Skip to main content
Toxicology Research logoLink to Toxicology Research
. 2018 May 31;7(5):913–922. doi: 10.1039/c8tx00065d

Triazophos-induced toxicity in zebrafish: miRNA-217 inhibits nup43

Longlue Jia a,, Danyan Zhang a,, Hannian Huang b, Yongyong Zhou a, Shengli Zhou c, Jiangfeng Guo a,
PMCID: PMC6116809  PMID: 30310668

graphic file with name c8tx00065d-ga.jpgTriazophos is a highly toxic organophosphorus pesticide, causing acute toxicity to brain tissue, and neurotoxicity and embryotoxicity to animals.

Abstract

Triazophos is a highly toxic organophosphorus pesticide, causing acute toxicity to brain tissue, and neurotoxicity and embryotoxicity to animals. Therefore, triazophos is considered as a public health problem due to its acute hazard index. MicroRNAs (miRNAs), a class of endogenous noncoding RNAs, can regulate the expression of target gene(s) by mediating mRNA cleavage or translational repression in organisms exposed to environmental chemicals. We found that nup43 is targeted by miR-217, which was significantly regulated in adult zebrafish (Danio rerio) exposed to triazophos (phenyl-1,2,4-triazolyl-3-(o,o-diethyl thionophosphate)). The expression of nup43 in both mRNA and protein levels was downregulated in a dose-dependent manner upon stimulation with triazophos. A dual luciferase reporter assay demonstrated that miR-217 interacted with the 3′-untranslated regions (3′-UTR) of nup43. The expression of nup43 in both mRNA and protein level was reduced in ZF4 cells when transfected with an miR-217 mimic, but increased when transfected with an miR-217 inhibitor. As a result, nup43 is targeted by miR-217 upon triazophos exposure. We suggest that miR-217 could be a potential toxicological biomarker for triazophos.

1. Introduction

MicroRNAs (miRNAs) are a class of small (19–24 nt long) endogenous noncoding RNAs that play important gene regulatory roles in animals and plants by pairing to protein-coding genes to direct their post-transcriptional repression.1 Genetic variations mapping to 3′-UTRs may overlap with miRNA binding sites, therefore potentially causing translation inhibition or mRNA degradation. This sequence complementarity involves the so-called miRNA seed sequence, a 6 or 7 nt matching region of 3′-UTR at the 5′-end of miRNAs, which is essential for effective function of miRNA. Regardless of where the seed sequence is located, it is clear that 3′-UTR polymorphisms overlapping with seed sequences can interfere with miRNA ligation, potentially disrupting or creating miRNA binding sites.1 They act by binding to the 3′-UTR of target mRNA, leading to either degradation of mRNA or repression of protein translation.2

MiRNAs may regulate a wide range of biological processes, including signal transduction, cell identity, growth, and developmental patterning, by targeting mRNAs.3 Increasing evidence has shown that miRNAs regulate almost 60% of protein-coding genes in humans and participate in the regulation of almost every cellular process, including keratinocyte proliferation and differentiation.4,5 Evidence suggests that miRNAs and mRNAs collectively interact in gene regulatory networks. The collective relationships between groups of miRNAs and groups of mRNAs may be more readily interpreted than those between individual miRNAs and mRNAs, and thus are useful for gaining insight into gene regulation.6

MiRNA expression would be readily changed in an organism after acute or chronic exposure to chemicals, which indicates that miRNAs play important roles in the toxicological process. Our previous study indicated that the expression levels of miR-216b and miR-499 in zebrafish were downregulated after exposure to increasing concentrations of fipronil.7MiR-124 and miR-499 were differentially expressed in zebrafish treated with β-diketone antibiotics.8 Paul and his co-workers found that a total of 20 and 11 miRNAs were differentially expressed in the human breast cancer MCF-7 cell line after 3 h and 48 h exposure to nonylphenol, respectively, and a total of 14 and 47 miRNAs were differentially expressed in the human hepatocellular carcinoma HepG2 cell line after 3 h and 48 h exposure to nonylphenol, respectively.9 Acetaminophen and CCl4 both significantly increased the urinary levels of 44 and 28 miRNAs in rats, respectively, and 10 of the increased miRNAs exhibited commonality between acetaminophen and CCl4 treatment. It was concluded that the patterns of urinary miRNA may hold promise as biomarkers of hepatotoxicant-induced liver injury.10 The exposure of adult mice to benzo(a)pyrene (BaP) resulted in the downregulation of miR-150, miR-142-5p, and miR-122 and the upregulation of miR-34c, miR-34b-5p, and miR-29b, which were the main pathways affected at the mRNA level.11

MiR-217 is a typical multi-functional gene, and it is a well-known tumor suppressor. MiR-217 was recently widely studied in various cancers, and increasingly recognized in proliferation, migration,12 ethanol-induced hepatic inflammation,13 and metabolic disorders.14 Its downregulation has been shown in a wide range of solid and leukaemic cancers, including pancreatic cancer,15 lung cancer,16 HIV-1,17 gastric cancer, osteosarcoma, and chronic myelogenous leukemia.18 Our previous studies indicated that the expression of miR-217 in zebrafish was downregulated after exposure to triazophos.19 However, the regulatory mechanism of miR-217 in zebrafish exposed to triazophos has not been clearly understood.

The protein NPCs (nuclear pore complexes) form nuclear pores that cross the nuclear envelope and allow molecules to transport between the nucleus and the cytoplasm. Xu and co-workers solved the crystal structure of human Nup43(hNUP43), an important component in the Nup107 subcomplex of NPC.20 In addition to participating in the transit of macromolecules through the nucleus, Nup107 is also involved in the cell cycle, apoptosis, and signal transduction, playing a role in the “transit” in the process of life.2123 Nup107 has been identified in highly and weakly invasive, early-onset steroid-resistant nephrotic syndrome, and metastatic pancreatic cancer cells. Tan and co-workers found a markedly decreased level of Nup107, a key scaffold protein in nuclear pore complex assembly, in senescent human diploid fibroblasts as well as in the organs of aged mice.2426 All three different algorithms, miRBase, MicroCosm Targets, and TargetScanFish, indicated that nup43 was a highly possible target of miR-217. However, the interaction between miR-217 and nup43 has not yet been experimentally validated.

Triazophos, a broad-spectrum organophosphorus pesticide, inhibits acetylcholinesterase activity, which leads to nervous system function damage of insects.27 Triazophos might induce a neurotoxic effect and oxidative damage in goldfish, and the goldfish brain should be a critical target for triazophos-induced damage.28 In female Wistar rats, triazophos exposure may lead to a number of pathophysiological conditions in female rats, with increased severity at high doses.29 Triazophos was likely a risk to the early development of the minnow Gobiocypris rarus, which is helpful in better understanding the toxicity induced by triazophos in fish embryos and larvae.30 The mechanisms for the stimulation of reproduction induced by pesticides are indicated by increases in the protein and RNA content of the ovary and fat body of adult females.31 Triazophos has a long half-life period and hard-degradation mechanism, thus leading to environmental pollution and side effects on aquatic biota. Moreover, triazophos could pose harm to human health through food chains by damaging metabolic enzymes, immunity-related genes, and membrane proteins of non-target organisms.32 Triazophos in tomatoes contributed 70.8% to the acute hazard index (aHI), which may be considered a public health problem.33

Zebrafish are used as the predominant test model for toxicological studies. Its genome size is approximately 20 to 40% of the mammalian genome, making it the only vertebrate available for large-scale mutagenesis. The maturation of this fish occurs in only 2–3 months, which is time-saving and relatively less laborious for generating transgenic lines.34 These mutagenesis studies have recently utilized a variety of stimuli including, but not limited to, genetic manipulations, pharmaceutical products, and environmental toxins.

In the current study, adult zebrafish were exposed to low doses of triazophos for 96 h, and then, the effects of triazophos on miR-217 and nup43 expression were investigated, as well as the possibility that miR-217 could affect the expression of nup43 by targeting 3′-UTR's seed sequence. The purpose of this study was to experimentally determine the aberrant expression of miR-217 and its target and the direct interaction between miR-217 and its target gene nup43. These data will provide a better understanding of the molecular mechanisms involved in the toxicological effects of triazophos.

2. Materials and methods

2.1. Chemicals

Triazophos TC (95%) was provided by Germany Bayor (China), and a stock solution was prepared by dissolving it in a mixture of polyethylene glycol, anhydrous ethanol, and n-butyl alcohol and storing at 4 °C. Cell culture media, fetal bovine serum (FBS), and antibiotics were obtained from Gibco BRL (Gaithersburg, MD, USA). The primary antibody against nup43 was purchased from Huaan Biotechnology (Hangzhou, China), and β-actin and anti-rabbit secondary antibody were purchased from GS Biosciences (Biosharp, St Louis, MO, USA). All other chemicals used in this study were of analytical grade.

2.2. Animals and cell lines

Adult zebrafish of the wild-type (AB strain), 2.5 ± 0.5 cm in length, were maintained in flow-through system glass tanks at 22 °C ± 1 °C, with a light/dark cycle of 14 h/10 h. Tap water was treated by the removal of chlorine, solid granule-filtering, and by a disinfection system. Fish were fed twice daily with freshly hatched brine shrimp and were not fed in the last 24 h before the experiment. The human embryonic kidney cell line 293T was obtained from Zhejiang University, Hangzhou, China. The zebrafish embryo ZF4 cell line was donated by Hangzhou Hibio Biotech, Zhejiang, China.

2.3. Exposure

Zebrafish were exposed to triazophos according to Organization for Economic Cooperation and Development (OECD) Guideline no. 203 at the following concentrations: 0, 0.45, 0.9, 1.8, and 3.6 μg mL–1, which were based on our previous study.19 Ten fish were used for each concentration and for the polyethylene glycol, anhydrous ethanol, and n-butyl alcohol solvent control (CK) 0.01% (v/v). The methods of fish preparation and RNA extraction were also the same as those of our previous study.19 After a 96 h exposure, zebrafish was sampled and instantly frozen in liquid nitrogen and then stored at –80 °C for further analysis. All animals were handled in strict accordance with good animal practice as defined by national guidelines for ethical review of animal welfare (GB/T 35892-2018), and all animal work was approved by the Animal Ethical Committee of our university.

2.4. RNA extraction and quantitative real-time PCR (qRT-PCR)

The total RNA in zebrafish was extracted with the RNAmisi microRNA purification kit (Aidlab Biotechnologies, Beijing, China) following the manufacturer's instructions. The quality and quantity of RNA were evaluated with a NanoDrop spectrophotometer (ND-3000; NanoDropTechnologies, DE, USA), and RNA integrity was examined with formaldehyde denaturing agarose gel electrophoresis.

For detection of miR-217 expression, stem-loop primers were designed with Primer 5.0 software (Premier Biosoft International, Canada) (Table 1). RNA reverse transcription was performed with 1000 ng of total RNA using Moloney-murine leukemia virus reverse transcriptase (M-MLV RT) (Takara, Dalian, China) in 20 μL of product, and 2 μL of the product was reserved for qRT-PCR. qRT-PCR was performed using the SYBR Premix Ex Taq™ II PCR kit (Takara, Dalian, China) and analysed using an ABI StepOnePlus™ Real-Time PCR System (PerkinElmer Applied Biosystems, CA, USA). The qRT-PCR cycles used were denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. Melting temperature-determining dissociation was performed at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s after the amplification phase. The relative expression was determined using the ΔΔCT method, and expression values were normalized to β-actin.

Table 1. Primers used for real-time PCR analysis.

Gene name Primer name Sequence (5′ → 3′) Length (nt) Product size (bp)
miR-217 FP GCCGTACTGCATCAGGAAC 19 58
RP GCAGGGTCCGAGGTATTC 18
S-L-P GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCAATC 50
nup43 FP GTCCTGAAATAGTGTCCGTGGGT 23 275
RP TATGTGCTGCTGGTTTGGGTGT 22
β-Actin FP GCCCATCTATGAGGGTTACGC 21 109
RP GCTTTAGCCACGCTCGGTC 19

For detection of mRNA of nup43, qRT-PCR was performed using a SYBR Premix Ex TaqTM II PCR kit (Takara, Dalian, China). β-Actin was used to normalize the expression level of mRNA. Primers for nup43 mRNA were designed using Primer 5.0 software (Premier Biosoft International, Canada). All qRT-PCR reactions were performed in triplicate.

2.5. Bioinformatics analysis

The computational algorithm prediction of TargetScanFish 6.2 (http://www.targetscan.org/fish_62/), Microcosm Targets (; http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/#), and MiRNAmap (; http://mirnamap.mbc.nctu.edu.tw/html/search.html) indicates that nup43 is highly possibly targeted by miR-217.

2.6. Cell culture and miRNA transfection

293 T cells were cultured with Dulbecco's modified Eagle's medium (DMEM)-high glucose medium containing 10% FBS, 100 U mL–1 penicillin, and 100 μg mL–1 streptomycin, at 37 °C in a humidified atmosphere of 95% air/5% CO2. ZF4 cells were grown in DMEM/F12 medium containing 10% FBS, 100 U mL–1 penicillin, and 100 μg mL–1 streptomycin, at 28 °C in a humidified atmosphere of 95% air/5% CO2. The miR-217 mimic, micrOFFTM miR-217 inhibitor (miR-217 inhibitor), CTRL–, and micrOFF mimic negative control (CTRL+) were chemically synthesized by RiboBio (Guangzhou, China). Cells were transfected using Lipofectamine™ 2000 transfection agent (Invitrogen, USA). Briefly, the transfection agent was diluted in medium and incubated for 5 min at room temperature. Also in this same medium, MiRNA mimic was diluted to a final concentration of 50 nM, miRNA inhibitors were diluted to a final concentration of 150 nM, and then the two were combined with the transfection agent and incubated for 20 min at room temperature. Transfection mixtures were added to the cell culture plate. Three separate transfections were performed, and each was analyzed in triplicate. Transfection efficiency was confirmed using TRACER™ Fluorescent Oligo (RiboBio, Guangzhou, China).

2.7. Luciferase reporter assay

The 3′-UTR of nup43 was amplified by PCR from zebrafish genomic DNA and then cloned into the pRL-TK vector (Promega, Madison, WI, USA) downstream of the stop codon of the luciferase gene between XbaI and NotI, named as pRL/S-UTR. The putative miR-217 binding site of the nup43 3′-UTR was deleted using overlap-extension PCR, and was named as pRL/S-K·O-217 (Table 2). For the luciferase assay, 1 × 105 293T cells were seeded in 24-well plates. On the second day, empty pRL-TK luciferase and recombinant plasmids (800 ng each) were individually co-transfected with the pGL3-control vector (40 ng) into 293T cells, along with 50 nM miR-217 mimic or 50 nM mimic negative control (CTRL+) using Lipofectamine™ 2000 transfection reagent according to the manufacturer's protocol. On the third day, luciferase activity was measured using the dual luciferase reporter assay system (Promega, Beijing, China) following the manufacturer's instructions. Renilla luciferase activity was normalized to firefly luciferase expression for each sample.

Table 2. Primers and templates used for recombinant plasmids.

Gene name Primer name Sequence (5′ → 3′) Length (nt) Product size (bp)
S-UTR FP GCTCTAGATTACTGACCTAAAACA 24 159
RP AATATGCGGCCGCCAGTGAACTGCATAC 28
T-P TTACTGACCTAAAACATGTATTAAGAGACTGTCATTTTTTATATACAACATTTCATTGGTTTTTCAAATAAAATTACACATAAAACATTATGGAATCTATTTGGGGAACGTTAATAAAACAGTGTATGCAGTTCACTG 136
S-K·O-217 FP GCTCTAGATTACTGACCTAAAACA 24 152
RP AATATGCGGCCGCCAGTGAACACTGTTT 28
T-P TTACTGACCTAAAACATGTATTAAGAGACTGTCATTTTTTATATACAACATTTCATTGGTTTTTCAAATAAAATTACACATAAAACATTATGGAATCTATTTGGGGAACGTTAATAAAACTCACTG 131

2.8. Western blotting analysis

For western blotting, 20 μg of protein from each sample was separated on a 12% gel via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then the gels were blotted onto polyvinylidene difluoride (PVDF) membranes. The membranes were incubated in 5% non-fat milk in phosphate-buffered saline (PBS), and then incubated overnight with a polyclonal antibody of nup43 at 4 °C, corresponding to β-actin. The membranes were then washed with phosphate-buffered saline with Tween 20 (PBST) and incubated with a HRP-conjugated goat anti-rabbit IgG antibody for 2 h at room temperature (dilution 1 : 2000). Antibody detection was performed with an enhanced chemiluminescence reaction (ECL western blotting detection, Biomiga, China). Western blotting photos were analyzed using the Tanon 5500 imaging system (Tanon, Shanghai, China).

2.9. Effect of miR-217 on the expression of nup43 mRNA and protein

The ZF4 cell line was utilized to verify whether the ectopic expression of miR-217 could influence the expression levels of nup43 mRNA and protein. Cells were seeded into six-well plates at a density of 200 000 cells per well, and after 24 h of incubation, four types of oligonucleotides were transfected (miR-217 mimic/CTRL+ 50 nM, miR-217 inhibitor/CTRL– 150 nM) into ZF4 cells, respectively. The total RNA and protein were extracted at 72 h post-transfection, and the mRNA and protein levels of nup43 were measured, as described above. The untransfected group was used as the negative control (NTC). Three technical replicates were set for each transfection, and three biological replicates were set by using different batches of cells.

2.10. Evaluation of cell apoptosis

At 48 h after ZF4 cells were transfected with the miR-217 mimic, negative control mimic, miR-217 inhibitor, and negative control inhibitor, cell apoptosis was detected by using the Annexin V-PE apoptosis detection kit (Becton Dickinson, Franklin Lakes, NJ, USA) according to the manufacturer's protocol. Briefly, adherent cells were harvested and suspended in the Annexin-binding buffer (1 × 106 cells per ml). Thereafter, cells were incubated with Annexin V-FITC and propidium iodide (PI) for 15 min at room temperature in the dark and then immediately analyzed by flow cytometry.

2.11. Statistical analysis

The data from each experiment were individually analyzed and are expressed as the mean ± SEM (n = 3). The statistical data analysis was performed using SPSS software (version 17.0, USA), and Student's t-test was used to analyze differences for the data. The differences were considered significant when p < 0.05. The nonparametric Spearman's rank correlation analysis was used to indicate the correlation between the expression levels of miR-217 and nup43.

3. Results

3.1. The expression of miR-217 and the predicted target gene nup43 in zebrafish exposed to triazophos

Computational analysis indicated that nup43 was a potential target gene of miR-217 and showed a putative binding site in the 3′-UTR of nup43 mRNA for miR-217 (Fig. 1A). To investigate the possible correlation between miR-217 and nup43 after exposure to triazophos, we measured the expression of miR-217 and nup43 in zebrafish by qRT-PCR. The expression of miR-217 was gradually downregulated with increasing triazophos concentration. Compared with the negative control, the rate change of miR-217 expression was 0.57 after exposure to triazophos at a concentration of 0.45 μg mL–1, and its fold change significantly decreased to 0.11 when the exposure concentration was increased to 3.6 μg mL–1 (Fig. 1B). Concurrently, an increasing upregulation in the expression of nup43 was observed with escalating exposure concentrations. Compared with the control, the rate change in nup43 expression was increased from 1.52 to 8.63 when the exposure concentration was increased from 0.45 to 3.6 μg mL–1 (Fig. 1C). Additionally, the expression of nup43 was also assayed at the protein level. Western blotting analysis showed that nup43 displayed the same pattern as mRNA of nup43 with the increasing triazophos concentrations. Its rate change was increased from 1.58 to 2.83 when the exposure concentration was increased from 0.45 to 3.6 μg mL–1 (Fig. 1D). Compared with the negative control, the solvent treatment did not result in any adverse effect on the expression of miR-217 or nup43 (Fig. 1). The nonparametric Spearman's rank correlation analysis indicated a strong inverse correlation between the expression levels of miR-217 and nup43 (Spearman's rho 5 –0.929, P < 0.01). Taken together, these data demonstrated that the expression change of nup43 was highly correlated with that of miR-217 in adult zebrafish exposed to triazophos.

Fig. 1. The aberrant expression of miR-217 and its predicted target nup43 in adult zebrafish in response to triazophos stress. (A) The sequence of miR-217 and its potential matching sites in nup43 3′-UTR. Watson–Crick and wobble-base (G–U) pairings are indicated by solid and dashed vertical lines, respectively. Adult zebrafishes were exposed for up to 96 h to multiple concentrations of triazophos (0, 1.438, 2.876, 4.314, and 5.752 μM) or the polyethylene glycol, anhydrous ethanol, and n-butyl alcohol solvent control 0.01% (v/v), and the expression levels of (B) miR-217 and (C) nup43 in adult zebrafish were determined by real-time PCR after 96 h triazophos exposure. (D) The results were evaluated as the fold change in the transcription level of each set of miR-217 and nup43 to that of β-actin. The change in Nup43 was detected with western blotting, and β-actin was used as an internal control. The data are presented as the mean ± SEM (n = 3), *P < 0.05, **P < 0.01.

Fig. 1

3.2. Interaction between miR-217 and the 3′-UTR of nup43 mRNA

The computational algorithm analysis indicated that a potential binding site for miR-217 is located in the 3′-UTR of nup43 in zebrafish. To validate whether miR-217 can repress nup43 through directly interacting with 3′-UTR, 293 T cells were co-transfected with the original plasmid pRL-TK, recombinant luciferase reporter plasmids, the pGL3-control plasmid, and miR-217 mimic or CTRL+. Compared with the luciferase activity of the empty pRL-TK vector (pRL/CTRL+), the luciferase expression of pRL/S-UTR was significantly decreased when cells were transfected with miR-217 mimic (**P < 0.01) (Fig. 2). The expression of luciferase between the pRL-UTR plasmid and the recombinant luciferase reporter plasmid in which the predicted binding sites were deleted did not display a significant change.

Fig. 2. Investigation of miR-217 against the 3′-UTR of nup43 mRNA. 293 T cells were transfected with pRL-TK (PRL/CTRL) or plasmid with 3′-UTR of nup43 (PRL/S-UTR) or plasmid with deletion of nucleotides that were complementary to the miR-217 sequence (PRL/S-K·O-217). Each plasmid was co-transfected with pGL3-control vector, which encoded firefly luciferase along with miR-217 mimics. Luciferase levels were measured 72 h post-transfection and normalized to those levels of firefly luciferase. The data are presented as the mean ± SEM (n = 3), *P < 0.05, **P < 0.01.

Fig. 2

3.3. miR-217 regulates nup43 at both the mRNA level and protein level

We sought to assess the effect of miR-217 on the expression of nup43 mRNA and protein levels. ZF4 cells were transfected with 50 nM miR-217 mimic, 50 nM CTRL+, 150 nM miR-217 inhibitor, and 150 nM CTRL–. Compared with the untreated negative control (NTC), the qRT-PCR results showed that the expression of miR-217 increased more than 30 000 times, and the expression of nup43 mRNA significantly decreased when ZF4 cells were transfected with the miR-217 mimic. In contrast, no significant difference in the expression of both miR-217 and nup43 was observed in cells transfected with CTRL+ (Fig. 3A). The expression of miR-217 was downregulated and the expression of nup43 was increased in the cells that were transfected with the miR-217 inhibitor. Additionally, there was no significant difference in the expression levels of both miR-217 and nup43 in cells transfected with CTRL– (Fig. 3B). Western blotting assay showed that the expression level of nup43 was downregulated when treated with the miR-217 mimic, and its expression was upregulated when treated with the miR-217 inhibitor. In contrast, the expression of nup43 was not affected by transfection of CTRL+or CTRL–, compared with the NTC. The results of western blotting were consistent with those of the qRT-PCR analysis, which demonstrated that the aberrant expression of miR-217 regulated the mRNA level of nup43 so that expression of nup43 was indirectly influenced (Fig. 3C).

Fig. 3. miR-217 regulates nup43 at the mRNA level and protein level. ZF4 cells were transfected with 50 nM CTRL+, 100 nM mimic of miR-217, and 150 nM inhibitor of miR-217, compared with the untransfected group (NTC). (A) qRT-PCR results showed that expression of miR-217 was increased and expression of nup43 mRNA was decreased when cells were transfected with miR-217 mimic; (B) the result was reversed when cells were transfected with miR-217 inhibitor; and (C) western blot showed the protein level of nup43 in cells normalized with β-actin. All data are shown as the mean of three independent experiments (mean + SEM), and the results are displayed with log2,*P < 0.05, **P < 0.01.

Fig. 3

3.4. miR-217 induces apoptosis in ZF4 cells

To explore the functional effects of miR-217 on cell survival, we measured apoptosis in ZF4 cells transfected with miR-217 mimic. Downregulation of miR-217 increased apoptosis of ZF4 cells, as measured by fluorescence activated cell sorting (FACS) analysis of cells that underwent PI and Annexin V staining (Fig. 4D). Apoptosis was much higher in ZF4 cells transfected with miR-217 mimic than in cells transfected with the NTC. The proportion of non-apoptotic cells (left lower quadrant: Annexin V-FITC–/PI–), early apoptotic cells (right lower quadrant: Annexin V-FITC+/PI–), late apoptotic/necrotic cells (right upper quadrant: Annexin V-FITC+/PI+), and dead cells (left upper quadrant: Annexin V-FITC–/PI+) (Fig. 4A–E). The results showed that compared to the NTC and blank control, apoptosis of cells reached 21.2% ± 0.33 after injection with 50 nM miR-217 mimic; 13.8% of 24.1% cells underwent apoptosis as late apoptotic/necrotic cells, and 10.3% underwent apoptosis as early apoptotic cells (Fig. 4A, B, and D). That is, the viability of cells was weakened because of the interaction between miRNA and mRNA. Additionally, we injected 150 nM inhibitor and NC inhibitor into ZF4 cells and found that no remarkable change of apoptosis occurred (Fig. 4C and E). These data suggest that downregulation of miR-217 in ZF4 cells can induce apoptosis, possibly through the nup43 pathway.

Fig. 4. Annexin V/PI-detected apoptosis after transfection. (A) Blank control group; (B) 50 nM mimic negative control group; (C) 150 nM inhibitor negative control group; (D) 50 nM miR-217 mimic group; (E) 150 nM miR-217 inhibitor group.

Fig. 4

4. Discussion

MiRNAs are associated with dozens of predicted protein targets, and are believed to be major regulators of proteins. MiRNAs also play important regulatory roles in proliferation, apoptosis, development, and differentiation. The study of miRNA and its role in regulating gene expression involved in various cellular mechanisms is an emerging field of research and has been a part of the world of toxicogenomics.35 MiRNAs have been studied in reference to target prediction, potential modulation of toxicology-related changes in miRNA expression, the role of miRNA in plasma as a potential toxicological biomarker, and the relevance of miRNA-related genetic polymorphisms.36 MiRNAs can provide a link between environmental influences and gene expression. Wang and his co-workers recently reported that some miRNAs were remarkably downregulated in zebrafish upon triazophos exposure.19 It has also been suggested that the existence of target sites is essential for proper protein regulation, indicating that miRNA regulation reflects an effective expression control mechanism associated with an assortment of influences and impacts. Here, we further demonstrated the involvement of miR-217 in response to triazophos stress by targeting the 3′-UTR of nup43 in zebrafish. The results clearly show the contribution of miRNA in regulating toxicological outcomes through the regulation of gene expression.

Through binding to the miRNA response elements (MREs) in mRNA 3′-UTR, miRNA regulates gene expression by affecting mRNA stability and/or translation. That is, the 3′-UTR of mRNA molecules can act as sinks for miRNAs and functionally liberate other transcripts sharing the same pools of miRNAs.37,38 Our study proved that nup43 mRNA was a direct target of miR-217 and that low expression of miR-217 might be one of the mechanisms causing the overexpression of nup43 under triazophos stress. Indeed, our luciferase reporter assays demonstrated that miR-217 specifically interacted with the nup43 3′-UTR and repressed gene expression. In particular, the luciferase activity of recombinant vectors that contained regions of the nup43 3′-UTR comprising miR-217 binding sites (pRL/S-UTR and pRL-TK) was inhibited in 293 T cells when transfected with miR-217. Conversely, the overrepresentation of miR-217 did not affect luciferase activity when the miR-217 seed complementary sequence was deleted (pRL/S-K·O). It has been suggested that miR-217 could be tumor specific and probably dependent on its targets in many types of cancer.39 In the current study, we concluded that miR-217 targeted the 3′-UTR of nup43, and that miR-217 was downregulated in zebrafish after exposure to triazophos. Then, due to the decreased expression of miR-217, the expression of nup43 would be upregulated (Fig. 5). Overexpression of nup43 in zebrafish upon triazophos exposure further proved the role of miR-217, which acted as a negative modulator of nup43. Moreover, both mRNA and protein levels of nup43 were markedly decreased in ZF4 cells after transfection with miR-217 mimic, whereas these levels increased after cells were transfected with miR-217 inhibitor. All these results suggested that miR-217 was involved in triazophos toxicity and acted through regulating one or several target genes, including nup43.

Fig. 5. Proposed mechanism of miR-217 and nup43 expression alteration as induced by triazophos. Low expression of miR-217 might be one of the mechanisms underlying the overexpression of nup43 under triazophos stress. Then, the downregulation of miR-217 led to the overexpression of nup43.

Fig. 5

Nup43, a WD40-containing protein, is conserved in higher eukaryotes, but is absent in the yeast Nup107 subcomplex. In C. elegans Nup107 null embryos, the members of the Nup107 complex, with the exception of Nup43 that was partially displaced, properly localized at the NPC during interphase.40Nup107 is ubiquitously expressed, including the glomerular podocytes. Miyake found that zebrafish with nup107 knockdown by morpholino oligonucleotides displayed hypoplastic glomerulus structures and abnormal podocyte foot processes, thereby mimicking the pathological changes seen in the kidneys of steroid-resistant nephrotic syndrome (SRNS) individuals with nup107 mutations.26 Zhu et al. evaluated the potential developmental toxicity by exposing Gobiocypris rarus embryos and larvae to various concentrations of triazophos (0.1–15 mg L–1) for 72 h. The results showed that values of LC50 and EC50 for 72 h were 7.44 and 5.60 mg L–1 for embryos, and 2.52 and 1.37 mg L–1 for larvae, respectively. Increased malformation, and decreased heart rate and body length provide a gradual concentration-dependent pattern. Enzymatic activities and mRNA levels were significantly changed even at low concentrations (0.05 mg L–1 for embryos and 0.01 mg L–1 for larvae).30 Our results also showed that the expression of nup43, which is a candidate tumor suppressor, could be upregulated upon triazophos exposure, even when the environmental concentration was as low as 3.6 mg L–1, and that implied that triazophos is worthy of a reassessment for carcinogenicity. Additionally, miR-217 could be potentially considered as a toxicological biomarker of zebrafish exposed to triazophos.

Genes have ability to modulate the levels of their cognate genes. This phenomenon is consistent with the fact that each miRNA has multiple targets and can lead to widespread homeostatic effects. Also, given that a single gene often has numerous differentially regulated pseudogenes and ribosomal protein pseudogenes, such networks can become intricately dynamic.41 Thus, a complex miRNA regulatory network can be formed for the fine regulation of gene expression. According to an in silico analysis, miR-203a, miR-203b, miR-200a, miR-141, miR-217, and miR-7a also target nup43, whereas the computational algorithm analysis for mRNA target identification usually yields many false-positive candidates. Therefore, regulatory miRNAs still must be experimentally identified, and the role of these miRNAs as part of the regulatory network in targeting nup43 under toxicological stress should be further determined.

In the present study, we proved that low expression of miR-217 might be one of the mechanisms underlying the overexpression of nup43 under triazophos stress. Then, the downregulation of miR-217 led to the overexpression of nup43. The expression of nup43 was also decreased in cells transfected with the miR-217 mimic, as nup43 was slightly protected from activation in cells overexpressing miR-217. In conclusion, our results suggested that the downregulation of miR-217 could be involved in the overexpression of nup43 in zebrafish under the stress of triazophos. Moreover, both nup43 mRNA and protein levels were markedly decreased in ZF4 cells after transfection with the miR-217 mimic, whereas these levels increased after cells were transfected with the miR-217 inhibitor. The miRNAs, including miR-217, which has been proven to regulate the expression of nup43, could be considered as potential toxicological biomarkers for triazophos toxicity. Further studies on these miRNAs are required to understand their effects on other potential target genes.

Conflicts of interest

There are no conflicts of interest to declare.

Acknowledgments

This work was supported by Zhejiang Provincial Natural Science Foundation (contract grant number: LY15B070012) and National Natural Science Foundation of China (contract grant number: 21307113).

References

  1. Bartel D. P. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Filipowicz W., Bhattacharyya S. N., Sonenberg N. Nat. Rev. Genet. 2008;9:102–114. doi: 10.1038/nrg2290. [DOI] [PubMed] [Google Scholar]
  3. Lee S. E. J. Pineal Res. 2011;51:345–352. doi: 10.1111/j.1600-079X.2011.00896.x. [DOI] [PubMed] [Google Scholar]
  4. Tal T. L., Tanguay R. L. Neurotoxicology. 2012;33:530. doi: 10.1016/j.neuro.2012.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Seeger M. A., Paller A. S. Adv. Wound Care. 2015;4:213. doi: 10.1089/wound.2014.0540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Karim S. M. M. BMC Genomics. 2016;17:7. doi: 10.1186/s12864-016-3088-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Zhou Y. Environ. Toxicol. Pharmacol. 2016;45:98–107. doi: 10.1016/j.etap.2016.05.019. [DOI] [PubMed] [Google Scholar]
  8. Zheng Y. Chemosphere. 2016;164:41–51. doi: 10.1016/j.chemosphere.2016.07.057. [DOI] [PubMed] [Google Scholar]
  9. Paul S. Mol. Cell. Toxicol. 2009;5:67–74. [Google Scholar]
  10. Yang X. Toxicol. Sci. 2012;125:335–344. doi: 10.1093/toxsci/kfr321. [DOI] [PubMed] [Google Scholar]
  11. Halappanavar S. Toxicology. 2011;285:133–141. doi: 10.1016/j.tox.2011.04.011. [DOI] [PubMed] [Google Scholar]
  12. Wang X. J. Biol. Chem. 2015;290:3925. doi: 10.1074/jbc.M114.596866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Yin H. J. Pathol. 2015;185:1286–1296. doi: 10.1016/j.ajpath.2015.01.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Menghini R. Circulation. 2009;120:1524. doi: 10.1161/CIRCULATIONAHA.109.864629. [DOI] [PubMed] [Google Scholar]
  15. Zhao G. J. Am. Coll. Cardiol. 2014;219:e47–e47. [Google Scholar]
  16. Lu L. Toxicol. Appl. Pharmacol. 2015;289:276–285. doi: 10.1016/j.taap.2015.09.016. [DOI] [PubMed] [Google Scholar]
  17. Zhang H. S. Biochim. Biophys. Acta, Mol. Cell Res. 2012;1823:1017. doi: 10.1016/j.bbamcr.2012.02.014. [DOI] [PubMed] [Google Scholar]
  18. Zhu H. Biochem. Biophys. Res. Commun. 2016;471:169. doi: 10.1016/j.bbrc.2016.01.157. [DOI] [PubMed] [Google Scholar]
  19. Wang X. X. J. Environ. Sci. Health, Part B. 2010;45:648–657. doi: 10.1080/03601234.2010.502435. [DOI] [PubMed] [Google Scholar]
  20. Xu C. FEBS Lett. 2015;589:3247–3253. doi: 10.1016/j.febslet.2015.09.008. [DOI] [PubMed] [Google Scholar]
  21. Rabut G., Lénárt P., Ellenberg J. Curr. Opin. Cell Biol. 2004;16:314–321. doi: 10.1016/j.ceb.2004.04.001. [DOI] [PubMed] [Google Scholar]
  22. Fahrenkrog B. Can. J. Physiol. Pharmacol. 2006;84:279–286. doi: 10.1139/y05-100. [DOI] [PubMed] [Google Scholar]
  23. Tran E. J., Wente S. R. Cell. 2006;125:1041. doi: 10.1016/j.cell.2006.05.027. [DOI] [PubMed] [Google Scholar]
  24. Kim S. Y., Kang H. H., Park S. C. Biochem. Biophys. Res. Commun. 2010;401:131–136. doi: 10.1016/j.bbrc.2010.09.025. [DOI] [PubMed] [Google Scholar]
  25. Tan X. J. Am. Coll. Surg. 2010;209:211–216. [Google Scholar]
  26. Miyake N. Am. J. Hum. Genet. 2015;97:555–566. doi: 10.1016/j.ajhg.2015.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jiang X. Biochem. Biophys. Res. Commun. 2009;378:269. doi: 10.1016/j.bbrc.2008.11.046. [DOI] [PubMed] [Google Scholar]
  28. Liu L. Ecotoxicol. Environ. Saf. 2015;116:68–75. doi: 10.1016/j.ecoenv.2015.03.001. [DOI] [PubMed] [Google Scholar]
  29. Sharma D., Sangha G. K., Khera K. S. Pestic. Biochem. Physiol. 2015;117:9–18. doi: 10.1016/j.pestbp.2014.09.004. [DOI] [PubMed] [Google Scholar]
  30. Zhu B. Chemosphere. 2014;108:46–54. doi: 10.1016/j.chemosphere.2014.03.036. [DOI] [PubMed] [Google Scholar]
  31. Ge L. Q. J. Econ. Entomol. 2009;102:1506. doi: 10.1603/029.102.0415. [DOI] [PubMed] [Google Scholar]
  32. Liu Y. Anal. Methods. 2016;8:6636–6644. [Google Scholar]
  33. Lozowicka B. Environ. Monit. Assess. 2015;187:1–19. doi: 10.1007/s10661-015-4818-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lin C. Y., Chiang C. Y., Tsai H. J. J. Biomed. Sci. 2016;23:1–11. doi: 10.1186/s12929-016-0236-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Paul S. Mol. Cell. Toxicol. 2011;7:259–269. [Google Scholar]
  36. Yokoi T., Nakajima M. Toxicol. Sci. 2011;123:1. doi: 10.1093/toxsci/kfr168. [DOI] [PubMed] [Google Scholar]
  37. Carthew R. W., Sontheimer E. J. Cell. 2009;136:642. doi: 10.1016/j.cell.2009.01.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Salmena L. Cell. 2011;146:353–358. doi: 10.1016/j.cell.2011.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Azam A. T. Tumor Biol. 2016;37:1–5. [Google Scholar]
  40. González-Aguilera C., Askjaer P. Nucleus. 2012;3:340–348. doi: 10.4161/nucl.21135. [DOI] [PubMed] [Google Scholar]
  41. Laura P. Nature. 2010;465:1033. [Google Scholar]

Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES