Over-expression of StZFP2 in Solanum tuberosum L. var. Kennebec (potato) inhibits growth of Tobacco Hornworm larvae (THW, Manduca sexta L.)

ABSTRACT

Tobacco hornworm (Manduca sexta, THW) is a voracious pest of tomato and potato. StZFP2 is a Q-type C2H2 zinc finger transcription factor (TF) that is induced upon wounding and infestation. Previous work has shown that Q-type C2H2 TFs are involved in stress responses and when over expressed, can enhance protection against drought, salinity or pathogen infection. Twelve transgenic lines (S1-S12) were tested that over-express StZFP2. Feeding S6 or S8 to THW significantly lowered larval weight (21–37%) as well as increased expression of StPIN2 in comparison to untransformed Kennebec. The increase in StPIN2, a classic marker for insect defense in potato, is consistent with the decreases in larval weight gain.

StZFP2 is a member of the Q-type C2H2 zinc finger protein family. While there are 176 C2H2 zinc finger proteins (ZFPs) in Arabidopsis,¹ there are only 18 Q-type C2H2 ZFPs.^1,2 The Q-type C2H2 is a thirty-amino acid zinc finger domain with an invariant QALGGH motif containing two Cys and two His residues that coordinate to bind a zinc ion. The Q-type C2H2 ZFPs (referred to here as ZFPs) have two zinc finger domains and these ZFPs are transcription factors (TF). The zinc bound domains interact with specific upstream regions of genes to control their expression. Another motif found in these ZFPs is the conserved DLN domain, which is an active repressor domain.^3,4 The repressor domain was named for the first protein in which it was identified, an ethylene-responsive element-binding factor (ERF)-associated amphiphilic repression or EAR domain. Recent evidence from Arabidopsis has shown that the EAR domain in several ZFPs repress by binding a corepressor such as TOPLESS (TPL) or four TPL related corepressors.⁵ The corepressor in turn binds a histone deacetylase complex, which closes the chromatin surrounding the gene the TF has bound.⁶ The zinc finger domain of these ZFPs bind specific genes while the EAR motif, as an active repressor, negatively regulates the gene that is bound to these ZFPs.

Q-type C2H2 ZFPs have often been associated with environmental stress.^2,7 When these ZFPs are over-expressed (OE), they can increase tolerance to that stress. For example, one of these ZFPs, OE-Zat7 enhances tolerance to salinity stress, while mutation of the EAR motif results in loss of that tolerance. ⁸ This suggests that negative regulation of genes interacting with Zat7 play a part in the tolerance. Over-expression of other ZFPs also results in an increase in tolerance to the stress that induces them.^7–12 Shi et al. demonstrated that OEZat6 lines enhance tolerance to bacterial infection, freezing, drought and salinity stress, while artificial microRNA of Zat6 reduce tolerance.¹¹ Yin et al. found that OEZat18 lines were more tolerant to drought stress while T-DNA mutant Zat18 lines were less tolerant.¹²

Only two ZFPs have been examined in potato. Tian et al. characterized StZFP1 and found it to be induced by Phytophthora infestans, salinity and abscisic acid.¹³ Ectopic-expression in tobacco resulted in an enhanced tolerance to salinity.¹³ Both StZFP1 and StZFP2 are induced by wounding and infestation by the chewing insects Tobacco hornworm (Manduca sexta, THW) and Colorado potato beetle (Leptinotarsa decemlineata).¹⁴ The effect of Arabidopsis ZFP mutants (zat10, zat12 and azf1) on herbivory has been examined by Schweizer et al., and demonstrates a decrease in resistance to the insect pest Spodoptera littoralis.¹⁵ However, there has not been an example of OEZFP lines that enhance tolerance to infestation. In this work, transgenic plants over-expressing StZFP2 in Solanum tuberosum var. Kennebec were subjected to feeding by THW. Untransformed Kennebec was used as a control (herein referred to as Kennebec). Since the potato defense gene StPIN2 (serine proteinase inhibitor type II) inhibits growth of THW when expressed in transgenic tobacco¹⁶ the transcript level of this classic insect defense marker gene,¹⁷ was determined.

Effect of OE-StZFP2 in potato

Typically, levels of StZFP2 transcript in non-stressed Kennebec leaves is extremely low compared to transcript levels of other genes (author’s observations). The expression of StZFP2 transcript increases upon THW infestation 80-fold by 4hr.¹⁴ The twelve 35S-StZFP2 lines (S1-S12) as well as Kennebec were tested for basal levels of StZFP2 transcript using qRT-PCR. Figure 1A shows Ct values of StZFP2 and an endogenous control St18S in Kennebec and the 12 transgenic lines. Due to how qRT-PCR works, Ct values refer to the cycle in which a set threshold is obtained. Therefore, the lower the Ct value the higher the amount of the transcript. The level of StZFP2 in Kennebec had a Ct value of 33 while the transgenic lines ranged from the high end of 19.4 for S4 to the low end 23.2 for S6 (Figure 1A). This represents an increase from the basal level of StZFP2 found in Kennebec to 17,731 fold for S4 and 1,673 fold for S6. Clearly this is a much higher change then the 80-fold amount found in THW infested Kennebec plants.¹⁴

Figure 1.

A: The level of StZFP2 transcript increased in the transgenics compared to Kennebec. The levels of StZFP2 transcript are shown in decreasing order from high near the vertical axis to low. The amount of 18S transcript was also higher in the transgenics compared to Kennebec. However, the amount of 18S transcript varies in comparison to StZFP2. S6 contains the least amount of StZFP2 and had a level of 18S approximating the level in Kennebec. B: Kennebec seedlings are above and C: S1-S8 below. Sense transgenics containing the highest amount of StZFP2 transcript were generally stunted with narrower leaves. D: The Kennebec plant on the left and S4 on the right are the same age. This shows the markedly slower growth of S4 compared to untransformed Kennebec. S4 also contains the largest amount of StZFP2 transcript.

Levels of St18S were also affected by the high levels of StZFP2 in the transgenics (Figure 1A). While the 18S Ct value for Kennebec was 7.04, the transgenics ranged from a Ct value of 4.98 for S2 and 6.56 for S6. While the difference in the Ct values for 18S were generally within a 2 Ct range required of an endogenous control, it is clear that these higher levels of StZFP2 affected the 18S transcript. The untransformed Kennebec had more foliage and broader leaves than the transformed plants expressing the highest levels of StZFP2 (Figure 1B,C). The stature of S4, which contains the highest amounts of StZFP2 transcript, clearly is stunted in comparison to untransformed Kennebec (Figure 1D).

Effect of OE-StZFP2 on Tobacco hornworm (THW)

The goal of this work was to determine whether ectopic expression of StZFP2 affected resistance to the insect pest THW. Figure 2A shows the results of an infestation experiment. Late 1^st instar larvae fed for 9 days until they reached late 3^rd instars. Larvae feeding on transgenic line S6 had a 22% lower final weight compared to Kennebec while transgenic line S8 had an almost significantly lower (P < 0.1) larval weight of 21% less compared to Kennebec. Interestingly, an increase in feeding was also detected in S10, but that value has not been confirmed. Figure 2B shows the effect of S6 and S8 transgenic lines on THW larval weight, using a different source of THW larvae and with 2^nd instars rather than 1^st instars. The larvae fed for 7 days until they reached early 4^th instars. Larvae feeding on both S6 and S8 were significantly lower in weight than larvae feeding on Kennebec. In this experiment larvae weighed 37% less on S6 and 35% less on S8 compared to Kennebec.

Figure 2.

A: 1^st instar and B; 2^nd instar THW larval weight feeding on Kennebec or sense transformants ectopically expressing StZFP2. (** P < 0.01, *P < 0.05) A t-test was performed and A: 1^st instar larvae feeding on S6 were significantly smaller than larvae feeding on Kennebec. Larvae feeding on S8 were almost significantly different with a P value of 0.1. B: 2^nd instar larvae feeding on S6 and S8 were significantly smaller than larvae feeding on Kennebec. C: StZFP2 gene expression was increased in the S6 and S8 as shown in Figure 1. The level of expression after 30 hr of infestation however did not alter the levels of StZFP2. D: Expression of the infestation marker gene StPIN2 was determined before and 30 hr after 2^nd instar THW larvae feeding on potato plants. S6 expressed more StPIN2 than untransformed Kennebec. While the mean expression level of S8 upon infestation was higher for StPIN2 compared to Kennebec, it was not significantly different.

Gene expression was measured before and 30 hrs after infestation using qRT-PCR. Levels of StZFP2 and StPIN2 were examined. The levels of StZFP2 in the transgenic plants were similar before and after 30hr of infestation (Figure 2C), however the levels of the infestation induced marker gene StPIN2 were increased in Kennebec and significantly higher in S6 and perhaps S8 (Figure 2D), which supports the modest increases in resistance to THW.

Discussion

Expressing StZFP2 under the control of the 35S promoter causes a high constitutive and widely varying amount of StZFP2 transcript in different transgenic lines (from 17,731–1,673 fold differences). In a no-choice feeding assay two of the transgenic lines S6 and perhaps S8 result in decreased larval weight. Of the 12 transgenics S6 has the lowest amount of StZFP2 and the most resistance to THW. Although the amount of StZFP2 in S6 was not significantly different upon infestation, the level of StPIN2 was markedly higher than Kennebec. Perhaps S6 contains the amount of StZFP2 that can enhance the plants response to infestation by THW, while the higher amounts in other transgenic lines result in stunted growth and an inability to enhance defense. Work of Shi et al and Yin et al have examined abiotic stress tolerance and found that OE-lines enhance while mutant lines reduce tolerance to the stress. ^11,12 Our observations are comparable to the results in Arabidopsis where the mutant ZFP lines zat10, zat12 and azf1 are more susceptible to insect infestation.¹⁵ Our findings confirm the author’s hypothesis that ZFPs play a role in the plant defense response.¹⁵ Critical information is needed to determine why a higher amount of StZFP2 alters the defense response. Perhaps this higher constitutive level of StZFP2 pre-primes the defense response against insect infestation. Until it is known what genes interact with StZFP2 protein, it is difficult to understand how this negative regulator enhances the defense response.

Control of the levels of StZFP2 protein may also be post-translational. A poplar ZFP (PtZFP1) has been identified as a MAPK (mitogen-activating protein kinase) interacting factor.¹⁸ It contains a typical EAR motif with the MDS (MAPK docking site) overlapping with its EAR-repressor. The MDS site when phophorylated can be tagged for degradation by the 26S proteasome. StZFP2 contains the exact same MDS site. Therefore, it is also possible that higher levels of StZFP2 transcript may increase the protein levels, and via the EAR domain StZFP2 protein may be regulated by MAPKs and turned over, to control its expression. Perhaps, a specific level of StZFP2 is needed, not too much and not too little, to enhance the defense response in potato. While it is counterintuitive that enhanced tolerance results by over expression of a TF whose mode of function is to negatively regulate transcription, perhaps determining the transcripts bound by StZFP2 using ChIP-Seq may give some insight into how the tolerance to insect feeding may be revealed.

Materials and methods

Construction of StZFP2 over-expressing potato lines

To examine the effect of overexpressing StZFP2, the entire ORF of StZFP2 (NCBI-BQ121106.1) was cloned into the vector pH7WG2, between the 35S promoter and terminator¹⁹ and transformed into S. tuberosum var. Kennebec. Twelve transformed lines were selected using PCR to confirm the presence of the 35S-StZFP2 DNA. Nodal cuttings of Kennebec and the sense transgenics were transferred to Murashige & Skoog (MS) Basal Medium w/Sucrose & Gelzan and grown for three weeks in Plantcons^TM in a Percival CU22L tissue culture chamber with a 16/8 light/dark cycle at 24°C. Rooted nodal plantlets were transferred to 3.5” Arabipots (Lehle Seeds) containing Sunshine LC1 mix (Sun Gro Horticulture, Inc) for 3 weeks in a Conviron CMP6050 growth chamber (with a 16:8 light/dark and 25°C day/20°C night temperature) so that the plants were large enough to sustain THW larvae over several instars.

Assay of resistance of OE-StZFP2 transgenic lines to THW

THW larvae were supplied in-house and were maintained with artificial diet.²⁰ Eggs originated from Carolina Biological Supply (Burlington, NC, USA). THW eggs from the colony were hatched on diet. In the first test, late first instar larvae were used. Two larvae were place on each plant, with 4 plants for each transgenic line and 5 plants for the Kennebec control. The larvae were harvested and weighed after 9 days. In the 2^nd test THW were purchased from Great Lakes Hornworm, and hatched on diet. 2^nd instar larvae were selected and harvested after 7 days as early 4^th instar larvae. The final larval weight was determined. Statistical differences between Kennebec and the individual transgenic lines were determined using a Student’s t-test.

RNA isolation and qRT-PCR analysis of potato

RNA was isolated using TRIzol with the manufacturer’s protocol. cDNA was made using SuperScript VILO Master Mix (Invitrogen). 2.5ug template RNA and 1ng luciferase RNA (Promega) was used in a total volume of 20ul. cDNA was diluted to 5ng/ul and 10ul was used for Real time PCR. Custom Taqman assays were designed for each gene used for qRT-PCR (Life Technologies). Sequences for the primer/probe combinations used in this study are listed in Table 1. The qRT-PCR was performed using the 7500 Real Time PCR System and Taqman assays were executed in accordance with manufacturer’s guidelines using 25 ng cDNA (Life Technologies). The Comparative Ct method was used to calculate transcript abundance for each gene.²¹ The results are graphed using either Ct or the 2^-dCt values as relative transcript levels to compare untransformed Kennebec to the transgenics. The relative transcript levels represent three biological replicates. The error bars represent standard deviation between the three biological replicates.

Table 1.

Primers used in this study.

target	F Primer	R Primer	probe
luciferase	AGAGCTGTTTTTACGATCCCTTCAG	GCGAAGAATGAAAATAGGGTTGGT	ACGCACTTTGAATTTT
St18S	CGTCCTAGTCTCAACCATAAACGAT	CCCGGAACCCAAAAACTTTGATT	ACATCCGCCGACCCCT
StZFP2	AGTAGAGGCCATGGCTAATTGTG	CTGATGATGAAGAAGGTTTTTGAAACGA	CAACAGCGCCATTAA
StPIN2	GTTGTGCAGGTTATAAAGGTTGCA	TGAACGGAGACATTTTGAATAGGCAATAT	TTGGGTCAGATTCTCC

Genbank accession numbers for gene sequences; Luciferase (X65316.2), St18S (X67238.1), StZFP2 (BQ121105.2), StPIN2 (KJ475532).

Funding Statement

This work was supported by the United States Department of Agriculture-Agricultural Research Service [Project Number:8042-22000-288-00D];

Abbreviations

Ct

cycle threshold

EAR

ethylene-responsive element-binding factor (ERF)-associated amphiphilic repression

Kennebec

Untransformed Kennebec

OE

over-expressed

S1-S12

35S-StZFP2 lines

StPIN2

serine proteinase inhibitor type II

TF

transcription factor

THW

Tobacco hornworm

TPL

TOPLESS

ZFPs

Q-type C2H2 zinc finger proteins

Author Contributions

SDL conceived the project. SDL and NGN designed the experiments and NGN performed them. SDL wrote the manuscript with the help and advice of NGN.

Conflict of interest

The authors report no conflict of interest.

Disclosure statement

This research was funded solely by USDA-ARS and all research took place in a USDA-ARS facility. Consequently, there is no additional business or financial interests that would result in a conflict of interest.

Health and Safety

All mandatory laboratory health and safety procedures have been complied with in the course of conducting any experimental work reported in your paper.