, VIC, NED, or PET fluorescent dyes (Table 1) (Life Technologies). The composition of the PCR mastermix for populations SA865 and SA1109 was as described above, except for the fluorescent‐labeled reverse primer (0.8 mM) and the forward primer (0.2 mM). For populations DP2044, DP2040, DG1052, and SA1218, PCRs were performed in 15‐μL volume reactions, which contained 45.5 ng of DNA, 3 μL of 1× Green GoTaq buffer (Promega Corporation, Madison, Wisconsin, USA), 0.2 mM of each dNTP, 0.04 mM of forward primer, 0.16 mM of fluorescent‐labeled reverse primer, 0.75 units of GoTaq polymerase (Promega Corporation), 0.7 μL of dimethyl sulfoxide (DMSO; Fisher Scientific, Hampton, New Hampshire, USA), and 0.3 μL of bovine serum albumin (BSA) 1 mg/mL (New England Biolabs, Ipswich, Massachusetts, USA). Regarding PCR conditions, annealing temperature was changed to 1 min at 52°C and extension temperature was changed to 50 s at 72°C for the first 30 cycles. The annealing temperature of the last 10 cycles was increased to 53°C. For the markers mf14 and mf25, the denaturation temperature was decreased to 83°C, and the annealing temperature was 52°C for 1 min for 35 cycles. The PCR products were run on an ABI 3730 Capillary Sequencer (Life Technologies) using GeneScan 500 LIZ Size Standard (Life Technologies). Electropherograms were analyzed with GeneMarker AFLP/Genotyping Software version 1.8 (SoftGenetics, State College, Pennsylvania, USA). Seven primers were discarded because they were monomorphic for all species analyzed or unspecific. In the cases that the expected sizes of the alleles were different than those obtained, the individuals were sequenced in order to identify indel presence.
Table 1.
Characteristics of 15 microsatellites amplified in Filago.a
| Locus | Primer sequences (5′–3′) | Fluorescent dye | Repeat motif | Allele size range (bp)b | T a (°C) | T d (°C) | GenBank accession no. |
|---|---|---|---|---|---|---|---|
| mf1c | F: ACCCACGAGTTAATATGCCG | FAM | (AAC)5 | 91 | 52–53 | 94 | KY792553 |
| R: TACTTAACCGGTCCCAGGC | |||||||
| mf3c | F: TGGATAAGGGATTTAGCATTGG | VIC | (ACC)5 | 121 | 52–53 | 94 | KY792554 |
| R: CGGTCGTTTGCTCGTTATCT | |||||||
| mf5 | F: GCAGAATCACATTCAACTCACG | NED | (AGAT)5 | 131–146 | 52–53 | 94 | KY792555 |
| R: ATGAGCTAGAGAAATAACTGATGTT | |||||||
| mf7c | F: TACCATTTGACCATGCGTTT | PET | (AAG)5 | 131 | 52–53 | 94 | KY792556 |
| R: CTTTCTTTGTGTTGTTCCTTCG | |||||||
| mf8 | F: TTCGGTTACTGTTGCATCTAGG | FAM | (AAG)6 | 150–171 | 52–53 | 94 | KY792557 |
| R: ATTAACCGGAGGAGTTTGGA | |||||||
| mf9 | F: ACTGAAGCGCGAACAATCTC | VIC | (AAG)6 | 154–169 | 52–53 | 94 | KY792558 |
| R: CCACTACAGATGACTCGGCA | |||||||
| mf10 | F: TATGTATCACGCGCCTATGG | NED | (AAGGTC)7 | 137–156 | 52–53 | 94 | KY792559 |
| R: CACTGTAAAGATCCGACGGC | |||||||
| mf12c | F: ATTGTTAGGGTTGGTGGTCG | PET | (ACC)5 | 144 | 52–53 | 94 | KY792560 |
| R: CAAACATTCCTGGGTATGGG | |||||||
| mf13 | F: GACTTCAAATCTGGATGAATTT | FAM | (AAG)8 | 146–171 | 52–53 | 94 | KY792561 |
| R: ACCATATGCACCGATTGATT | |||||||
| mf14 | F: CGACAGTAAATACTCATTGAACCA | VIC | (ACAT)5 | 161–181 | 52–53 | 83 | KY792562 |
| R: GGTATCTTTCGTCATGTAACATTCA | |||||||
| mf19 | F: TTTCTGAACCAAGATCGGTATTC | FAM | (AGAT)5 | 244–256 | 52–53 | 94 | KY792563 |
| R: TCGCTTTCTCCAGATCATCC | |||||||
| mf20c | F: CAATCCCAAATCTGAAGCGT | FAM | (AAC)5 | 236 | 52–53 | 94 | KY792564 |
| R: TTTGATTCTCCATGAGCAAGA | |||||||
| mf25 | F: ACACCACAAGGGCATGTGTA | FAM | (AAC)5 | 276–284 | 52–53 | 83 | KY792565 |
| R: TCTTGTCACTAAGTAGTCCTATCGC | |||||||
| mf26 | F: AATATGTCACCGTCGGGTTC | VIC | (AAC)5 | 289–300 | 52–53 | 94 | KY792566 |
| R: GTGTTCGGGTACAAATTCGG | |||||||
| mf28 | F: GGGAACTTGAACCATCATCC | VIC | (AAC)6 | 296–300 | 52–53 | 94 | KY792567 |
| R: TCCATATTAGCTACACTCCCTTCA |
T a = optimal annealing temperature; T d = optimal denaturation temperature.
All values are based on 60 samples from F. gaditana and F. carpetana.
Fragment size ranges do not include M13 tail.
Monomorphic loci.
Population genetic parameters in two species of Filago
The number of alleles per locus, levels of observed (H o) and expected heterozygosity (H e), significance of deviation from Hardy–Weinberg equilibrium (HWE; Table 2), and tests for linkage disequilibrium between markers were calculated using Arlequin version 3.5.1.2 (Excoffier and Lischer, 2010). The number of alleles ranged from one to six for both F. gaditana and F. carpetana. H o and H e values ranged from 0 to 1 and from 0.005 to 0.728, respectively, for all six populations. Deviation from HWE (P < 0.01) was detected in each population for all loci except for locus mf25. Discordant values of H o and H e and the subsequent deviation of HWE (except for locus mf25, which only was amplified for population SA1109) could be attributed to autogamy processes. Linkage disequilibrium was significant after Bonferroni correction for all pairwise comparisons except for those involving mf5 and mf14.
Table 2.
Results of initial primer screening of 10 polymorphic loci in six populationsa corresponding to two species of Filago
| Locus | F. carpetana DG1052 (n = 27) | F. carpetana SA1218 (n = 21) | F. carpetana SA1109 (n = 30) | F. gaditana SA865 (n = 30) | F. gaditana DP2044 (n = 27) | F. gaditana DP2040 (n = 28) | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | HWEb | A | H o | H e | HWEb | A | H o | H e | HWEb | A | H o | H e | HWEb | A | H o | H e | HWEb | A | H o | H e | HWEb | |
| mf5 | 1 | — | — | — | 1 | — | — | — | 2 | 0.000 | 0.131 | 0.001*** | 3 | 0.000 | 0.508 | 0.000*** | 2 | 0.000 | 0.492 | 0.000*** | 1 | — | — | — |
| mf8 | 2 | 1 | 0.509 | 0.000*** | 3 | 1 | 0.633 | 0.000*** | 6 | 1 | 0.687 | 0.000*** | 3 | 0.967 | 0.636 | 0.000*** | 2 | 1 | 0.509 | 0.000*** | 2 | 1 | 0.509 | 0.000*** |
| mf9 | 1 | — | — | — | 1 | — | — | — | 3 | 0.033 | 0.501 | 0.000*** | 5 | 0.000 | 0.653 | 0.000*** | 3 | 0.037 | 0.174 | 0.001*** | 1 | — | — | — |
| mf10 | 2 | 0.778 | 0.484 | 0.001*** | 4 | 0.619 | 0.728 | 0.000*** | 3 | 0.8667 | 0.005 | 0.000*** | 3 | 0.000 | 0.59 | 0.000*** | 1 | — | — | — | 1 | — | — | — |
| mf13 | 2 | 0.963 | 0.509 | 0.000*** | 2 | 0.762 | 0.483 | 0.000*** | 4 | 0.8 | 0.561 | 0.000*** | 6 | 0.933 | 0.656 | 0.005** | 2 | 0.037 | 0.465 | 0.000*** | 1 | — | — | — |
| mf14 | 2 | 0.037 | 0.372 | 0.000*** | 3 | 0 | 0.621 | 0.000*** | 3 | 0.067 | 0.337 | 0.000*** | 3 | 0.000 | 0.472 | 0.000*** | 2 | 0.000 | 0.462 | 0.000*** | 1 | — | — | — |
| mf19 | 2 | 0 | 0.391 | 0.000*** | 1 | — | — | — | 2 | 0.000 | 0.127 | 0.000*** | 2 | 0.000 | 0.452 | 0.000*** | 1 | — | — | — | 1 | — | — | — |
| mf25 | ‡ | ‡ | 4 | 0.433 | 0.367 | 1.000ns | 1 | — | — | — | 1 | — | — | — | 1 | — | — | — | ||||||
| mf26 | ‡ | ‡ | 5 | 0.033 | 0.536 | 0.000*** | 2 | 0.000 | 0.127 | 0.001*** | ‡ | ‡ | ||||||||||||
| mf28 | 2 | 1 | 0.508 | 0.000*** | 2 | 0.524 | 0.396 | 0.000*** | 3 | 0.000 | 0.513 | 0.000*** | 3 | 0.033 | 0.186 | 0.000*** | 2 | 1 | 0.509 | 0.000*** | 2 | 1 | 0.509 | 0.000*** |
— = no population genetic analyses were performed for monomorphic loci; A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium probabilities; n = number of individuals sampled.
aSee Appendix 1 for locality and voucher information for each population.
bDeviations from HWE were statistically significant at **P < 0.05 and ***P < 0.001. There were no values at P < 0.01. ns = not significant.
‡Unsuccessful amplification.
Cross‐amplification in other species from Filago
Cross‐amplification was tested in nine additional species (Table 3) representing the three other subgenera recovered within Filago by Galbany‐Casals et al. (2010). Except for mf5, mf9, mf10, and mf14, all other loci were amplified (Table 3) for all species included in cross‐amplification. More specific PCR protocols could improve these results.
Table 3.
Results of cross‐amplification of 10 polymorphic markers developed using Filago gaditana and F. carpetana within related Filago species.a
| Species | Collector no.b , c | mf5 | mf8 | mf9 | mf10 | mf13 | mf14 | mf19 | mf25 | mf26 | mf28 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Filago subg. Filago | |||||||||||
| F. albicans Andrés‐Sánchez, M. M. Mart. Ort. & E. Rico (Clade G) | SA202‐1 | 150 | 200 | 75 | — | 175 | — | 260 | 290 | 320 | 330 |
| SA202‐2 | 150 | 200 | 75 | — | 175 | — | 260 | 290 | 320 | 330 | |
| SA202‐3 | 150 | 200 | 75 | — | 175 | — | + | 290 | 320 | 330 | |
| F. petro‐ianii Rita & Dittrich (Clade H) | SA249‐2 | 100 | 200 | 75 | — | 200 | 200 | 260 | 290 | 300 | 330 |
| SA249‐3 | 100 | 200 | 75 | — | 200 | 200 | 260 | 290 | 300 | 330 | |
| SA249‐4 | — | — | — | — | — | — | — | — | — | — | |
| F. lusitanica (Samp.) P. Silva (Clade H) | SA1108‐1 | 142 | 150 | 163 | 143 | 146–152 | 223 | 255 | 278 | 289–299 | 296 |
| SA1108‐2 | 142 | 150 | 163 | 143 | 146–152 | 223 | 255 | 278 | 289–299 | 296 | |
| SA1108‐3 | 142 | 150 | 163 | 143 | 146–152 | 223 | 255 | 278 | 289–299 | 296 | |
| SA1108‐4 | 142 | 150 | 163 | 143 | 146–152 | 223 | 255 | 278 | 289–299 | 296 | |
| SA1108‐5 | 142 | 150 | 163 | 143 | 146–152 | 223 | 255 | 278 | 289–299 | 296 | |
| F. ramosissima Lange (Clade I) | SA1090‐21 | 150 | 200 | 75 | — | 175 | 200 | 260 | 290 | 300 | 330 |
| SA1090‐22 | 150 | 200 | 75 | — | 175 | 200 | 260 | 290 | 300 | 330 | |
| SA1090‐32 | 150 | 200 | — | — | 175 | + | 260 | 290 | 300 | 330 | |
| F. castroviejoi Andrés‐Sánchez, D. Gut. Larr., E. Rico & M. M. Mart. Ort. (Clade F) | SA1089‐14 | 150 | 200 | — | — | 150–200 | — | 260 | 280 | 300 | 330 |
| SA1089‐15 | 150 | 200 | — | 75 | 150–200 | — | 260 | 280 | 300 | 330 | |
| SA1089‐16 | 150 | 200 | — | — | 150–200 | — | 260 | 280 | 300 | 330 | |
| F. germanica (L.) Huds. (Clade D) | MG‐1 | 150 | 200 | — | — | 150–200 | 175 | 250 | 280 | 300 | 330 |
| MG‐2 | 150 | 200 | — | 75 | 150–175 | 175 | 250 | 280 | 300 | 330 | |
| MG‐3 | 150 | 200 | — | — | 150–175 | 175 | 250 | 280 | 300 | 330 | |
| Filago subg. Crocidion | |||||||||||
| F. crocidion (Pomel) Chrtek & Holub | DG731‐17 | — | 200 | — | — | 175 | — | 250 | 280 | 300 | 330 |
| DG731‐18 | — | 200 | — | — | 175 | — | 250 | 280 | 300 | 330 | |
| DG731‐19 | — | 200 | — | — | 175 | — | 250 | 280 | 300 | 330 | |
| Filago subg. Pseudevax | — | 200 | |||||||||
| F. hispanica (Degen & Hervier ex Pau) Chrtek & Holub | SA237‐1 | — | 200 | 75 | 75 | 160 | 220 | 260 | 300 | 175–320 | 330 |
| SA237‐2 | — | 200 | 75 | 75 | 160 | 220 | 260 | 300 | 175–320 | 330 | |
| SA237‐3 | — | 200 | 75 | — | 160 | 220 | 260 | 300 | 175–320 | 330 | |
| Filago subg. Oglifa | — | ||||||||||
| F. arvensis L. | BR128‐4 | — | 160 | — | — | 160 | — | 260 | — | — | — |
| BR128‐5 | — | 160 | — | — | 160 | — | 260 | 290 | — | 330 | |
| BR128‐6 | — | 160 | — | — | 160 | — | 260 | 290 | 320 | 330 |
— = no amplification; + = successful amplification.
Numbers shown represent the size in base pairs of the amplified fragments estimated by gel electrophoresis examination.
See Appendix 1 for locality and voucher information for each collector number.
DNA samples are deposited at Biobanco de ADN Vegetal, University of Salamanca, Salamanca, Spain. Specimens are deposited in the herbarium of the University of Salamanca (SALA; see Appendix 1).
CONCLUSIONS
A set of polymorphic microsatellite markers for the genus Filago is reported here for the first time. Cross‐species amplification suggests that these markers may have utility for the entire genus. They will allow the development of phylogenetic, phylogeographic, and population genetic studies, which can contribute valuable information for species conservation, as well as data on reproductive systems.
DATA ACCESSIBILITY
Sequence data for the 15 microsatellite loci were submitted to GenBank, and accession numbers are listed in Table 1. Sequence reads are available from the Dryad Digital Repository (https://doi.org/10.5061/dryad.94g0tc5; Gutiérrez‐Larruscain et al., 2018).
ACKNOWLEDGMENTS
This research was financially supported by the Spanish Ministerio de Economía y Competitividad (MINECO) through the projects CGL2009‐07555, CGL2012‐32574, and CGL2014‐52787‐C3‐2‐P. D.G.L. received funding from MINECO through a predoctoral grant (reference BES‐2015‐071270). The contract of T.M.F was also supported by MINECO (Tech. reference PTA2012‐7297‐I). The authors are grateful to Noemí Lopez and Daniel Pinto for lab support and suggestions on the data analyses.
Appendix 1. Voucher information for Filago samples used in this study.
| Species | n | Herbarium code (Collector no.)a , b | Locality | Geographic coordinates |
|---|---|---|---|---|
| Filago lusitanica (Samp.) P. Silva | 5 | SALA 157965 (SA1108) | Portugal: Terra de Miranda, Sequeiros | 41°09′00.8″N, 07°04′04.7″W |
| Filago gaditana (Pau) Andrés‐Sánchez & Galbany | 30 | SALA 157396 (SA865) | Morocco: Gharb‐Chrarda‐Béni‐Hssn, Moulay Bousselham | 34°52′51.2″N, 06°16′09.2″W |
| 27 | SALA 158014 (DP2044) | Spain: Pontevedra, Isla de Arousa | 42°31′55.1″N, 08°52′10.0″W | |
| 28 | SALA 158010 (DP2040) | Portugal: Setúbal, Santiago do Cacém | 38°04′11.6″N, 08°47′01.5″W | |
| 2 | SALA139213 (SA289 c) | Spain: Pontevedra, Isla de Arousa | 42°31′55.8″N, 08°52′09.4″W | |
| 3 | SALA 139214 (SA293 c) | Portugal: Minho, Esposense | 41°12′26.2″N, 08°25′13.4″W | |
| Filago carpetana (Lange) Chrtek & Holub | 30 | SALA 157952 (SA1109) | Spain: Salamanca, Masueco | 41°13′55.2″N, 06°35′04.2″W |
| 27 | SALA 162503 (DG1052) | Spain: Teruel, Frías de Albarracín | 40°17′37.19″N, 01°35′50.3″W | |
| 21 | SALA 162522 (SA1218) | Spain: Burgos, Cubillo del Campo | 42°08′37.3″N, 03°35′00.2″W | |
| 3 | SALA 110279 (LD1059 c) | Spain: Zamora, Galende | 42°07′15.0″N, 06°41′27.9″W | |
| 3 | SALA 134314 (MO1804 c) | Spain: Salamanca, San Miguel de Valero | 40°31′14.8″N, 05°54′23.7″W | |
| Filago arvensis L. | 3 | SALA 110288 (BR128) | Macedonia: Mavrovo, Bistra Planina | 41°43′12.3″N, 20°46′17.8″E |
| Filago albicans Andrés‐Sánchez, M. M. Mart. Ort. & E. Rico | 3 | SALA134823 (SA202) | Portugal: Alentejo, Ourique | 37°41′03.3″N, 08°19′10.3″W |
| Filago hispanica (Degen & Hervier ex Pau) Chrtek & Holub | 3 | SALA139140 (SA237) | Morocco: Ifrane, Tizi‐n‐Tretten | 33°25′43.3″N, 05°03′55.5″W |
| Filago petro‐ianii Rita & Dittrich | 3 | SALA 139206 (SA249) | Spain: Islas Baleares, Palma | 39°33′58.9″N, 02°50′13.9″E |
| Filago ramosissima Lange | 3 | SALA 156143 (SA1090) | Spain: Almería, Tabernas | 37°04′58.3″N, 02°19′07.2″W |
| Filago crocidion (Pomel) Chrtek & Holub | 3 | SALA 158953 (DG731) | Spain: Teruel, Frías de Albarracín | 40°19′43.1″N, 01°41′26.9″W |
| Filago castroviejoi Andrés‐Sánchez, D. Gut. Larr., E. Rico & M. M. Mart. Ort. | 3 | SALA 156142 (SA1089) | Spain: Almería, Tabernas | 37°04′58.3″N, 02°19′07.2″W |
| Filago germanica (L.) Huds. | 3 | SALA 160405 (MG) | Spain: Girona, Roses | 42°17′03.11″N, 03°10′53.05″W |
n = number of individuals sampled.
aHerbarium specimens are deposited at the herbarium of the University of Salamanca (SALA), Salamanca, Spain.
bAbbreviations (collector no.): BR = Blanca Rojas‐Andrés; DG = David Gutiérrez‐Larruscain; DP = Daniel Pinto Carrasco; LD = Luis Delgado; MG = Merçe Galbany; MO = M. Montserrat Martínez‐Ortega; SA = Santiago Andrés‐Sánchez.
cSpecimens used for the preparation of the microsatellite library.
Appendix 2. Primers rejected during the study and reasons for discarding.
| Locus | Primer sequences (5′–3′) | Repeat motif | PCR product size | T a (°C) | Reason for discarding |
|---|---|---|---|---|---|
| mf2 | F: GGCCTAGCTAGCAGATCCC | (AAG)6 | 120 | 52–53 | Unsuccessful amplification |
| R: TCTTCTCCGTCACGCCTC | |||||
| mf4 | F: GGCCTAGCTAGCAGAATCCA | (ACC)5 | 121 | 52–53 | Unsuccessful amplification |
| R: CCACCTGACGACCCACTAAT | |||||
| mf6 | F: GGCCTAGCTAGCAGAATCAA | (ACTCCT)5 | 129 | 52–53 | Unsuccessful amplification |
| R: TCCAGAAGTCTATCATCGTTATTG | |||||
| mf11 | F: GCTAGCAGAATCTCGGTTGG | (ACC)5 | 142 | 52–53 | Unsuccessful amplification |
| R: AGGAGGAACATCAATCCTCG | |||||
| mf15 | F: AGGCATTGTTAGGGTTGGTG | (ACC)5 | 148 | 52–53 | Unsuccessful amplification |
| R: CAAACATTCCTGGATATGGGA | |||||
| mf16 | F: GGCCTAGCTAGCAGAATCCA | (AAC)5 | 206 | 52–53 | Unsuccessful amplification |
| R: TCCTGTAACCGGCATTCCT | |||||
| mf17 | F: GCCTAGCTAGCAGAATCCGA | (AAC)7 | 208 | 52–53 | Unsuccessful amplification |
| R: TGGTAAGGGTCTTCCTCATACAA | |||||
| mf18 | F: AGGCCTAGCTAGCAGAATCAA | (AAATG)6 | 231 | 52–53 | Unsuccessful amplification |
| R: AAGGTGTTACCACTAGTCAGCTTG | |||||
| mf21 | F: ACCCGAATGCATCAGGTAAC | (AGC)5 | 240 | 52–53 | Unsuccessful amplification |
| R: CCCGAGATTTCTCAACGTCT | |||||
| mf22 | F: CACGTTGCAGCTAGCGTTAT | (AGG)6 | 253 | 52–53 | Unsuccessful amplification |
| R: CGATACACATGGAGCACGTC | |||||
| mf23 | F: GGCCTAGCTAGCAGAATCTACC | (AAC)5 | 257 | 52–53 | Unsuccessful amplification |
| R: GGTTTGGGTGAGTTGAGCAT | |||||
| mf24 | F: AAGGCCTAGCTAGCAGAATCAA | (AAC)5 | 260 | 52–53 | Unsuccessful amplification |
| R: TGAGCAAGATTAGAAGTACCCTCA | |||||
| mf27 | F: GTTTAAGGCCTAGCTAGCAGAA | (AAG)6 | 280 | 52–53 | Unsuccessful amplification |
| R: TGGTGGTTATAACGGAGAATGG | |||||
| mf29 | F: CACCATCCTTTCAAACACCC | (AAC)6 | 281 | 52–53 | Unsuccessful amplification |
| R: AAGCTTCCTGAAGGCGAAA | |||||
| mf30 | F: AAGGCCTAGCTAGCAGAATCTC | (AAC)8 | 406 | 52–53 | Unsuccessful amplification |
| R: GTGGTCGGTTGCTCGTTATC |
T a = annealing temperature.
Gutiérrez‐Larruscain, D. , Malvar Ferreras T., Martínez‐Ortega M. M., Rico E., and Andrés‐Sánchez S.. 2018. SSR markers for Filago subg. Filago (Gnaphalieae: Asteraceae) and cross‐amplification in three other subgenera. Applications in Plant Sciences 6(8): e1171.
LITERATURE CITED
- Andrés‐Sánchez, S. , Galbany‐Casals M., Rico E., and Martínez‐Ortega M. M.. 2011. A nomenclatural treatment for Logfia Cass. and Filago L. (Asteraceae) as newly circumscribed. Typification of several names. Taxon 60: 572–576. [Google Scholar]
- Andrés‐Sánchez, S. , Martínez‐Ortega M. M., and Rico E.. 2013. Estudio corológico del género Filago L. (Asteraceae, Gnaphalieae) en la Península Ibérica y Baleares. Botanica Complutensis 37: 57–78. [Google Scholar]
- Andrés‐Sánchez, S. , Galbany‐Casals M., Bergmeier E., Rico E., and Martínez‐Ortega M. M.. 2015. Systematic significance and evolutionary dynamics of the achene twin hairs in Filago L. (Asteraceae, Gnaphalieae) and related genera: Further evidence of morphological homoplasy. Plant Systematics and Evolution 301: 1653–1668. [Google Scholar]
- Barreno, E. , Bramwell D., Cabezudo B., Cardona M. A., Costa M., Fernández Casas J., Fernández‐Galiano E., et al. 1985. Listado de las plantas endémicas, raras o amenazadas de España. Información Ambiental 3: 48–71. [Google Scholar]
- Carretero, J. L. 2004. Flora arvense española. Las malas hierbas de los cultivos españoles. Phytoma‐España S. L., Valencia, Spain.
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Excoffier, L. , and Lischer H. E. L.. 2010. Arlequin suite version 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10: 564–567. [DOI] [PubMed] [Google Scholar]
- Galbany‐Cassals, M. , Andrés‐Sánchez S., García‐Jacas N., Susanna A., Rico E., and Martínez‐Ortega M. M.. 2010. How many of Cassini anagrams should there be? Molecular systematics and phylogenetic relationships in the “Filago groups” (Asteraceae, Gnaphalieae), with special focus on the genus Filago . Taxon 59: 1671–1689. [Google Scholar]
- Gutiérrez‐Larruscain, D. , Malvar Ferreras T., Martínez‐Ortega M. M., Rico E., and Andrés‐Sánchez S.. 2018. Data from: SSR markers for Filago subg. Filago (Gnaphalieae: Asteraceae) and cross‐amplification in three other subgenera. Dryad Digital Repository. 10.5061/dryad.94g0tc5 [DOI] [PMC free article] [PubMed]
- Malausa, T. , Gilles A., Meglécz E., Blanquart H., Duthoy S., Costedoat C., Dubut V., et al. 2011. High‐throughput microsatellite isolation through 454 GS‐FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources 11: 638–644. [DOI] [PubMed] [Google Scholar]
- Meglécz, E. , Pech N., Gilles A., Dubut V., Hingamp P., Trilles A., Grenier R., and Martin J. F.. 2014. QDD version 3.1: A user friendly computer program for microsatellite selection and primer design revisited: Experimental validation of variables determining genotyping success rate. Molecular Ecology Resources 14(6): 1302–1313. [DOI] [PubMed] [Google Scholar]
- Moreno, J. C. [ed.]. 2008. Lista Roja 2008 de la flora vascular española. Dirección General de Medio Natural y Política Forestal (Ministerio de Medio Ambiente, y Medio Rural y Marino, y Sociedad Española de Biología de la Conservación de Plantas), Madrid, Spain.
- Obbard, D. J. , Harris S. A., and Pannell J. R.. 2006. Sexual systems and population genetic structure in an annual plant: Testing the metapopulation model. American Naturalist 167: 354–366. [DOI] [PubMed] [Google Scholar]
- Randall, R. P. 2007. Global compendium of weeds. Website http://www.hear.org/gcw/ [accessed 20 July 2018].
- Schuelke, M. 2000. An economic method for the fluorescent labelling of PCR fragments. Nature Biotechnology 18: 233–234. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence data for the 15 microsatellite loci were submitted to GenBank, and accession numbers are listed in Table 1. Sequence reads are available from the Dryad Digital Repository (https://doi.org/10.5061/dryad.94g0tc5; Gutiérrez‐Larruscain et al., 2018).