Neospora caninum Dense Granule Protein 7 Regulates the Pathogenesis of Neosporosis by Modulating Host Immune Response

Neospora caninum invades and replicates in a broad range of host species and cells within those hosts. The effector proteins exported by Neospora induce its pathogenesis by modulating the host immunity. We show that most of the transcriptomic effects in N. caninum-infected cells depend upon the activity of NcGRA7. A deficiency in NcGRA7 reduced the virulence of the parasite in mice. This study demonstrates the importance of NcGRA7 in the pathogenesis of neosporosis.

ABSTRACT

Neospora caninum is a protozoan parasite closely related to Toxoplasma gondii. Neosporosis caused by N. caninum is considered one of the main causes of abortion in cattle and nervous-system dysfunction in dogs, and identification of the virulence factors of this parasite is important for the development of control measures. Here, we used a luciferase reporter assay to screen the dense granule proteins genes of N. caninum, and we found that NcGRA6, NcGRA7, and NcGRA14 are involved in the activation of the NF-κB, calcium/calcineurin, and cAMP/PKA signals. To analyze the functions of these proteins and Neospora cyclophilin, we successfully knocked out their genes in the Nc1 strain using plasmids containing the CRISPR/Cas9 components. Among the deficient lines, the NcGRA7-deficient parasites showed reduced virulence in mice. An RNA sequencing analysis of infected macrophage cultures showed that NcGRA7 mainly regulates the host cytokine and chemokine production. The levels of gamma interferon in the ascites fluid, CXCL10 expression in the peritoneal cells, and CCL2 expression in the spleen were lower 5 days after infection with the NcGRA7-deficient parasite than after infection with the parental strain. The parasite burden and the degree of necrosis in the brains of mice infected with the NcGRA7-deficient parasite were also lower than in those of the parental strain. Collectively, our data suggest that both the NcGRA7-dependent activation of the inflammatory response and the parasite burden are important in Neospora virulence.

IMPORTANCE Neospora caninum invades and replicates in a broad range of host species and cells within those hosts. The effector proteins exported by Neospora induce its pathogenesis by modulating the host immunity. We show that most of the transcriptomic effects in N. caninum-infected cells depend upon the activity of NcGRA7. A deficiency in NcGRA7 reduced the virulence of the parasite in mice. This study demonstrates the importance of NcGRA7 in the pathogenesis of neosporosis.

INTRODUCTION

Neospora caninum is a protozoan parasite belonging to the phylum Apicomplexa and is closely related to Toxoplasma gondii. Neospora caninum infects a wide range of warm-blooded animals as intermediate hosts and dogs as the definitive host (1). Neosporosis is considered one of the main causes of abortion and neonatal mortality in cattle and nervous-system dysfunction in dogs (2, 3). Importantly, bovine neosporosis entails significant economic losses (1, 4, 5). In humans, antibodies against N. caninum have been detected in Brazil, South Korea, Northern Ireland, and the United States, although no viable parasite has been isolated from humans (4). With no effective drugs or vaccines available to control neosporosis (1), there is an urgent need to develop measures to control N. caninum infection. To develop new vaccines and drug targets for this disease, more scientific evidence of the molecular factors and genes involved in Neospora pathogenesis is required.

Neospora caninum primarily induces the host cellular immune response by invading and replicating in the host cells. Gamma interferon (IFN-γ) plays an important role as the major mediator of resistance against N. caninum in vivo (6, 7). In addition to IFN-γ-producing CD4⁺ and CD8⁺ T cells, different types of innate cells are required for the acquisition of protective immunity against N. caninum infection, including natural killer T cells, macrophages, and dendritic cells (8–11). The pathogenesis of N. caninum infection is closely associated with the host-parasite interaction, and the effector proteins exported by the parasite secretory organelles (rhoptries and dense granules) are key factors in its pathogenesis because they modulate the host immune response. Several proteins of N. caninum have been identified as effector molecules that could interact with host signaling pathways. The rhoptry proteins of N. caninum, NcROP5 and NcROP16, may be virulence factors because parasites deficient in these proteins cause reduced mortality in mice (12, 13). NcROP16 is also responsible for STAT3 activation (13). Similarly, the Toxoplasma rhoptry proteins, ROP5, ROP16, ROP18, and ROP38, contain protein kinase domains (14) and subvert and coopt host-cell functions (15–17). Among other molecules of N. caninum, cyclophilin (NcCYP) appears to contribute to host cell migration (18) and profilin (NcPF) induces strong IFN-γ and interleukin-12 (IL-12) responses (19). Therefore, the effector proteins exported by N. caninum are key players in neosporosis.

In T. gondii, dense granule proteins also participate in the modulation of host cell functions. GRA6, GRA15, GRA16, and GRA24 are involved in the activation of the host transcription factor nuclear factor of activated T cells 4 (NFAT4), the activation of nuclear factor-κB (NF-κB), the regulation of host cell cycle progression and the TP53 tumor suppressor signaling pathway, and the promotion of p38 mitogen-activated protein kinase activation, respectively (20–23). However, the dense granule proteins of N. caninum that directly activate cell signaling pathways in the host cells have not yet been identified. Therefore, we screened 18 potential dense granule proteins of N. caninum for their activation of host cell signaling pathways in this study. The NcGRA6, NcGRA7, or NcGRA14 gene was knocked out in N. caninum, and we used the clustered regularly interspaced short palindromic repeats (CRISPR)-associated gene 9 (CRISPR/CAS9) system to examine the effects on the parasite phenotype. We demonstrate that NcGRA7 regulates the pathogenesis of neosporosis by modulating the host immune response.

RESULTS

Ectopic expression of Neospora-derived molecules robustly activates cell signaling pathways in 293T cells.

Because T. gondii GRA proteins activate host cell signaling pathways, we hypothesized that N. caninum GRA proteins, including NcCYP and NcPF, also manipulate host gene expression by activating signaling pathways in the host cells. We constructed mammalian expression vectors for 18 N. caninum GRA proteins, NcCYP, and NcPF and assessed whether their expression, together with luciferase reporter plasmids carrying elements dependent on various transcription factors, activated the reporters (Fig. 1A). Among our target genes, NcGRA6, NcGRA7, and NcGRA14 were involved in the activation of NF-κB signaling, calcium/calcineurin (NFAT) signaling, and cAMP/PKA (CRE) signaling (Fig. 1B).

FIG 1.

Immunostimulatory effects of Neospora genes. (A) 293T cells were transfected with the luciferase reporter plasmids and the expression vector of one of the 18 Neospora genes encoding dense granule proteins, NcCYP, or NcPF. The luciferase activity is expressed as the fold increase over the background level in lysates prepared from mock-transfected cells. (B) 293T cells were transfected with the luciferase reporter plasmids and the expression vector for Neospora gene NcGRA6, NcGRA7, NcGRA14, or NcCYP. Error bars represent the means ± the standard deviations of triplicate readings. The results represent two independent experiments with similar results.

Characterization of NcGRA6-, NcGRA7-, NcGRA14-, and NcCYP-deficient parasites in vitro and in vivo.

To evaluate whether NcGRA6, NcGRA7, or NcGRA14 are involved in the virulence of Neospora, we generated gene-deficient parasites with the CRISPR/CAS9 system (see Fig. S1A to C and 2A in the supplemental material). NcCYP-deficient parasites were also generated because it has been suggested that NcCYP induces IFN-γ production by peripheral blood mononuclear cells (24) and triggers the migration of murine and bovine cells (18) (Fig. 2B; see also Fig. S1D in the supplemental material). CRISPR plasmids targeting between nucleotides (nt) 86 and 87 in the NcGRA6 gene, between nt 113 and 114 in the NcGRA7 gene, between nt 110 and 111 in the NcGRA14 gene, and between nt 753 and 754 in the NcCYP gene were constructed to allow the insertion of the pyrimethamine resistance dihydrofolate reductase (DHFR*) cassette (see Fig. S1 in the supplemental material). The CRISPR plasmids were then transferred into N. caninum strain Nc1 with electroporation, and the parasites were selected in the presence of pyrimethamine. To verify the successful establishment of the gene-deficient lines, PCR was used to confirm the insertion of the DHFR* cassette into the target gene in the clones obtained with limited dilution. The amplification of the target gene was negative and the insertion of the DHFR* cassette into the target gene was confirmed in each deficient line (see Fig. S1 in the supplemental material). The loss of the target genes was also confirmed with Western blotting (Fig. 2A). Anti-NcGRA6 mouse serum detected a 33-kDa protein in the Nc1 strain, but not in the NcGRA6-deficient parasite. A rabbit NcGRA7 antibody detected three major proteins of 33, 26, and 18 kDa in the Nc1 strain, but not in the NcGRA7-deficient parasite. Anti-NcGRA14 mouse serum detected a 51-kDa protein in the Nc1 strain, but not in the NcGRA14-deficient parasite. A rabbit NcCYP antibody detected a 15-kDa protein in the Nc1 strain, but not in the NcCYP-deficient parasite. In addition, we confirmed the loss of target protein expression by an immunofluorescent antibody test (IFAT), except in the case of the NcGRA14-deficient parasite (anti-NcGRA14 mouse serum did not specifically react with Nc1 by IFAT) (see Fig. S2 and S3 in the supplemental material).

FIG 2.

Generation of NcGRA6-, NcGRA7-, NcGRA14-, and NcCYP-deficient parasites and their phenotypes. (A) Western blots of the parental strain Nc1 and the NcGRA6-, NcGRA7-, NcGRA14-, and NcCYP-deficient parasites. Anti-NcGRA6 mouse serum detected a 33-kDa protein in the Nc1 strain, but not in the NcGRA6-deficient parasite (KO). *, anti-NcGRA6 mouse serum detected nonspecific bands in the Nc1 strain and the NcGRA6-deficient parasite. A rabbit anti-NcGRA7 antibody detected three major proteins of 33, 26, and 18 kDa in the Nc1 strain, but not in the NcGRA7-deficient (KO) parasite. Three major proteins of 39, 34, and 25 kDa were detected in the NcGRA7-complemented parasite (Comp). Anti-NcGRA14 mouse serum detected a 51-kDa protein in the Nc1 strain, but not in the NcGRA14-deficient parasite. A rabbit anti-NcCYP antibody detected a 15-kDa protein in the Nc1 strain, but not in the NcCYP-deficient parasite. NcSRS2 was used as the loading control. M, molecular mass marker. The each figure panel represents photo taken from the same blot, including the marker, while the ladder of the marker was visualized and then joined together. (B) Infection rates of the different parasite lines in Vero cells at 24 h postinfection. (C) Intracellular replication assay of the parasite lines in Vero cells at 48 h postinfection. (D) Egress rates of the different parasite lines in Vero cells at 72 h postinfection. Each bar represents the means ± the standard deviation (n = 4 for all groups), and the results represent two independent experiments with similar results. *, statistically significant differences relative to the value for Nc1, according to one-way ANOVA (B and D) or two-way ANOVA (C) and a Tukey-Kramer post hoc analysis (P < 0.05). Further details on the production of antisera, polyclonal antibodies, and monoclonal antibodies against the N. caninum proteins, the Western blotting, infection rate, and growth of N. caninum lines can be found in the supplemental methods in the supplemental material.

We then assessed the physiological changes in the gene-deficient lines in vitro. The infection rates of the NcGRA6-deficient (6.1% ± 3.3%) and NcGRA7-deficient (9.5% ± 3.2%) lines at 20 h postinfection in Vero cells were similar to those of the parental strain Nc1 (5.8% ± 1.1%) (Fig. 2B). The infection rates of the NcGRA14-deficient (11.3% ± 1.3%) and NcCYP-deficient (16.6% ± 2.1%) lines at 20 h postinfection in Vero cells were significantly higher than those of the parental strain Nc1 (P < 0.05) (Fig. 2B). We measured the numbers of parasites in parasitophorous vacuoles (PV) at 48 h postinfection between strains (Fig. 2C). However, the deficient parasites displayed numbers of parasites per PV similar to the number in the parental strain Nc1, while reduced percentages at 16 parasites per PV were seen in the NcGRA6-deficient line, suggesting that in vitro-proliferation rates were not affected by the loss of these proteins. Because N. caninum start to egress from host cells after 48 h postinfection in vitro, the percent egress of parasites at 72 h postinfection was measured (Fig. 2D). Among the gene-deficient lines, NcGRA7-deficient line showed lower egress compared to the parental strain Nc1 (P < 0.05). The parasitic virulence of the lines was also compared in BLAB/c and C57BL/6 mice (Fig. 3A and B). Among the deficient lines, the NcGRA7-deficient line showed the lowest virulence relative to the parental strain Nc1 and the other deficient lines. The low virulence of the NcGRA7-deficient line was similar to that seen in Toll-like receptor 2 (TLR2)-deficient mice (Fig. 3C).

FIG 3.

Parasite virulence in mice. Mice were infected with a lethal dose (10⁶) of N. caninum tachyzoites of the parental strain Nc1, the deficient line (KO), and the NcGRA7-complemented parasite (Comp). The survival rates (surviving mice/total mice) were calculated for 60 days after infection. (A) Survival rates of BALB/c mice (n = 6 per group): Nc1, 2/6, 33.3%; NcGRA6KO, 2/6, 33.3%; NcGRA7KO, 5/6, 83.3%; NcGRA14KO, 4/6, 66.7%; and NcCYPKO, 1/6, 16.7%. (B) Survival rates of C57BL/6 mice (n = 6 per group): Nc1, 1/6, 16.7%; NcGRA6KO, 3/6, 50.0%; NcGRA7KO, 6/6, 100%; NcGRA14KO, 1/6, 16.7%; and NcCYPKO, 1/6, 16.7%. (C) Survival rates of Tlr2^−/− mice (n = 6 per group): Nc1, 1/6, 16.7%; and NcGRA7KO, 5/6, 83.3%. (D) Survival rates of BALB/c mice (n = 8 per group): Nc1, 1/8, 12.5%; NcGRA7KO, 5/8, 62.5%; and NcGRA7 complemented, 2/8, 25.9%. The significance of the differences in survival at 60 days postinfection was analyzed with a χ² test (*, P < 0.05).

To confirm the loss of virulence in the NcGRA7-deficient line, a FLAG tag-fused NcGRA7 gene was introduced between nt 88 and 89 in the Neospora uracil phosphoribosyl transferase (NcUPRT) gene of the NcGRA7-deficient line with the CRISPR/CAS9 system (see Fig. S3 in the supplemental material). The complemented parasites were selected in the presence of fluorouracil (5-FU). The PCR results showed the correct insertion of the FLAG tag-fused NcGRA7 gene into the NcUPRT gene. The expression of the FLAG tag-fused NcGRA7 protein was confirmed with Western blotting (Fig. 2A) and an IFAT (see Fig. S3B in the supplemental material). Three major proteins of 39, 34, and 25 kDa were detected in the NcGRA7-complemented parasite. The differences of molecular weights of NcGRA7 between the Nc1 strain and the NcGRA7-complemented parasite were 6 to 8 kDa. FLAG tag has 22 amino acids (DYKDHDGDYKDHDIDYKDDDDK), and most amino acids in the tag are charged amino acids, such as D, K, and H (77%, 17/22). Charged amino acids may affect micelle formation between sodium dodecyl sulfate (SDS) and protein, resulting in a different migration from the expected size of the protein on SDS-PAGE. Thus, the FLAG tag-fused NcGRA7 proteins might be larger than the native NcGRA7 proteins because of the length and charge of amino acid in the FLAG tag. We evaluated the band intensity between NcGRA7 in the Nc1 and the NcGRA7-complemented parasite by objective judgment using ImageJ software v. 1.49 (Mac version of NIH Image [http://rsb.info.nih.gov/nih-image/]). The expression level of the FLAG tag-fused NcGRA7 protein in the NcGRA7-complemented parasite observed with Western blotting was 19.2% of that in the Nc1, consistent with the results of RNA sequencing, shown in Table S1 in the supplemental material (mean counts per million [CPM]: Nc1, 10,236.71; NcGRA7 deficient, 623.66; and NcGRA7 complemented, 4,233.64). As shown in Fig. S3C in the supplemental material, the egress level of the NcGRA7-complemented parasite was similar to that of the Nc1. The virulence of the NcGRA7-complemented line in the infected BLAB/c mice was thus restored (Fig. 3D). The survival rate at 20 days postinfection of mice infected with NcGRA7-complemented parasite (7/8, 87.5%) was higher than that of mice infected with Nc1 (3/8, 37.5%; P = 0.04), while the survival rates at 60 days postinfection were not significantly different between mice infected with Nc1 and the NcGRA7-complemented parasite (P = 0.52).

Transcriptome and cytokine production of the NcGRA7-deficient parasite in macrophages.

To understand the roles of NcGRA7, a transcriptomic sequencing analysis of infected macrophage cultures was performed (Fig. 4). The infection rates were similar among the parasite lines (Nc1, 4.9% ± 0.5%; NcGRA7-deficient parasite, 5.9% ± 0.8%; and NcGRA7-complemented parasite, 5.3% ± 1.4%). We first examined the differentially expressed genes (DEGs) in the parasites and found that 15 genes, including 9 genes encoding hypothetical proteins, were downregulated, and 4 genes were upregulated in the NcGRA7-deficient parasite compared with their expression in the parental strain Nc1 (see Table S1 in the supplemental material). Although these data demonstrated the NcGRA7 deficiency, the complementation of the NcGRA7 gene, and the expression of DHFR* in each parasite line, we could not confirm any clear changes in other Neospora genes based on the mean CPM values.

FIG 4.

RNA-seq analysis of macrophages infected with Nc1, NcGRA7-deficient parasite (KO), or NcGRA7-complemented parasite (Comp) and uninfected cells (NoI) (n = 3 per group). Further details on macrophage preparation can be found in the supplemental methods in the supplemental material. These data show the differential expression of genes associated with the presence or absence of NcGRA7. (A) Expression of all genes in the pathway “cytokine-cytokine receptor interaction” was plotted as a heatmap. A cluster in panel A, which was upregulated when NcGRA7 expression was restored, is enlarged on the right. Detailed expression data for the genes are shown in Table S3 in the supplemental material. (B) PCA was performed to gain an overview all the expression data and identify classification patterns.

To analyze the pathways of host cells regulated by NcGRA7 in more detail, we analyzed the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways in which the host genes were involved (see Table S2 in the supplemental material). Immune-response-related pathways, such as the IL-17 signaling pathway, the cytokine-cytokine receptor interaction pathway, and the tumor necrosis factor (TNF) signaling pathway, were significantly enriched in the DEGs downregulated in macrophage cultures infected with the NcGRA7-deficient parasite compared with their expression in Nc1-infected cell cultures. Although only the Hippo signaling pathway was enriched in DEGs upregulated in macrophage cultures infected with the NcGRA7-deficient parasite, the false discovery rate (FDR) P value was 0.04. A heatmap of the gene expression associated with cytokine-cytokine receptor interactions showed that the expression levels of several cytokines and chemokines were changed as the expression levels of NcGRA7 were altered in N. caninum (Fig. 4; see also Table S3 in the supplemental material). To identify the host genes regulated by NcGRA7, the DEGs up- or downregulated in macrophage cultures infected with the NcGRA7-deficient parasite were compared with the genes expressed in Nc1-infected cell cultures and ranked according to the degree of change in expression (Fig. 5; see also Table S4 in the supplemental material). When we considered the gene expression levels in macrophage cultures infected with the NcGRA7-complemented line, upregulated genes, such as Cxcl3, Il1b, Serpinb, Slc6a9, Serpine1, Aldh1l2, and Siglece, and downregulated genes, such as Ccnd1, Rasgrp3, Uhrf1, Cavin1, Plau, and Cbr2, were identified as NcGRA7-regulated genes (see Table S4 in the supplemental material). The production of IL-12p40 and IL-6 in the macrophage cultures infected with the NcGRA7-deficient parasite was lower than in the Nc1-infected cell cultures, and the complementation of the NcGRA7 gene in the NcGRA7-deficient line resulted in the partial restoration of cytokine production (Fig. 6). Together, these results indicate that NcGRA7 deficiency robustly downregulated the immune-response-related pathways induced by N. caninum infection.

FIG 5.

Expression of the 20 most differentially expressed genes downregulated (A) or upregulated (B) in macrophages infected with Nc1, NcGRA7-deficient parasites (KO), or NcGRA7-complemented parasites (Comp) and uninfected cells (Mock). Bars represent mean counts per million (CPM) in triplicate samples, and error bars represent the standard deviations of each value. Detailed expression data for the genes are shown in Table S4 in the supplemental material.

FIG 6.

Cytokine production in macrophages infected with Nc1, NcGRA7-deficient parasites (KO), or NcGRA7-complemented parasites (Comp) and uninfected cells (mock) at 20 h postinfection. Further details on macrophage preparation can be found in the supplemental methods in the supplemental material. IL-12p40 (A) and IL-6 (B) in the culture supernatant were analyzed with ELISAs. Each value represents the means ± the standard deviation of four replicate samples. Different letters above the bars in the graphs indicate statistically significant differences according to one-way ANOVA and a Tukey-Kramer post hoc analysis (P < 0.05). The reproducibility of the data was confirmed with two independent experiments.

Measurement of inflammatory markers in vivo.

Based on the results shown in Fig. 6, we measured the levels of IFN-γ, an inflammatory marker, in the ascites fluid of mice at 5 days postinfection (Fig. 7A). The IFN-γ levels were lower in the mice infected with the NcGRA7-deficient parasite than in mice infected with Nc1 or the NcGRA7-complemented line, indicating that NcGRA7 deficiency reduced the inflammatory response in vivo. To examine the effects of NcGRA7 deficiency on the inflammatory response at the tissue level, the mRNA expression of cytokines (TNF-α and IFN-γ), chemokines (CCL1, CCL2, CCL5, CCL7, CCL8, CCL17, CCL22, CXCL9, and CXCL10), chemokine receptors (CCR5, CCR7, CXCR3, and CXCR6), and inducible nitric oxide synthase in the peritoneal cells and spleens of mice was measured at 5 days postinfection. The expression of TNF-α, CCR5, CXCL9, and CXCL10 mRNAs was enhanced in the peritoneal cells by Nc1 infection, whereas the level of CXCL10 expression was lower in the peritoneal cells of mice infected with the NcGRA7-deficient parasite than in the Nc1-infected mice (Fig. 7B). The splenic expression of CCL2, CCL8, and CXCL9 was upregulated after N. caninum infection, and NcGRA7 deficiency reduced the expression levels of CCL2 to below those after Nc1 infection (Fig. 7C). The expression levels of CXCL10 in peritoneal cells and CCL2 in the spleen were not significantly different between Nc1 and the NcGRA7-complemented line.

FIG 7.

Expression of inflammatory markers, chemokines, and chemokine receptors in BALB/c mice at 5 days postinfection with Nc1, NcGRA7-deficient parasite (KO), or NcGRA7-complemented parasite (Comp) and in uninfected control mice. (A) Levels of IFN-γ in ascites fluid. mRNA levels in peritoneal cells (B) and spleen (C) were normalized to ACTB mRNA levels. The values per individual (symbols) and mean levels (horizontal lines) from two pooled independent experiments (n = 3 + 4) are shown. *, statistically significant differences observed with one-way ANOVA and a Tukey-Kramer post hoc analysis (P < 0.05).

Parasite tissue burden.

The number of parasites in the brain, lung, liver, and spleen tissues of mice were measured at 12 and 20 days postinfection with quantitative real-time PCR (Fig. 8). Although no statistically significant difference was found between tissue samples from the same organs from the three groups at 12 days postinfection (Fig. 8A), the number of NcGRA7-deficient parasites was higher in the spleen, but lower in the brain than the number of Nc1 at 20 days postinfection (Fig. 8B).

FIG 8.

Parasite burdens in tissues of BALB/c mice at 12 days (A) and 20 days (B) postinfection with Nc1, NcGRA7-deficient parasite (KO), or NcGRA7-complemented parasite (Comp). Values are the numbers of parasites in 50 ng of tissue DNA. The number of parasites per individual (symbols) and the mean levels (horizontal lines) are shown (12 days, n = 6 for all groups; 20 days, n = 5 for Nc1, n = 8 for KO, and n = 6 for Comp). Individuals with undetectable expression are not shown. *, statistically significant differences detected with one-way ANOVA and a Tukey-Kramer post hoc analysis (P < 0.05).

Pathological analysis of infected mice.

We performed a pathological analysis of the livers, spleens, lungs, and brains of the mice at 20 days postinfection. Scattered mild lymphocyte infiltration was observed in several livers and lungs, but no specific or differentiable lesions were found in the livers, spleens, or lungs of the mice infected with Nc1, the NcGRA7-deficient line, or the NcGRA7-complemented line. Brain lesions were common in infections with all lines and consisted of scattered lymphocytic perivascular cuffing, meningitis, focal gliosis, and focal necrosis associated with lipid-laden macrophages and gliosis. However, the severity of infection, indicated by the number of necrotic lesions, varied across individuals and brain regions, and the number of necrotic lesions was lower in the brains of mice infected with the NcGRA7-deficient line than in those of the Nc1-infected mice (see Fig. S4 in the supplemental material). Focal necrosis was mainly observed in the cerebrum and brain stem, and there was little in the cerebellum. In several cases, acidophilic tachyzoites were observed at the periphery of the necrotic lesions. In an immunohistochemical analysis, N. caninum antigen was detected in or around the inflammatory and necrotic lesions (Fig. 9). We confirmed the specificity of the reaction with rabbit NcGRA7 antibody using preimmune rabbit antibody and brain tissues of uninfected mouse (see Fig. S5 in the supplemental material). The positive signal for NcGRA7 was observed as punctate or amorphous staining, in addition to N. caninum tachyzoites, in or around the lesions (Fig. 9C and D).

FIG 9.

Immunohistochemical analysis of brain tissues of mice 30 days after infection with Nc1. Serial sections (A/B and C/D) of N. caninum-infected mouse brains were analyzed. (A) Hematoxylin and eosin (HE) staining showing inflammatory and necrotic lesions. (B) Immunohistochemical analysis with an anti-NcGRA7 antibody. NcGRA7 signal was observed around the necrotic area. (C and D) Immunohistochemical analysis with antibodies directed against NcGRA7 and N. caninum. Further details of this pathological analysis can be found in the supplemental methods in the supplemental material.

DISCUSSION

Gene deletion techniques and protein expression analyses are useful for studying the protein functions in parasites to better understand parasite biology. The recent adaptation of the CRISPR/Cas9 technology has led to extremely efficient gene editing in apicomplexan parasites (e.g., Plasmodium, Cryptosporidium, and Toxoplasma) (25). The CRISPR/Cas9 system was adapted to produce efficient targeted gene disruption and the site-specific insertions of selectable markers in T. gondii (26, 27). Very recently, Arranz-Solís et al. reported that Toxoplasma CRISPR/Cas9 constructs successfully disrupted genes in an Nc-Spain7 isolate of N. caninum (28). Similarly, we used the universal pU6 plasmid (Addgene plasmid, pSAG1::CAS9-U6::sgUPRT), which contains Cas9 with a nuclear localization sequence driven by the TgTUB1 promoter and a gRNA expression site driven by the T. gondii U6 promoter (27), to disrupt and insert genes into the Nc1 strain of N. caninum and confirm that the Toxoplasma CRISPR/Cas9 constructs were successfully used in the present study.

Three North American clonal lineages of T. gondii (types I, II, and III) differ in their activation of the immune responses, including the host NF-κB pathway. The type II strains induce a high level of NF-κB p65 translocation, whereas the type I and III strains do not (21). Although the dense granule proteins, including GRA6, GRA15, GRA16, and GRA24, are important virulence factors in T. gondii (20–23), some dense granule proteins show type-specific functions. Ma et al. (20) reported that according to a luciferase reporter assay, which was similar to the system we used in this study, the transfection of 293T cells with the cDNA of Toxoplasma GRA6 (type I strain) or GRA15 (type II strain) activated NFAT or NF-κB signal, respectively. Furthermore, Toxoplasma GRA14 (type II strain) also activated the NF-κB signal, although at an activity level lower than that induced by GRA15 (20). Interestingly, there is no homologue of Toxoplasma GRA15 in the Neospora genome (from the Toxoplasma Genomics Resource, ToxoDB). In our luciferase reporter assay, several dense granule proteins of N. caninum (NcGRA6, NcGRA7, and NcGRA14) activated the NF-κB, NFAT, and cAMP/PKA signals. These results suggest that the dense granule proteins of N. caninum contribute to the activation of the host immune responses.

In this study, we generated NcGRA6-, NcGRA7-, NcGRA14-, and NcCYP-deficient N. caninum to examine the roles of the encoded proteins. Among these constructs, the NcGRA7-deficient parasite showed reduced virulence in immunocompetent mice and immunocompromised (TLR2-deficient) mice, whereas there was no significant difference in the infection rate or intracellular growth of the parental strain Nc1 and the NcGRA7-deficient strain in vitro. Interestingly, egress of the NcGRA7-deficient line delayed compared with that of the Nc1. It may reduce the parasite burden in host body in vivo. The infection rates of the NcGRA14- and NcCYP-deficient lines were higher than that of Nc1. So we must understand these phenotypes in future study. A recent study showed that the loss of NcROP5 by N. caninum led to a reduction in mouse mortality and reduced NcGRA7 transcription in the parasite (12). According to ToxoDB, sequences that share high identity with TgROP5 (TgROP5A, TgROP5B, and TgROP5C) have been detected the genome of the N. caninum Liverpool strain: NcLIV_060730, NcLIV_060740, and NcLIV_060741, respectively (12, 29). On the contrary, RNA sequencing in this study showed no significant differences in the expression levels of Neospora ROP5 in Nc1 and the NcGRA7-deficient and NcGRA7-complemented lines (see Table S1 in the supplemental material). Moreover, the cerebral loads of the parasite in mice infected with the NcROP16-deficient strain were significantly lower than the loads in mice infected with the Nc1 strain (13), but the expression levels of NcROP16 (NcLIV_025120) did not differ in the parasite lines in our study (see Table S1 in the supplemental material). Excluding inserted and deficient genes, we found that 14 genes were downregulated or upregulated in the NcGRA7-deficient parasite, including nine genes encoding hypothetical proteins and three genes encoding unknown proteins. These genes might be related to metabolic enzymes, transporters, or cell surface antigens that are altered in response to NcGRA7 deficiency. Therefore, NcGRA7 is a key molecule in the virulence of N. caninum in mice. Although it is unknown whether NcGRA7 interacts with host factors or other parasite molecules, Toxoplasma GRA7 increases the turnover of immunity-related GTPases and contributes to the parasite's acute virulence in the mouse (30). We identified several host macrophage genes as “core” NcGRA7-regulated genes in this study. Our results suggest that NcGRA7 may be a master regulator to control host immune response. Because the secretion of NcGRA7 into the host cell cytosol was observed in Nc1-infected Vero cells 48 h postinfection (see Fig. S2A and S6 in the supplemental material), NcGRA7 may interact with host protein(s) involved in the host immune response. Therefore, in a future study, we will identify the NcGRA7-binding protein(s) to further clarify the function of NcGRA7.

In a KEGG pathway analysis of N. caninum-infected macrophage cultures, we demonstrated that NcGRA7 robustly activates the host signaling pathways, especially the production of cytokines and chemokines, as shown in Table S3 in the supplemental material. In macrophages, the production of the inflammatory cytokines IL-12p40 and IL-6 is regulated by NcGRA7. The levels of IFN-γ (an inflammatory marker) were also lower in the ascites fluid of mice infected with the NcGRA7-deficient parasites than in that of mice infected with Nc1 or the NcGRA7-complemented parasite. These results support the notion of NcGRA7-dependent inflammatory responses. The expression data for DEGs also showed that chemokine (C-X-C motif) ligand 3 (CXCL3) was upregulated in an NcGRA7-dependent manner in macrophages in vitro. The expression levels of CXCL10 in the peritoneal cells and of CCL2 in the spleen were higher in mice infected with the parental strain of N. caninum than in those infected with the NcGRA7-deficient parasite. CCL2, CXCL3, and CXCL10 control the migration and adhesion of immune cells by interacting with the cell surface chemokine receptors CCR2/4, CXCR2, and CXCR3, respectively (31–33). Therefore, NcGRA7 may play a role in parasite migration within the host body because infected dendritic cells facilitate the systemic dissemination of N. caninum in mice (34). In the present study, the dissemination of the NcGRA7-deficient parasite to the brain was lower than that of the parental strain Nc1, suggesting that the regulation of chemokines by NcGRA7 affects the parasite burden.

We also defined several host macrophage genes as “core” NcGRA7-regulated genes, as shown in Table S4 in the supplemental material. The upregulation of gene Serpinb2 and Serpine1 and the downregulation of Plau confirmed them as NcGRA7-regulated genes. Plasminogen activator inhibitor 1 (PAI-1), encoded by Serpine1, and plasminogen activator inhibitor 2 (PAI-2), encoded by Serpinb2, are serine protease inhibitors (serpins) that function as the principal inhibitors of the tissue plasminogen activator and urokinase encoded by Plau. Elevated PAI-1 is a risk factor for thrombosis and atherosclerosis (35). PAI-2 is only present in detectable quantities in the blood during pregnancy because it is produced by the placenta (36). Although the effects of PAI-1 and PAI-2 on N. caninum infection are unknown, they may be associated with the pathogenesis of peripheral and placental infections. The expression of Slc6a9, encoding sodium- and chloride-dependent glycine transporter 1, was also upregulated by NcGRA7. This transporter may play a role in the regulation of glycine levels in N-methyl-d-aspartate receptor-mediated neurotransmission (37). In our previous study, we showed that the expression of Slc6a5, which encodes sodium- and chloride-dependent glycine transporter 2, was lower in symptomatic mice than in asymptomatic mice (38). Mice deficient in glycine transporter 2 also showed neuromotor abnormalities, such as spasticity, hind feet clasping, and tremor (39). Therefore, an imbalance in glycine levels in the brain may be involved in the neuronal symptoms of N. caninum infection. Although Aldh1l2, encoding mitochondrial 10-formyltetrahydrofolate dehydrogenase, and Siglece, encoding sialic acid-binding Ig-like lectin 12, were identified as NcGRA7-regulated genes, the contributions of these genes to N. caninum infection are not known. Our pathological analysis indicated that NcGRA7 deficiency reduced the number of necrotic lesions in the brain. NcGRA7 may associated with the tissue damage that follows the inflammatory response, such as the migration of inflammatory cells and the production of inflammatory cytokines, increasing the virulence in the central nervous system.

Several host genes were downregulated by NcGRA7 in macrophages (see Table S4 in the supplemental material). Ccnd1 (encoding G₁/S-specific cyclin D1), Uhrf1 (ubiquitin-like, containing PHD and RING finger domains, 1), and Rasgrp3 (RAS, guanyl releasing protein 3) encode proteins that regulate the cell cycle and RAS signaling (40–42). Toxoplasma infection, but not Neospora infection, induces an increase in the levels of c-MYC, a tightly regulated transcription factor involved in vital cellular processes, including cell cycle progression, apoptosis, cell differentiation, and metabolism (43, 44). Therefore, the roles of these genes in N. caninum infection should be examined carefully in future studies. Interestingly, the lipid metabolism-related genes Cavin1 (caveolae associated protein 1) and Cbr2 (carbonyl reductase 2) were also identified as NcGRA7-downregulated genes, which means that the parental strain of N. caninum inhibits the expression of these genes. Cavin1 is crucial for caveola formation and function (45). Caveolae have several functions in signal transduction and are also believed to play roles in mechanoprotection, mechanosensation, endocytosis, oncogenesis, and the uptake of pathogens (46). The expression of Cbr2 (encoding AP27) is linked to adipogenic differentiation (47). However, it is unknown whether N. caninum inhibits caveola formation or adipogenic differentiation.

The expression level of NcGRA7 in NcGRA7-complemented parasites was about 37.6% of the mRNA level and 19.2% of the protein level of the parental strain Nc1. This difference may be due to promoter activity because the Toxoplasma GRA1 promoter was used in the complemented parasite. Although survival rates at 60 days postinfection were not significantly different between mice infected with Nc1 and NcGRA7-complemented parasites (P = 0.52), the survival rate of mice infected with the NcGRA7-complemented parasite (7/8, 87.5%) at 20 days postinfection was higher than that of Nc1-infected mice (3/8, 37.5%) (P = 0.04). This result suggests that the expression level of NcGRA7 may affect acute virulence of the parasite. The transcriptome of infected macrophage cultures showed broad changes of gene expression related to immune response-related pathways in an NcGRA7-dependent manner. When considering the gene expression levels in macrophage cultures infected with the NcGRA7-complemented line, upregulated genes, such as Cxcl3, Il1b, Serpinb, Slc6a9, Serpine1, Aldh1l2, and Siglece, and downregulated genes, such as Ccnd1, Rasgrp3, Uhrf1, Cavin1, Plau, and Cbr2, were identified as highly sensitive genes regulated by NcGRA7. The production of IL-12p40 and IL-6 in the macrophage cultures infected with NcGRA7-deficient parasites significantly decreased compared with Nc1-infected cell cultures. However, the cytokine levels of the macrophage cultures infected with NcGRA7-complemented parasite did not reach the levels in Nc1-infected cell cultures. In addition, compared with Nc1 infection, levels of IFN-γ in ascites fluid, CXCL10 mRNA expression in peritoneal cells and CCL2 mRNA expression in spleen were decreased in mice at 5 days after infection with NcGRA7-deficient parasites, but these levels were partially recovered on infection with NcGRA7-complemented parasites. These results may be associated with the parasite burdens in spleen and brain at 20 days postinfection. Because chemokines and chemokine receptors play a crucial role in the migration of parasite-infected immune cells into several organs, the expression levels of NcGRA7 will affect the parasite burden. Thus, suitable levels of NcGRA7 expression will be required for the phenotype of parental strain Nc1, such as its virulence and gene expression profiles in both the host and parasite.

Previous studies have demonstrated the antigenicity of NcGRA7 as a potential vaccine antigen (48), but its function has not been determined. In the present study, we show that NcGRA7 is a virulence factor in N. caninum infection. Although nervous system dysfunction and abortion are very important clinical symptoms of neosporosis, the molecular mechanism of disease onset is largely unknown. Our research approach, screening for potential virulence factors in N. caninum, provides valuable scientific information and extends our understanding of neosporosis. We identified several NcGRA7-regulated host genes with a comprehensive transcriptome analysis. However, further research is required to clarify the association between NcGRA7 and the host genes it regulates and their effects on the neurological symptoms and abortion associated with neosporosis.

MATERIALS AND METHODS

Ethics statement.

This study was performed in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the Ministry of Education, Culture, Sports, Science and Technology, Japan. The protocol was approved by the Committee on the Ethics of Animal Experiments at Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Japan (permit numbers 24-16, 29-42, and 28-47). All surgery was performed under isoflurane anesthesia, and every effort was made to minimize animal suffering.

Animals.

C57BL/6 and BALB/c mice, 6 to 8 weeks of age, were obtained from Clea Japan (Tokyo, Japan). Homozygous TLR2-knockout (Tlr2^−/−) mice were kindly provided by Satoshi Uematsu and Shizuo Akira (Osaka University, Osaka, Japan) (49). The animals were housed under specific-pathogen-free conditions in the animal facility of the National Research Center for Protozoan Diseases at Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Japan. The animals used in this study were treated and used according to the Guiding Principles for the Care and Use of Research Animals published by the Obihiro University of Agriculture and Veterinary Medicine.

Parasite and cell cultures.

Neospora caninum (Nc1 strain) was maintained in African green monkey kidney epithelial cells (Vero cells) cultured in Eagle minimum essential medium (Sigma, St. Louis, MO) supplemented with 8% heat-inactivated fetal bovine serum (FBS). Human embryonic kidney cells (293T cells) and the peritoneal macrophages were cultured in Dulbecco modified Eagle medium (DMEM; Sigma) supplemented with 10% heat-inactivated FBS. For the purification of tachyzoites, parasites and host cell debris were washed with cold phosphate-buffered saline (PBS), and the final pellet was resuspended in cold PBS and passed through a 27-gauge needle and a 5.0-μm-pore size filter (Millipore, Bedford, MA).

Plasmid construction.

All the plasmids and primers used in this study are listed in Tables 1 and 2. Further details of the plasmid construction can be found in the supplemental methods in the supplemental material.

TABLE 1.

Plasmids used in this study

Plasmid	Description	Use	Source or reference
pSAG1::CAS9-U6::sgUPRT	CAS9 expressed from the Toxoplasma SAG1 promoter and CRISPR gRNA targeting Toxoplasma UPRT produced from the U6 promoter	CRISPR plasmid targeting Toxoplasma UPRT	Addgene
pSAG1::CAS9-U6::sgNcGRA6	CAS9 expressed from the Toxoplasma SAG1 promoter and CRISPR gRNA targeting NcGRA6 produced from the U6 promoter	CRISPR plasmid targeting between nucleotides 86 and 87 in NcGRA6 gene	This study
pSAG1::CAS9-U6::sgNcGRA7	CAS9 expressed from the Toxoplasma SAG1 promoter and CRISPR gRNA targeting NcGRA7 produced from the U6 promoter	CRISPR plasmid targeting between nucleotides 113 and 114 in NcGRA7 gene	This study
pSAG1::CAS9-U6::sgNcGRA14	CAS9 expressed from the Toxoplasma SAG1 promoter and CRISPR gRNA targeting NcGRA14 produced from the U6 promoter	CRISPR plasmid targeting between nucleotides 110 and 111 in NcGRA14 gene	This study
pSAG1::CAS9-U6::sgNcCyp	CAS9 expressed from the Toxoplasma SAG1 promoter and CRISPR gRNA targeting NcCyp produced from the U6 promoter	CRISPR plasmid targeting between nucleotides 753 and 754 in NcCyp gene	This study
pUPRT::DHFR-D	DHFR* cassette flanked by two homology arms from the 5′- and 3′-UTR of UPRT gene respectively	Replacing the UPRT gene with DHFR*	Addgene
pSAG1::CAS9-U6::sgNcUPRT	CAS9 expressed from the Toxoplasma SAG1 promoter and CRISPR gRNA targeting Neospora UPRT produced from the U6 promoter	CRISPR plasmid targeting between nucleotides 88 and 89 in Neospora UPRT	This study (Neospora UPRT: NCLIV_056020)
p3XFLAG-CMV-14		Plasmid for cloning of FLAG tag fused gene	Sigma-Aldrich
p3XFLAG-CMV-NcGRA1	FLAG tag-fused NcGRA1	Luciferase reporter assay	This study (NCLIV_036400)
p3XFLAG-CMV-NcGRA2	FLAG tag-fused NcGRA2	Luciferase reporter assay	This study (NCLIV_045650)
p3XFLAG-CMV-NcGRA3	FLAG tag-fused NcGRA3	Luciferase reporter assay	This study (NCLIV_045870)
p3XFLAG-CMV-NcGRA4	FLAG tag-fused NcGRA4	Luciferase reporter assay	This study (NCLIV_054830)
p3XFLAG-CMV-NcGRA5	FLAG tag-fused NcGRA5	Luciferase reporter assay	This study (NCLIV_014150)
p3XFLAG-CMV-NcGRA6	FLAG tag-fused NcGRA6	Luciferase reporter assay	This study (NCLIV_052880)
p3XFLAG-CMV-NcGRA7	FLAG tag-fused NcGRA7	Luciferase reporter assay, insertion of FLAG tag-fused NcGRA7 DNA into pDXF	This study (NCLIV_021640)
p3XFLAG-CMV-NcGRA8	FLAG tag-fused NcGRA8	Luciferase reporter assay	This study (NCLIV_008990)
p3XFLAG-CMV-NcGRA9	FLAG tag-fused NcGRA9	Luciferase reporter assay	This study (NCLIV_066630)
p3XFLAG-CMV-NcGRA10	FLAG tag-fused NcGRA10	Luciferase reporter assay	This study (NCLIV_037450)
p3XFLAG-CMV-NcGRA12	FLAG tag-fused NcGRA12	Luciferase reporter assay	This study (NCLIV_041120)
p3XFLAG-CMV-NcGRA14	FLAG tag-fused NcGRA14	Luciferase reporter assay	This study (NCLIV_016360)
p3XFLAG-CMV-NcGRA16	FLAG tag-fused NcGRA16	Luciferase reporter assay	This study (NCLIV_003340)
p3XFLAG-CMV-NcGRA17	FLAG tag-fused NcGRA17	Luciferase reporter assay	This study (NCLIV_005560)
p3XFLAG-CMV-NcGRA21	FLAG tag-fused NcGRA21	Luciferase reporter assay	This study (NCLIV_017230)
p3XFLAG-CMV-NcGRA22	FLAG tag-fused NcGRA22	Luciferase reporter assay	This study (NCLIV_052190)
p3XFLAG-CMV-NcGRA23	FLAG tag-fused NcGRA23	Luciferase reporter assay	This study (NCLIV_006780)
p3XFLAG-CMV-NcGRA25	FLAG tag-fused NcGRA24	Luciferase reporter assay	This study (NCLIV_042680)
p3XFLAG-CMV-NcCyp	FLAG tag-fused NcCyp	Luciferase reporter assay	This study (NCLIV_004790)
p3XFLAG-CMV-NcPF	NcPF	Luciferase reporter assay	This study (NCLIV_00610)
pGL4.29	Cyclic AMP response (CRE)	Luciferase reporter assay for cAMP/PKA signal	Promega
pGL4.30	Nuclear factor of activated T cells response element (NFAT)	Luciferase reporter assay for calcium/calcineurin signal	Promega
pGL4.32	Nuclear factor-κB response element (NF-κB)	Luciferase reporter assay for NF-κB signal	Promega
pGL4.33	Serum response element (SRE)	Luciferase reporter assay for MAP/ERK signal	Promega
pGL4.34	Serum response factor response element (SRF)	Luciferase reporter assay for RhoA signal	Promega
pGL4.36	Murine mouse mammary virus long terminal repeat (MMTV-LTR)	Luciferase reporter assay for nuclear receptor signal (androgen receptor, glucocorticoid receptor, etc.)	Promega
pGL4.37	Antioxidant response element (ARE)	Luciferase reporter assay for oxidative stress signal	Promega
pGL4.38	p53 response element (p53 RE)	Luciferase reporter assay for p53 signal	Promega
pGL4.44	AP1 response element (AP1)	Luciferase reporter assay for MAPK/JNK signal	Promega
pGL4.45	Interferon-stimulated response element (ISRE)	Luciferase reporter assay for IFN-α signal	Promega
pGL4.47	sis-inducible element (SIE)	Luciferase reporter assay for IL-6 signal	Promega
pGL4.48	SMAD binding element, SBE	Luciferase reporter assay for TGF-β signal	Promega
pGL4.74	Control Renilla luciferase expression vector		Promega
pDMG	Foreign gene expressed from the Toxoplasma GRA1 5′ UTR and GRA2 3′ UTR	Plasmid for cloning of FLAG tag-fused gene	57
pDMG-NcGRA7FLAG	FLAG tag-fused NcGRA7 expressed from the Toxoplasma GRA1 5′UTR and GRA2 3′ UTR	Replacing the UPRT gene by FLAG tag-fused NcGRA7	This study
pGEX4T-1/NcGRA6	Cloned NcGRA6 gene (130–462 bp) into EcoRI and XhoI sites of pGEX4T-1 plasmid	Preparation of recombinant NcGRA6 fused with GST	This study
pGEX4T-1/NcGRA14	Cloned NcGRA14 gene (109–852 bp) into EcoRI and XhoI sites of pGEX4T-1 plasmid	Preparation of recombinant NcGRA14 fused with GST	This study

TABLE 2.

Primers used in this study

Primer	Sequence (5′–3′)a	Use
NcGRA1-InFu-1F	ACCAGTCGACTCTAGATGGTGCGTGTGAGCGCT	To clone full length of the NcGRA1 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA1-InFu-2R	AGTCAGCCCGGGATCTATGTTGCCCTTGAAGAGC
NcGRA2-InFu-1F	ACCAGTCGACTCTAGATGTTCACGGGGAAACGTT	To clone full length of the NcGRA2 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA2-InFu-2R	AGTCAGCCCGGGATCTATTGACTTCAGCTTCTGGC
NcGRA3-InFu-1F	ACCAGTCGACTCTAGATGCCTGGTAAACAGGTGC	To clone full length of the NcGRA3 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA3-InFu-2R	AGTCAGCCCGGGATCTATTTCTTTCGTGCTTGCGA
NcGRA4-InFu-1F	ACCAGTCGACTCTAGATGAAGGGTCTCTTCTTTCC	To clone full length of the NcGRA4 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA4-InFu-2R	AGTCAGCCCGGGATCTATGGCGCATTGCTTTCAAC
NcGRA5-InFu-1F	ACCAGTCGACTCTAGATGGCGTCTGTCAAACGC	To clone full length of the NcGRA5 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA5-InFu-2R	AGTCAGCCCGGGATCTCTCTTCCTCTCCTGCTTC
NcGRA6-InFu-1F	ACCAGTCGACTCTAGATGGCGAACAATAGAACCC	To clone full length of the NcGRA6 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-fusion cloning
NcGRA6-InFu-2R	AGTCAGCCCGGGATCGTTTTTCCTCCCCGCCGT
NcGRA7-InFu-1F	ACCAGTCGACTCTAGATGGCCCGACAAGCAACC	To clone full length of the NcGRA7 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA7-InFu-2R	AGTCAGCCCGGGATCTTTCGGTGTCTACTTCCTG
NcGRA8-InFu-1F	ACCAGTCGACTCTAGATGGCTGCAGTGCGCGTG	To clone full length of the NcGRA8 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA8-InFu-2R	AGTCAGCCCGGGATCTAGCATCTCCATTAGCCTC
NcGRA9-InFu-1F	ACCAGTCGACTCTAGATGATGAGGTCATTCAAGTC	To clone full length of the NcGRA9 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA9-InFu-2R	AGTCAGCCCGGGATCGTATTTCTCCGTTATGGTTC
NcGRA10-InFu-1F	ACCAGTCGACTCTAGATGCTGCTCTACTACCGC	To clone full length of the NcGRA10 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA10-InFu-2R	AGTCAGCCCGGGATCTATCACATTCCCCGCTGC
NcGRA12-InFu-1F	ACCAGTCGACTCTAGATGGAGGTTGTTGTGGCG	To clone full length of the NcGRA12 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA12-InFu-2R	AGTCAGCCCGGGATCTGCGGGGACCGGCGTTTG
NcGRA14-InFu-1F	ACCAGTCGACTCTAGATGCAGGGCGCAACGGGG	To clone full length of the NcGRA14 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA14-InFu-2R	AGTCAGCCCGGGATCTGTAGACCGAGTTACCTGA
NcGRA16-InFu-1F	ACCAGTCGACTCTAGATGTATCGGAGTCAATCGC	To clone full length of the NcGRA16 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA16-InFu-2R	AGTCAGCCCGGGATCTCTGAGTCCCATCTTCGTC
NcGRA17-InFu-1F	ACCAGTCGACTCTAGATGCGAGTGTGCGGTTCC	To clone full length of the NcGRA17 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA17-InFu-2R	AGTCAGCCCGGGATCTCTGGTTGCCACTGCCGG
NcGRA21-2-InFu-1F	ACCAGTCGACTCTAGATGATACATCAGCACCGATG	To clone full length of the NcGRA21 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA21-2-InFu-2R	AGTCAGCCCGGGATCTGAGAGAAACGCAACGTTG
NcGRA22-InFu-1F	ACCAGTCGACTCTAGATGTGGATTTTGTTGTGTATG	To clone full length of the NcGRA22 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA22-InFu-2R	AGTCAGCCCGGGATCTATTGCGCCCGTTCTTTAG
NcGRA23-InFu-1F	ACCAGTCGACTCTAGATGCTCGCGTCCGCCGAC	To clone full length of the NcGRA23 gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA23-InFu-2R	AGTCAGCCCGGGATCTGTTCTTTCGCGCGAGCA
NcGRA25-InFu-1F	ACCAGTCGACTCTAGATGAAACGGTCCTCAGTATG	To clone full length of the NcGRA25 gene into XbaI and BamHI sites of p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcGRA25-InFu-2R	AGTCAGCCCGGGATCTACGACGAGTTTGTTGAAGA
NcCyp-InFu-1F	ACCAGTCGACTCTAGATGAAGCTCCTGTTCTTCTT	To clone full length of the NcCyp gene into XbaI and BamHI sites of the p3XFLAG-CMV-14 plasmid by In-Fusion cloning
NcCyp-InFu-2R	AGTCAGCCCGGGATCTCAACAAACCAATGTCCGTG
NcPF_EcoRI_1F	ACGAATTCATGTCGGACTGGGATCCCGT	To clone full length of the NcPF gene into EcoRI and XbaI sites of the p3XFLAG-CMV-14 plasmid
NcPF_XbaI_2R	CCTCTAGATTAATAGCCAGACTGGTGAA
Common CAS9-U6-Rv	AACTTGACATCCCCATTTAC	Common primer for CRISPR/CAS9 plasmids targeting Neospora genes
NcGRA6_70-gRNAv2	GTGACGCTTGTGGCCTTCATGTTTTAGAGCTAGAAATAGC	Primer for CRISPR/CAS9 plasmids targeting the NcGRA6 gene (pSAG1::CAS9-U6::sgNcGRA6)
NcGRA7_97-gRNAv2	GAACAGCATGAAGGGGACATGTTTTAGAGCTAGAAATAGC	Primer for CRISPR/CAS9 plasmids targeting the NcGRA7 gene (pSAG1::CAS9-U6::sgNcGRA7)
NcGRA14_94-gRNAv2	GTTGTTTCAGCTGCTGGCTTGTTTTAGAGCTAGAAATAGC	Primer for CRISPR/CAS9 plasmids targeting the NcGRA14 gene (pSAG1::CAS9-U6::sgNcGRA14)
NcCyp_169-gRNAv2	GGTCTCTTCGACAAGTACAAGTTTTAGAGCTAGAAATAGC	Primer for CRISPR/CAS9 plasmids targeting the NcCyp gene (pSAG1::CAS9-U6::sgNcCyp)
NcUPRT_72-gRNAv2	GCAGGAGGAAAGCATTCTGCGTTTTAGAGCTAGAAATAGC	Primer for CRISPR/CAS9 plasmids targeting the NcUPRT gene (pSAG1::CAS9-U6::sgUPRT)
DHFR-25ntNcGRA6_70_1F	TGTTGGCGGTGACGCTTGTGGCCTTAAGCTTCGCCAGGCTGTAAA	To amplify an amplicon containing NcGRA6 homology regions surrounding a pyrimethamine-resistant DHFR* cassette
DHFR-21ntNcGRA6_70_2R	GAGCTGAGAGGCACGCCCATGGGAATTCATCCTGCAAGTGCATAG
DHFR-NcGRA7_97_1F	TGGCAACCGAACAGCATGAAGGGGAAAGCTTCGCCAGGCTGTAAA	To amplify an amplicon containing NcGRA7 homology regions surrounding a pyrimethamine-resistant DHFR* cassette
DHFR- NcGRA7_97_2R	GCCCTAACCCCATATCCGATGGGAATTCATCCTGCAAGTGCATAG
DHFR-25ntNcGRA14_94_1F	GTTCAACAGTTGTTTCAGCTGCTGGAAGCTTCGCCAGGCTGTAAA	To amplify an amplicon containing NcGRA14 homology regions surrounding a pyrimethamine-resistant DHFR* cassette
DHFR-21ntNcGRA14_94_2R	CGGTACGAAATCTCGCCCAAGGGAATTCATCCTGCAAGTGCATAG
DHFR-NcCyp_169_1Fv2	ACTTCATTGGTCTCTTCGACAAGTAAAGCTTCGCCAGGCTGTAAA	To amplify an amplicon containing NcCyp homology regions surrounding a pyrimethamine-resistant DHFR* cassette
DHFR-NcCyp_169_2Rv2	CGGTGGAACGTGCTGCCTTTGGGAATTCATCCTGCAAGTGCATAG
3⇆FLAG_pDXF_1F_rev	ATCAAGAAGCTTGATAAGCTTGCGGCCGCGAAT	To amplify NcGRA7-FLAG expressed from the Toxoplasma GRA1-5′UTR and GRA2-3′ UTR
3⇆FLAG_pDXF_2R	CTGCAGGAATTCGATGGGATCACTACTTGTCATC
NcGRA6-screen-1F	ATGGCGAACAATAGAACCCTC	To confirm the insertion of DHFR* cassette into the NcGRA6 gene
NcGRA6-screen-2R	CCCACGGCGACTGGCGGCTCA	To confirm the insertion of DHFR* cassette into the NcGRA6 gene
NcGRA7-screen-1F	ATGGCCCGACAAGCAACCTTC	To confirm the insertion of DHFR* cassette into the NcGRA7 gene and NcGRA7-FLAG cassette into the NcUPRT gene
NcGRA7-screen-2R	TACTGCCAGCTTCTTGATCAA	To confirm the insertion of DHFR* cassette into the NcGRA7 gene and NcGRA7-FLAG cassette into the NcUPRT gene
NcGRA14-screen-1F	ATGCAGGGCGCAACGGGGCGA	To confirm the insertion of DHFR* cassette into the NcGRA14 gene
NcGRA14-screen-2R	ACTACCAAAACGTTCCACCGC	To confirm the insertion of DHFR* cassette into the NcGRA14 gene
NcCyp-screen-1Fv2	GGCGACGTGGTCCCTAAGAC	To confirm the insertion of DHFR* cassette into the NcCyp gene
NcCyp-screen-2R	CTCGTCTTCGAATCTGGGGCC	To confirm the insertion of DHFR* cassette into the NcCyp gene
TgDHFR-TS-screen-2R	CAGACACACCGGTTTCTGCAT	To confirm the insertion of DHFR* cassette into the target gene
DHFR2-1F	CCATTGTGAACATCCTCAAC	To confirm the insertion of DHFR* cassette into the target gene
NcUPRT(−6-14)1F	TCTTTGATGGCACAGACACC	To confirm the insertion of NcGRA7-FLAG cassette into the NcUPRT gene
NcUPRT(265-284)2R	AAAAGCACTGCACAACATGC	To confirm the insertion of NcGRA7-FLAG cassette into the NcUPRT gene
rNcGRA6_1F_130	ATGAATTCATGGATCCGGTTGAATCCGTGGAG	To clone NcGRA6 gene (130–462 bp) into EcoRI and XhoI sites of the pGEX4T-1 plasmid
rNcGRA6_2R_462	ATCTCGAGCTATCTGTGACGTGCCTGCTGCCG
rNcGRA14_1F_109	GCGAATTCATGGGCTTGGGCGAGATTTCGTAC	To clone NcGRA14 gene (109–852 bp) into EcoRI and XhoI sites of the pGEX4T-1 plasmid
rNcGRA14_2R_852	ATCTCGAGCTACCGAGACTTGCCTCCGGATGT
TNFa-1F	GGCAGGTCTACTTTGGAGTCATTGC	Real-time PCR for expression of mouse TNF-α mRNA
TNFa-2R	ACATTCGAGGCTCCAGTGAA
IFNg_1F	GAGGAACTGGCAAAAGGATG	Real-time PCR for expression of mouse IFN-γ mRNA
IFNg_2R	TGAGCTCATTGAATGCTTGG
NOS2_1F	CATTGGAAGTGAAGCGTTTCG	Real-time PCR for expression of mouse iNOS mRNA
NOS2_2R	CAGCTGGGCTGTACAAACCTT
CCR5_1F	GACATCCGTTCCCCCTACAAG	Real-time PCR for expression of mouse CCR5 mRNA
CCR5_2R	TCACGCTCTTCAGCTTTTTGCAG
CXCR6_1F	CCCTGTACTTTATGCCTTTG	Real-time PCR for expression of mouse CXCR6 mRNA
CXCR6_2R	CTTGGAACTGTCCTCAGAAG
CCL2_1F	GGCTCAGCCAGATGCAGTTAA	Real-time PCR for expression of mouse CCL2 mRNA
CCL2_2R	CCTACTCATTGGGATCATCTTGCT
CCL5-1F	CCAATCTTGCAGTCGTGTTTGT	Real-time PCR for expression of mouse CCL5 mRNA
CCL5-2R	CATCTCCAAATAGTTGATGTATTCTTGAAC
CCL7_1F	GGATCTCTGCCACGCTTCTG	Real-time PCR for expression of mouse CCL7 mRNA
CCL7_2R	GGCCCACACTTGGATGCT
CCL8_1F	CTGGGCCAGATAAGGCTCC	Real-time PCR for expression of mouse CCL8 mRNA
CCL8_2R	CATGGGGCACTGGATATTGT
CCL17_1F	ATGTAGGCCGAGAGTGCTGC	Real-time PCR for expression of mouse CCL17 mRNA
CCL17_2R	TGATAGGAATGGCCCCTTTG
CCL22_1F	TCGCTTTTCCTCTCTGAGCC	Real-time PCR for expression of mouse CCL22 mRNA
CCL22_2F	GCCCTTTGTGGTCCCATATG
CXCL9-1F	ACCTCAAACAGTTTGCCCCA	Real-time PCR for expression of mouse CXCL9 mRNA
CXCL9-2R	TTCACATTTGCCGAGTCCG
CXCL10-1F	TGCCGTCATTTTCTGCCTCA	Real-time PCR for expression of mouse CXCL10 mRNA
CXCL10-2R	TCACTGGCCCGTCATCGATAT
Nc5-1F	ACTGGAGGCACGCTGAACAC	Quantitative PCR for calculating parasite numbers based on the detection of N. caninum DNA
Nc5-2R	AACAATGCTTCGCAAGAGGAA
Beta actin-1F	GCTCTGGCTCCTAGCACCAT	Internal control gene for real-time RT-PCR analysis
Beta actin-2R	GCCACCGATCCACACAGAGT

^aRestriction enzyme sites are indicated in boldface type.

Luciferase assay.

293T cells were transiently transfected with the reporter plasmid for the luciferase assay (Table 1), together with the pGL4.74 control Renilla luciferase expression vector (Promega) and the mammalian expression plasmid of Neospora genes, with FuGENE HD transfection reagent (Promega), according to the manufacturer's instructions. At 20 h posttransfection, the luciferase activities in the total cell lysates were measured with the Dual-Glo luciferase assay system (Promega).

Generation of NcGRA6-, NcGRA7-, NcGRA14-, and NcCYP-knockout lines.

To disrupt the NcGRA6, NcGRA7, NcGRA14, and NcCYP genes in Nc1, we cotransfected the parasite with 50 μg of each CRISPR plasmid (pSAG1::CAS9-U6::sgNcGRA6, pSAG1::CAS9-U6::sgNcGRA7 pSAG1::CAS9-U6::sgNcGRA14, or pSAG1::CAS9-U6::sgNcCyp), together with an amplicon containing the homologous regions surrounding the pyrimethamine resistance (DHFR*) cassette (5 μg), prepared by PCR amplification using the primers listed in Table 2. The electroporation of tachyzoites was performed as described previously (50). Stably resistant clones were selected by growth in pyrimethamine (1 μM) for 10 to 14 days and were subsequently screened with PCR to ensure the correct integration of DHFR* into each target gene locus (see Fig. S1 in the supplemental material; Table 2). The PCR-positive clones were further analyzed with Western blotting to confirm the loss of the target gene.

Generation of NcGRA7-complemented line.

To complement the NcGRA7 gene, we transfected the NcGRA7-deficient parasite with pSAG1::CAS9-U6::sgNcUPRT (50 μg) and the NcGRA7-FLAG DNA fragment (5 μg) containing the Toxoplasma GRA1 5′ UTR and GRA2 3′ UTR, prepared with PCR amplification from pDMG-NcGRA7FLAG and the primers listed in Table 2. Stably resistant clones were selected by growth on fluorouracil (10 μM) for 8 days and were subsequently screened with PCR to ensure the correct integration of NcGRA7-FLAG into the Neospora UPRT gene locus (see Fig. S3A in the supplemental material). PCR-positive clones were further analyzed with Western blotting and IFAT to confirm the expression of the NcGRA7–FLAG protein (Fig. 2A and see Fig. S3B in the supplemental material).

Neospora caninum infection in mice.

To compare the parasites' virulence in mice, BALB/c, C57BL/6, and Tlr2^−/− mice were intraperitoneally inoculated with N. caninum (10⁶ tachyzoites/mouse). The mice were observed daily for up to 60 days postinfection. The parasite burdens were quantified in the brains, lungs, livers, and spleens of the BALB/c mice at 5 and 12 days postinfection. To analyze mRNA expression, spleen and peritoneal exudate cells were collected from the BALB/c mice at 5 days postinfection. For the pathological analysis and immunohistochemistry, brain, lung, liver, and spleen tissues were collected from the BALB/c mice at 20 and 30 days postinfection, respectively.

Monolayer cultures of peritoneal macrophages.

Mouse peritoneal macrophages were collected from mice 4 days after the intraperitoneal injection of 1 ml of 4.05% brewer-modified BBL thioglycolate medium (Becton and Dickinson, Sparks, MD) by washing their peritonea with 5 ml of cold PBS. After harvesting, the cells were centrifuged at 800 × g for 10 min and suspended in DMEM supplemented with 10% FBS. A macrophage suspension (2 × 10⁶ cells per well) was added to 12-well tissue culture microplates. The suspension was incubated at 37°C for 3 h, washed thoroughly to remove nonadherent cells, and incubated further at 37°C overnight. Then, 2 × 10⁵ parasites were added to each well. At 2 h postinfection, the extracellular parasites were washed away and DMEM supplemented with 10% FBS was added. At 20 h postinfection, the culture supernatants and cells were collected for the measurement of cytokines and RNA extraction, respectively.

RNA sequencing.

RNA from the macrophage cultures was sequenced as described in our previous studies (38, 51, 52). Briefly, 1 μg of total RNA was subjected to poly(A) selection and a sequence library was constructed with the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA). The library generated was sequenced with 36-bp single-end reads using the Illumina Genome Analyzer IIx and TruSeq SBS kit v5-GA (36-cycle; Illumina) according to the manufacturer's instructions. Raw sequence reads were subjected to quality control, and the cleaned reads were mapped to the reference mouse genome (mm10) with CLC Genomics Workbench version 10 (GWB; CLC bio, Aarhus, Denmark) (read mapping parameters: minimum fraction length of read overlap = 0.95 and minimum sequence similarity = 0.95). The remaining unmapped reads were mapped to the reference N. caninum Liverpool strain genome (ToxoDB-35_NcaninumLIV) (read mapping parameters: minimum fraction length of read overlap = 0.8 and minimum sequence similarity = 0.8). Only uniquely mapped reads were retained for further analysis. All the samples were subjected to principal-component analysis (PCA) using the PCA for transcriptome sequencing (RNA-seq) function in CLC GWB to gain an overview of the whole expression data and look for classification patterns.

Identification of DEGs.

For both the host and parasite gene expression data, the expression of each gene was compared between the Nc1 and NcGRA7-deficient parasites using the differential expression for RNA-seq function in CLC GWB. DEGs were identified as genes with a log₂-fold change of >1 or < −1 and an FDR of <0.05.

KEGG pathway enrichment analysis.

The KEGG database is a bioinformatic tool that assembles large-scale molecular data sets, such as gene lists, into biological pathway maps (53). The list of host DEGs was subjected to a KEGG pathway enrichment analysis using the clusterProfiler package (54) in the statistical environment R to assess their overarching function. Following CPM normalization, the expression of each gene in the enriched pathways was normalized with Z-score normalization and visualized. Normalized gene expression was visualized in a heatmap using the heatmap.2 function (55) in the gplots package in R. The genes were hierarchically clustered based on the Pearson correlation distance and the group average method.

Cytokine ELISAs.

The supernatants of macrophage cultures and the ascites fluids of mice were collected to measure the IL-6, IL-12p40, and IFN-γ levels with enzyme-linked immunosorbent assay (ELISA) kits (Mouse OptEIA ELISA set; BD Biosciences, San Jose, CA) according to the manufacturer's instructions. The cytokine concentrations were calculated from curves generated from cytokine standards analyzed on the same plates.

Real-time RT-PCR analysis of chemokine expression.

Total RNA was extracted from cells or homogenized tissues using TRI Reagent (Sigma-Aldrich). The RNA was reverse transcribed with a PrimeScript II First Strand cDNA synthesis kit (TaKaRa Bio, Inc., Shiga, Japan) according to the manufacturer's instructions. The cDNA was amplified with reverse transcription-PCR (RT-PCR) using PowerUp SYBR green master mix (Thermo Fisher Scientific, Inc., Waltham, MA) and 500 nM gene-specific primers in a 10-μl total reaction volume according to the manufacturer's protocol. The primer sequences used for real-time RT-PCR are shown in Table 2. ACTB (encoding β-actin) was selected as the internal control gene using RefFinder (56). The relative mRNA levels were calculated as described previously (10).

DNA isolation and real-time PCR analysis of N. caninum distribution.

DNA was extracted from the tissues (brain, liver, lungs, and spleen) as follows. Each tissue or organ was thawed in 10 volumes of extraction buffer (0.1 M Tris-HCl [pH 9.0], 1% SDS, 0.1 M NaCl, 1 mM EDTA) and 100 μg/ml proteinase K at 55°C. The DNA was purified with phenol-chloroform extraction and ethanol precipitation. The parasite DNA was then amplified with primers specific to the N. caninum Nc5 gene (Table 2). Amplification, data acquisition, and data analysis were performed in the ABI Prism 7900HT sequence detection system (Applied Biosystems), and the cycle threshold values (C_T) were calculated as described previously (10, 38). A standard curve was constructed using 10-fold serial dilutions of N. caninum DNA extracted from 10⁵ parasites; thus, the curve ranged from 0.01 to 10,000 parasites. The parasite number was calculated from the standard curve.

Statistical analysis.

Data are expressed as means ± the standard deviations or as scatter diagrams. The various assay conditions were evaluated with analysis of variance (ANOVA) followed by Tukey's multiple-comparison test. The significance of the differences in survival at 60 days postinfection was analyzed with a χ² test. A P value of <0.05 was considered statistically significant.