Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Sep 6.
Published in final edited form as: Cell. 2018 Aug 23;174(6):1477–1491.e19. doi: 10.1016/j.cell.2018.07.041

TBK1 suppresses RIPK1-driven apoptosis and inflammation during development and in aging

Daichao Xu 1,#, Taijie Jin 2,3,#, Hong Zhu 1, Hongbo Chen 1, Dimitry Ofengeim 1, Chengyu Zou 1, Lauren Mifflin 1, Lifeng Pan 4, Palak Amin 1, Wanjin Li 1, Bing Shan 2, Masanori Gomi Naito 1, Huyan Meng 2,3, Ying Li 2, Heling Pan 2, Liviu Aron 5, Xian Adiconis 6, Joshua Z Levin 6, Bruce A Yankner 5, Junying Yuan 1,2,8,*
PMCID: PMC6128749  NIHMSID: NIHMS1502270  PMID: 30146158

Summary

Aging is a major risk factor for both genetic and sporadic neurodegenerative disorders. However, it is unclear how aging interacts with genetic predispositions to promote neurodegeneration. Here we investigate how partial loss-of-function of TBK1, a major genetic cause for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) comorbidity, leads to age-dependent neurodegeneration. We show that TBK1 is an endogenous inhibitor of RIPK1 and the embryonic lethality of Tbk1−/− mice is dependent on RIPK1 kinase activity. In aging human brains, another endogenous RIPK1 inhibitor, TAK1, exhibits a marked decrease in expression. We show that in Tbk1+/− mice, the reduced myeloid TAK1 expression promotes all the key hallmarks of ALS/FTD, including neuroinflammation, TDP-43 aggregation, axonal degeneration, neuronal loss and behavior deficits, which are blocked upon inhibition of RIPK1. Thus, aging facilitates RIPK1 activation by reducing TAK1 expression, which cooperates with genetic risk factors to promote the onset of ALS/FTD.

Keywords: RIPK1-dependent apoptosis, necroptosis, ALS, FTD

In brief

A progressive loss of TAK1-mediated RIPK1 inhibition can synergize with genetic risk factors to promote neuroinflammation and provides a direct link between aging and the onset of neurodegenerative disorders

GRAPHIC ABSTRACT

graphic file with name nihms-1502270-f0001.jpg

Introduction

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are related neurodegenerative diseases with shared genetic susceptibilities (Ghasemi and Brown, 2017). ALS primarily leads to the progressive degeneration of motor neurons, while FTD, the second most common cause of early onset dementia after Alzheimer’s disease (AD), is characterized clinically by behavioral abnormalities or language dysfunction with progressive degeneration of the frontal and temporal lobes in the brain (Onyike and Diehl-Schmid, 2013). Activated microglia are a universal feature of ALS/FTD pathology (Lall and Baloh, 2017).

TBK1 mutations are a major genetic cause of patients with ALS/FTD comorbidity (10.8%) and to a lesser extent causal in ALS alone (0.5%) (Cirulli et al., 2015; Freischmidt et al., 2017). TBK1, originally identified as a kinase that mediates the ability of TANK to activate NF-κB, is not required for the activation of NF-κB mediated by TNFα, IL1 or CD40/CD40L (Pomerantz and Baltimore, 1999). TBK1 contains an N-terminal kinase domain, a ubiquitin-like domain (ULD) and two C-terminal coiled-coil domains (CCD1 and CCD2). Reduced expression of TBK1 by the mutant alleles associated with ALS/FTD has led to the proposal that haploinsufficiency of Tbk1 is a pathological mechanism. However, it is unclear how reduced expression of TBK1 in individuals with Tbk1 mutations might promote the onset of ALS and FTD.

Aging is a major risk factor in the development of all chronic neurodegenerative diseases, including ALS and FTD (Niccoli et al., 2017). The mean onset of ALS and FTD is between 50 and 65 years of age. Individuals with familial mutations that predispose them to ALS/FTD may live asymptomatically until middle age. Aging is known to be associated with an increase in neuroinflammation, which is mediated by microglia (Conde and Streit, 2006; Perry et al., 1993). The kinase activity of RIPK1 plays a central role in mediating neuroinflammation by promoting the activation of microglia in multiple neurodegenerative diseases including ALS, AD and multiple sclerosis (MS) (Caccamo et al., 2017; Ito et al., 2016; Ofengeim et al., 2015; Ofengeim et al., 2017). RIPK1 is suppressed by inhibitory phosphorylations mediated directly by TAK1 and by the kinases activated by TAK1, including MK2 and IKKs (Dondelinger et al., 2015; Geng et al., 2017; Jaco et al., 2017; Menon et al., 2017). Cells with the loss of TAK1-mediated suppression of RIPK1 kinase can directly promote RIPK1-dependent apoptosis (RDA) upon stimulation by TNFα (Geng et al., 2017; Mihaly et al., 2014; Morioka et al., 2014). Activation of RIPK1 can also mediate an alternative form of regulated necrotic cell death called necroptosis. This regulated necrosis is mediated by the activation of RIPK1 and subsequent activation of RIPK3 which in turn phosphorylates MLKL (Weinlich et al., 2017). Although necroptosis has been implicated in mediating the pathology of neurodegenerative diseases including ALS, AD and MS (Ito et al., 2016; Ofengeim et al., 2015; Ofengeim et al., 2017), a corresponding role for RDA in mediating these diseases has yet to be demonstrated. Furthermore, the molecular mechanisms of age-dependent activation of RIPK1 contributing to neurodegeneration in the human central nervous system (CNS) remain unclear.

In this study, we investigate the mechanism by which Tbk1 knockout mediates embryonic lethality during development and how TBK1 reduction-of-function can promote neuroinflammation in the adult CNS. We show that the embryonic lethality of Tbk1−/− mice is completely rescued by the genetic inhibition of RIPK1 kinase activity with Ripk1D138N knock-in mutation, but only partially by Ripk3 knockout. We demonstrate that TBK1 inhibits the activation of RIPK1 by direct phosphorylation of T189/T190 of human/murine RIPK1. TBK1 deficiency sensitizes cells to RDA induced by TNFα. Furthermore, double heterozygosity of TBK1 and TAK1 is sufficient to promote the activation of RIPK1 by TNFα. Interestingly, we find that TAK1 levels are decreased in the aging normal human brains (>60 years old). We modeled the interaction of TBK1 and TAK1 in a new animal model of ALS/FTD with TBK1 heterozygosity and myeloid-specific reduction of TAK1 expression. We show that 50% reduction of myeloid TAK1 expression in Tbk1+/− mice is sufficient to promote all key hallmarks of ALS/FTD including neuroinflammation, TDP-43 aggregation, axonal degeneration, neuronal loss and behavior deficits, which are rescued by inhibition of RIPK1. Thus, the genetic susceptibility induced by TBK1 heterozygosity can be compounded by aging-induced reduction of TAK1 expression in the brains to promote the activation of RIPK1 and ALS/FTD.

Results

Inhibition of RIPK1 kinase activity blocks embryonic lethality of Tbk1−/− mice

While Tbk1+/− mice appear normal, Tbk1−/− mice die between embryonic day 13.5 (E13.5) and 14.5 (E14.5) with no live births (Bonnard et al., 2000) (Figure S1A). We found that the embryonic lethality of Tbk1−/− mice could be fully rescued by either a heterozygous or a homozygous RIPK1 kinase-dead D138N knock-in mutation (Figures 1A and S1B). Both Tbk1−/−;Ripk1D138N/+ mice and Tbk1−/−;Ripk1D138N/D138N mice remained healthy and fertile as adults (Figures S1C-S1F). Thus, the embryonic lethality of Tbk1−/− mice is mediated by abnormal activation of the kinase activity of RIPK1.

Figure 1. Inhibition of RIPK1 kinase activity blocks embryonic lethality of Tbk1−/− mice.

Figure 1.

(A) Numbers of offspring from intercrossing Tbk1+/−;Ripk1D138N/D138N parents. (B) Histological analysis and TUNEL assays were performed on E13.5 liver sections (n=3). H&E, haematoxylin and eosin. (C and D) The liver samples (E13.5) were analyzed by immunoblotting (C) and immunostained for cleaved caspase-3 (CC3), RIPK1 or DAPI for nuclei (n=3) (D). (E) Quantitative RT-PCR analysis of the mRNA expression of cytokines and chemokines in E13.5 pups’ liver (n=9, mean ± SEM). ( F) The numbers and genotypes of weaned offspring from Tbk1+/−;Ripk3−/− parents. (G) p-RIPK3 immunohistostaining (brown, n=3). Microscopic quantification of p-RIPK3 positive cells on liver sections (E13.5) (right). (mean ± SEM. **p < 0.01, ***p < 0.001). See also Figures S1 and S2.

We performed histological analysis and TUNEL assays on sections from E13.5 wild-type (WT) and Tbk1 knockout embryos. Tbk1−/− embryos showed severe liver degeneration with a large number of TUNEL+ cells (Figure 1B). Tbk1−/− fetal livers exhibited activated caspase-3 (CC3) and the cleavage of PARP1 as assessed by immunoblot analysis and by immunostaining of CC3 throughout the liver but not the brain (Figures 1C, 1D and S1G). Interestingly, these hallmarks of apoptosis were completely blocked by heterozygous or homozygous Ripk1D138N mutation (Figures 1B–1D). In addition, we also observed significant increases in the levels of proinflammatory cytokines and chemokines in Tbk1−/− fetal livers, including Il1a/b, Il6, Tnf, Cxcl1, Ccl2 and Ccl5, which were blocked in Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice (Figure 1E).

RIPK1 activation can be assessed by examining its differential solubility within cells and tissues (Ito et al., 2016; Ofengeim et al., 2015; Ofengeim et al., 2017). We found that RIPK1 levels in fetal livers isolated from Tbk1−/− mice were decreased in the mild detergent (NP-40) fraction but elevated in the insoluble 6M urea fraction, similar to prior studies that showed RIPK1 activation in human tissue samples from ALS, MS and AD patients (Caccamo et al., 2017; Ito et al., 2016; Ofengeim et al., 2015; Ofengeim et al., 2017). This change in the solubility of RIPK1 in the Tbk1−/− tissue was rescued upon inhibition of RIPK1 by either heterozygous or homozygous Ripk1D138N mutation (Figure 1C). Furthermore, RIPK1 puncta were detected in CC3+ apoptotic cells with condensed nuclei (Figures 1D and S1H), but not in the Tbk1−/−;Ripk1D138N samples (Figure 1D). The activation of RIPK1 in Tbk1−/− fetal livers was further confirmed by p-RIPK1(S166) immunostaining (Figures S1I and S1J), a marker of RIPK1 activation (Berger et al., 2014; Degterev et al., 2008; Ofengeim et al., 2015).

Genetic knockout of Ripk3 (KO) had only partial efficacy in rescuing embryonic lethality of Tbk1−/− mice (Figures 1F and S2A-S2C). Using a validated p-RIPK3 (T231/S232) antibody (Figure S2D), a marker for its activation (Cho et al., 2009; Sun et al., 2012), we detected cells with activated RIPK3 in Tbk1−/− fetal livers which were absent in Tbk1−/−;Ripk1D138N/D138N fetal livers (Figure 1G). RIPK3 KO partially prevented the activation of caspase-3 in the fetal livers and restored the viability of only a subset of E13.5 Tbk1−/− embryos (Figures S2C and S2E). Thus, RIPK3 deficiency can partially suppress the embryonic lethality of Tbk1−/− mice.

Collectively, these findings suggest that TBK1 suppresses RIPK1 activation during embryonic fetal liver development. TBK1 deficiency promotes RDA by promoting caspase activation during embryonic development. Since inhibition of RIPK1 kinase is more effective in blocking the activation of caspases than RIPK3 deficiency, Ripk1D138N mutation is more successful than Ripk3 knockout in rescuing the survival of Tbk1−/− mice.

TBK1 deficiency promotes RIPK1 activation and RDA

To understand the mechanism by which TBK1 deficiency promotes RDA, we generated immortalized mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Tbk1−/−littermates. TBK1 deficiency greatly sensitized cells to TNFα-induced apoptosis with activation of caspase-8, which did not occur in WT cells; however, TBK1 deficiency had no effect on STS-induced apoptosis (Figures 2A, 2B and S3A). The increased sensitivity of Tbk1−/− MEFs to TNFα was suppressed by the expression of WT TBK1, but not by TBK1 kinase-dead K38A mutant (Figure S3B). NF-κB activation in Tbk1−/− MEFs stimulated by TNFα was not altered (Figure S3C). There was a slight enhancement of IKKα/β and IκBα phosphorylation in TNFα-stimulated Tbk1−/− MEFs compared to WT cells (Figure S3D). We found that the RIPK1 kinase inhibitor R-7-Cl-O-Necrostatin-1 (Nec-1s) (Degterev et al., 2005) completely protected Tbk1−/− MEFs from apoptosis induced by TNFα (Figures 2A, 2B and S3E). The sensitization of TBK1 deficiency to TNFα-mediated apoptosis was also blocked in Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N MEFs (Figures 2C and S3F). Increases of both p-RIPK1(S166) and CC3 in Tbk1−/− MEFs induced by TNFα were inhibited by Nec-1s and by either heterozygous or homozygous Ripk1D138N mutation (Figures 2D and S3G).

Figure 2. TBK1 deficiency promotes RIPK1-dependent apoptosis.

Figure 2.

(A-D) MEFs were treated with 10 ng/ml mTNFα, +/or - Nec-1s (10 μM). Cell death (A, C) and caspase-8 activity (B) were measured by SytoxGreen positivity and Caspase-Glo 8 assay, respectively. The levels of p-RIPK1(S166) and CC3 were determined by immunoblotting (D). Data are represented as mean ± SD. (E-H) MEFs of indicated genotypes were treated with 1 μM CHX for 0.5 h followed by mTNFα, +/or - Nec-1s. Cell death was measured by SytoxGreen positivity (E) or CellTiter-Glo assay (H). Caspase-8 activity was measured by Caspase-Glo 8 assay (F). The levels of p-RIPK1(S166) and CC3 were determined by immunoblotting (G). Data are represented as mean ± SD. (I-L) MEFs were treated with 100 nM (5Z)-7-Oxozeaeno for 0.5 h followed by mTNFα, +/or - Nec-1s. Cell death was measured by SytoxGreen positivity (I) or CellTiter-Glo assay (K). Caspase-8 activity was measured by Caspase-Glo 8 assay (J). The levels of p-RIPK1(S166) and CC3 were determined by immunoblotting (L). Data are represented as mean ± SD. ***p < 0.001, n.s. not significant. See also Figure S3.

The treatment of TNFα/Cycloheximide (CHX) is an established protocol to induce RIPK1-independent apoptosis (RIA) (Degterev et al., 2005; Zimmermann and Green, 2001). As expected, Nec-1s cannot protect against apoptosis of WT MEFs induced by TNFα/CHX; in contrast, Tbk1−/− MEFs showed greater levels of apoptosis in response to TNFα/CHX, which was blunted by Nec-1s (Figures 2E, 2F and S3H). Furthermore, co-treatment with TNFα/CHX and Nec-1s reduced the levels of caspase-8 activity in Tbk1−/− MEFs, but not in Tbk1+/+ MEFs (Figure 2F). TNFα/CHX-treated Tbk1−/− MEFs, but not Tbk1+/+ MEFs, induced p-RIPK1(S166) and increased CC3 (Figure 2G). Furthermore, the increased CC3 in TNFα/CHX-treated Tbk1−/−MEFs, but not that of Tbk1+/+ MEFs, was inhibited by the addition of Nec-1s (Figure 2G).

We further verified this conclusion by using Ripk1D138N/D138N MEFs and Tbk1−/−;Ripk1D138N/D138N MEFs. Ripk1D138N/D138N MEFs showed the same sensitivity to TNFα/CHX-induced apoptosis as WT MEFs (Polykratis et al., 2014). Interestingly, Tbk1−/−;Ripk1D138N/D138N MEFs showed resistance to TNFα/CHX-induced apoptosis (Figure 2H). Consistently, Tbk1−/−MEFs, but not WT MEFs, treated with TNFα/CHX exhibited RIPK1 activation as indicated by p-RIPK(S166) and CC3, both of which were inhibited in Tbk1−/−;Ripk1D138N/+ MEFs and Tbk1−/−;Ripk1D138N/D138N MEFs (Figure S3I). Thus, TBK1 deficiency not only sensitizes cells to apoptosis induced by TNFα alone, but also converts RIA induced by TNFα/CHX into RDA.

Activation of TAK1 kinase activity was previously shown to be a key negative regulator of RDA (Dondelinger et al., 2013; Geng et al., 2017; Mihaly et al., 2014). To address whether there was any crosstalk between TBK1 and TAK1, we induced RDA in WT and Tbk1−/− MEFs using TNFα and a TAK1 inhibitor: (5Z)-7-Oxozeaenol (5z7). We found that Tbk1−/− MEFs were much more sensitive to RDA with increased p-RIPK1 (S166) and caspase-3/caspase-8 activation than that of WT. Pharmacological and genetic inhibition of RIPK1 protected WT and Tbk1−/− MEFs from RDA and blocked caspase activation (Figures 2I–2L and S3J-M). Thus, TBK1-deficient cells are hypersensitive to RDA mediated by TNFα and TAK1 inhibition.

RIPK3 has been shown to contribute to RDA, in addition to its well-established role in necroptosis (Dondelinger et al., 2013). We generated Tbk1 and Ripk3 double knockout MEFs (Tbk1−/−;Ripk3−/−), and compared their sensitivity to TNFα-induced RDA with WT MEFs and Tbk1−/− MEFs. As shown in Figures S3N and S3O, Ripk3 knockout only partially protected TNFα-induced apoptosis and caspase-3 activation in Tbk1−/− MEFs.

We profiled the cytokine and chemokine production in Tbk1−/− MEFs treated with TNFα by using a PCR array for mouse cytokines and chemokines. We found that the production of 8 cytokines and chemokines, including Tnf and Ifng, were increased by >1.5-fold in Tbk1−/− MEFs compared to WT MEFs treated with TNFα, which were reduced by inhibition of RIPK1 in Tbk1−/−;Ripk1D138N/D138N MEFs treated with TNFα, and partially by RIPK3 deficiency in Tbk1−/−;Ripk3−/−MEFs treated with TNFα, as RIPK3 partially protected RDA in Tbk1−/− MEFs, but not by inhibition of either JNK or ERK pathway (Figures S3P and S3Q). These results suggest that RDA is a form of inflammatory apoptosis dependent on RIPK1 kinase activity.

Recruitment of TBK1 into the TNF-RSC depends on RIPK1 and linear ubiquitination

TBK1 was shown to be recruited to the TNFR1 signaling complex (TNF-RSC) in a mass spectrometry study (Kuai et al., 2004); but the mechanism of TBK1 recruitment to TNFR1 is unclear. We found that the recruitment of TBK1 into the TNF-RSC was largely blocked in Ripk1−/− MEFs stimulated by TNFα (Figure 3A); however, recruitment was unaffected by either treatment with Nec-1s or Ripk1D138N mutation (Figures S4A and S4B). The recruitment of TBK1 to the TNF-RSC was reduced following depletion of cIAP1/2 by SM164 treatment (Figure 3B). Furthermore, Hoip−/− MEFs, in which the LUBAC complex is dysfunctional, showed impaired recruitment of TBK1 to the TNF-RSC (Figure 3C). These results suggest that the recruitment of TBK1 into the TNF-RSC depends on RIPK1 and its linear ubiquitination.

Figure 3. TBK1 is recruited into TNF-RSC to suppress RIPK1 activation.

Figure 3.

(A-C) MEFs were stimulated by Flag-mTNFα (100 ng/ml), and SM164 (50 nM) or Nec-1s. TNF-RSC (Complex I) was immunoprecipitated using anti-Flag resin. The recruitment of TBK1 and RIPK1 were analyzed by immunoblotting. TNFR1 was a control for TNF-RSC. (D-F) MEFs were stimulated by Flag-mTNFα with or without Nec-1s. TNF-RSC was immunoprecipitated using anti-Flag resin. The lysates were analyzed by immunoblotting using anti-p-RIPK1(S166) antibody. (G) WT and Tbk1−/− MEFs were pre-incubated with 20 μM zVAD-fmk, +/or - Nec-1s for 0.5 h and then stimulated with mTNFα. The complex II was isolated by FADD immunoprecipitated and RIPK1 binding was revealed by immunoblotting. See also Figure S4.

To characterize the effect of TBK1 deficiency on the activation of RIPK1 following TNFα stimulation, we examined whether TBK1 suppresses the activation of RIPK1 in the TNF-RSC. We found that TBK1 deficiency dramatically enhanced the activation of RIPK1 but had no effect on the recruitment of RIPK1 into the TNF-RSC or its ubiquitination (Figures 3D and S4C). The treatment of Nec-1s fully blocked the activation of RIPK1 without affecting the recruitment of RIPK1 into the TNF-RSC (Figure 3E). Furthermore, we found that the elevated levels of p-RIPK1(S166) in the TNF-RSC in Tbk1−/− MEFs was attenuated in the heterozygous Ripk1D138N/+MEFs and blocked in the homozygous Ripk1D138N/D138N MEFs (Figure 3F). We subsequently characterized the interaction of RIPK1 with FADD to form complex II, a key downstream event. TBK1 deficiency led to an increased formation of complex II as compared to WT MEFs (Figure S4D), and the interaction of FADD and RIPK1 induced by TNFα in Tbk1−/− MEFs was blocked by Nec-1s (Figure 3G). Thus, the TBK1 deficiency-induced exaggerated cell death phenotype is dependent upon RIPK1 kinase activity.

TBK1 inhibits RIPK1 by direct phosphorylation

We noted an upwards shift of the RIPK1 band by SDS-PAGE analysis of the lysates from HEK293T cells transfected with expression vectors of Flag-RIPK1 and Myc-TBK1. This migrational shift disappeared when co-expressing RIPK1 with kinase mutant TBK1 (K38A) (Figure S4E) and following in vitro dephosphorylation using λPPase (Figure S4F). These results suggest that TBK1 can phosphorylate RIPK1. The expression of TBK1 inhibited the activation of RIPK1, as assessed by immunoblotting analysis of p-RIPK1(S166) (Figure S4G). To determine the effect of TBK1 on RIPK1 kinase activity, we conducted an in vitro kinase assay to compare the ability of RIPK1 auto-phosphorylation in the presence or absence of TBK1. We found that co-incubation with TBK1 significantly reduced the activation of RIPK1 as shown by p-RIPK1(S166) (Figure S4H). Thus, TBK1 can directly inhibit the activation of RIPK1 by phosphorylation.

Mass spectrometry analysis was used to determine the site(s) in RIPK1 phosphorylated by TBK1. We found that T189 in human RIPK1 was a dominant phosphorylation site mediated by TBK1 (Figures S5A and S5B). T189 human RIPK1/T190 murine RIPK1 is an evolutionarily conserved residue in the activation loop with the motif (DFG…p(S/T/Y)…APE) (aa156–196) (Xie et al., 2013) (Figures 4A and S5C) which is is often found in similar kinases and may be subject to phosphorylation to induce a conformational change that can alter kinase activity (Hawley et al., 2014; McCartney et al., 2016). Because the RIPK1 kinase domain shares kinase fold structural homology with PKC, we aligned the structure of the RIPK1 kinase domain with that of PKC in complex with a substrate peptide from Par3. We identified that D138 residue in the catalytic loop and T189 residue in the activation loop of RIPK1 occupied similar positions to that of D368 in the catalytic loop and T406 in the activation loop of PKC, respectively (Figure 4A). Notably, Ripk1D138N mutation is highly effective in blocking the activation of RIPK1 (Polykratis et al., 2014). Since T406 in PKC is directly involved in the substrate recognition for the kinase due to its position in the activation loop (Figure 4A), we hypothesized that T189 residue of RIPK1 might also be directly involved in substrate binding. We tested this hypothesis using a heterodimerization system (Figure 4B). TNFα-mediated activation of RIPK1 involves dimerization which is mediated by its C-terminal death domain (Meng et al., 2018). We tested the ability of heterodimerized WT, D138N and T190E/A RIPK1 to promote RIPK1 activation. Interestingly, we found that the heterodimerization of WT and D138N RIPK1 resulted in the S166 phosphorylation of D138N RIPK1, but not WT RIPK1 itself (Figure 4C), suggesting that activation of RIPK1 requires trans-phosphorylation. This result also explains why heterozygous Ripk1D138N/+ cells and mice are also defective in the activation of RIPK1 and protected from TBK1 deficiency. On the other hand, the heterodimerization of WT RIPK1 with either T190E or T190A mutant resulted in no S166 RIPK1 phosphorylation (Figure 4D), supporting the hypothesis that T190 is a critical residue involved in the substrate recognition for RIPK1 as WT RIPK1 cannot phosphorylate T190E or T190A RIPK1.

Figure 4. TBK1 inhibits RIPK1 by direct phosphorylation.

Figure 4.

(A) The structural comparison of the RIPK1 kinase domain (PDB ID: 4ITI) and the PKC/Par3 complex (PDB ID: 4ITI). The kinase domain of PKC and the bound Par3 peptide in the PKC/Par3 complex are shown in grey and in orange respectively, while the RIPK1 kinase domain is drawn in blue; the side chain of S1060 phosphorylation site of Par3 is highlighted and displayed in the stick-ball model, and the side chains of the related key residues are shown in the stick mode; while the relevant hydrogen bonds are indicated by black dash lines. (B) A schematic diagram of inducible heterodimerization of mouse RIPK1 DD-DmrC-HA-GFP fusion with RIPK1 DD-DmrA-Myc fusion. (C and D) HEK293T cells were co-transfected with expression vectors for mRIPK1 DD(WT)-DmrC-HA-GFP, mRIPK1 DD(WT)-DmrA-Myc or mRIPK1 DD(D138N)-DmrA-Myc (C), mRIPK1 DD(WT)-DmrC-HA-GFP, mRIPK1 DD(WT)-DmrA-Myc, mRIPK1 DD(T190E)-DmrA-Myc or mRIPK1 DD(T190A)-DmrA-Myc (D) as indicated for 12h, and then treated with 100nM A/C Heterodimerizer ligand (AP21967) for different periods of time as indicated. The levels of p-RIPK1 (S166) were analyzed by immunoblotting. (E) Jurkat cells were pre-treated with or without MRT67307 for 0.5 h and then stimulated with 10 ng/ml hTNFα. RIPK1 was then immunoprecipitated with p-RIPK1(T189) ab and determined by immunoblotting. (F) HEK293T cells were transfected with WT, T190E, T190A or K45M mutant Flag-hRIPK1 and treated with Nec-1s for 20 h. Flag-RIPK1 was then immunoprecipitated using anti-Flag and incubated with or without 100 μM ATP or 50 μM Nec-1s as indicated at 30°C for 30min. The samples were analyzed by immunoblotting with p-RIPK1(S166). (G) Tbk1−/−;Ripk1CrisprKO MEFs were retrovirally reconstituted with HA tagged WT, T190E or T190A mutant RIPK1. Reconstituted cells were stimulated with TNFα. Cell death was measured by ToxiLight (n=4. Mean ± SD. **p < 0.01, ***p < 0.001). See also Figure S5.

We developed an anti-p-RIPK1(T189) antibody (Figure S5D). Phosphorylation of T189 human RIPK1 was detected upon incubation with TBK1 both in vitro and in HEK293T cells. This phosphorylation was inhibited by TBK1/IKKε inhibitor MRT67307 (Figures S5E-S5G). Furthermore, T189 phosphorylation of endogenous RIPK1 was detected in Jurkat cells stimulated by TNFα, which was similarly inhibited by MRT67307 (Figure 4E).

Our data clearly indicate that TBK1 can directly phosphorylate RIPK1 at T189. We next characterized the functional role of this phosphorylation on the kinase activity of RIPK1 in vitro. We found that both T189E and T189A RIPK1 mutants were catalytically inactive (Figure 4F). We further characterized the role of T190/T189 on cell death. While re-introduction of WT RIPK1 could rescue the sensitivity of Tbk1−/−;Ripk1CrisprKO MEFs to TNFα-induced RDA, neither T190A nor T190E RIPK1 could restore this sensitivity (Figures 4G and S5H). Taken together, these results suggest that phosphorylation of T190/T189 RIPK1 by TBK1 inhibits RIPK1 by blocking trans-activation of RIPK1.

Over-activation of TAK1 in TBK1 deficient cells

Similar to TBK1, TAK1 can also directly mediate inhibitory phosphorylation on RIPK1. S321 is one of the multiple sites on RIPK1 that can be phosphorylated by TAK1 (Geng et al., 2017). We found that the levels of p-RIPK1(S321) in Tbk1−/− MEFs upon TNFα stimulation were increased compared to that of WT MEFs (Figure 5A). Furthermore, p-IKKα/β(S178/S180), another known substrate of TAK1 (Chen, 2012; Mihaly et al., 2014), was also increased in Tbk1−/− MEFs stimulated by TNFα (Figures 5A and S3D). Since both TAK1 and TBK1 are endogenous inhibitors of RIPK1, these data suggest that TAK1 may be over-activated in TNFα-stimulated TBK1 deficient cells to compensate for the loss of TBK1. The over-activation of TAK1 in TBK1 deficient cells was further confirmed by an in vitro kinase assay (Figure 5B). Consistently, the TAK1 sites on RIPK1 and IKKα/β as well as the downstream targets of TAK1, such as p-JNK, p-p38 and p-ERK (Mihaly et al., 2014), were all hyperphosphorylated in the Tbk1−/− MEFs in response to TNFα (Figures S6A and S6B).

Figure 5. Over-activation of TAK1 in TBK1 deficient cells and reduction of TAK1 in human aging brains.

Figure 5.

(A) WT and Tbk1−/− MEFs were stimulated with mTNFα and analyzed by immunoblotting. (B) Tbk1+/+ and Tbk1−/− MEFs were treated with TNFα for 15 min and then were immunoprecipitated with TAK1 ab. The precipitated TAK1 (IP: anti-TAK1) kinase activity was measured by incubating the kinase with 4 μg GST fused mouse TAK1 peptide (aa180–195) in vitro in the presence of ATP or 5z7 at 30 °C for 30 min. The samples were analyzed by immunoblotting with p-TAK1(T184/T187). (C) Immunoblotting analysis of human frontal cortex (12 young and 12 older individuals) (top) and the quantification of TAK1 levels (bottom) (mean ± SEM). (D) MEFs of indicated genotypes were stimulated by Flag-mTNFα. TNF-RSC was immunoprecipitated using anti-FLAG resin. The activation of RIPK1 was analyzed by immunoblotting using anti-p-RIPK1(S166) ab. (E-G) MEFs were treated with mTNFα, +/or - Nec-1s. Cell death was measured by CellTiter-Glo assay (E, F) (mean ± SD). The levels of CC3 were determined by immunoblotting (G). *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S6.

We questioned how aging might play a role in the onset of ALS and FTD in individuals carrying a TBK1 heterozygous mutation. Since hyperactivation of TAK1 in a TBK1 deficient background might compensate for the loss of TBK1, we wondered if aging might have an effect on the expression of TAK1 in human brains. We analyzed a microarray expression dataset that examined transcriptional changes during normal aging of the human brain. The mRNA levels of Tak1 were decreased 1.33-fold in brains from aged individuals (>60 years old) compared to young adults (<40 years old) (Figure S6C); while the expression of TBK1 did not change during aging (Loerch et al., 2008). A striking reduction in the protein levels of TAK1 in aged brains was demonstrated by immunoblot analysis of human prefrontal cortex samples from individuals of different ages who passed away due to non-neurological causes (Figure 5C). The mean age of onset for ALS/FTD is ~60 years old (White and Sreedharan, 2016); in particular, the current genetic data suggest a high disease penetrance of TBK1 loss-of-function variants in mutation carriers older than 60 years (Freischmidt et al., 2017). Interestingly, we found a further reduction of TAK1 expression in ALS brains compared to age-matched controls (Figure S6D). These data suggest that an age-dependent reduction of TAK1 expression might be a key contributing factor in the onset of ALS/FTD.

To test if double heterozygosity of TBK1 and TAK1 might be sufficient to drive RIPK1 activation, we generated Tbk1+/−;Tak1+/− MEFs by infecting immortalized Tbk1+/−;Tak1fl/+ MEFs with retrovirus expressing Cre recombinase (Figure S6E). We observed increased levels of p-RIPK(S166) in TNF-RSC of Tbk1+/−;Tak1+/− MEFs as compared to WT MEFs, which was inhibited by reduction of RIPK1 activity in Tbk1+/−;Tak1+/−;Ripk1D138N/+ MEFs (Figure 5D). Furthermore, we found that Tbk1+/−;Tak1+/− MEFs stimulated by TNFα alone would die by apoptosis, which was prevented by Nec-1s or Ripk1D138N mutation (Figures 5E and5F). We observed increased levels of activated caspase activity in Tbk1+/−;Tak1+/− MEFs treated with TNFα which was similarly inhibited by genetic or pharmacological inhibition of RIPK1 via D138N mutation or Nec-1s, respectively (Figures 5G and S6F). Taken together, our results demonstrate that double heterozygosity of TBK1 and TAK1 promotes RIPK1 activation and RDA, and suggest that TAK1 reduction during that normal aging in the CNS may contribute to the susceptibility of the brain to neurodegeneration.

Double heterozygosity of TBK1 and TAK1 promotes microglia activation

We found that in both mouse and the human brains from younger individuals, TAK1 was highly expressed by microglia (Figures S6G and S6H). Furthermore, the levels of TAK1 were reduced in microglia in brains from older individuals (Figure S6H). Since TBK1 is also highly expressed in microglia (Zhang et al., 2014), we hypothesized that heterozygosity of myeloid TAK1 expression in Tbk1+/− mice could be sufficient to promote the activation of RIPK1 to mediate neurodegeneration. To model the age-dependent reduction of TAK1 expression in individuals with haploid loss of TBK1 function, we crossed Tbk1−/−;Ripk1D138N/+ mice with Tak1fl/fl;Lyz2Cre/Cre mice to generate Tbk1+/−;Tak1 ΔM/+ mice which were heterozygous for Tbk1 with a single allelic loss of Tak1 in cells of myeloid lineage, which includes microglia, macrophages and monocytes, to reduce the expression of Tak1 (Figure S6I). We characterized the number and morphology of microglia in the spinal cords and cortex using IBA1 immunostaining. While no microgliosis was observed in 6 months old WT, Tbk1+/− mice or Tak1 ΔM/+ mice (Figure S6J), we observed significant evidence of microgliosis with activated amoeboid-like microglia, in anterior horn of spinal cord as well as cortex of Tbk1+/−;Tak1 ΔM/+ mice at the same age. The increased number of IBA1+ microglia was reduced by the inhibition of RIPK1 in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figure 6A). We also analyzed the global profile of microglia isolated from brains and spinal cords of adult mice by FCAS using cell surface levels of major histocompatibility complex class (MHC II), a classical M1 biomarker for pro-inflammatory microglia (Barron, 1995). We found that the cell surface levels of MHC-II in microglia isolated from both spinal cords and brains of adult Tbk1+/−;Tak1 ΔM/+ mice were significantly increased compared to that of WT, which were suppressed upon inhibition of RIPK1 by Ripk1D138N mutation in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figure 6B).

Figure 6. Double heterozygosity of TBK1 and TAK1 promotes microglia activation.

Figure 6.

(A) Immunostaining of microglia marker IBA1 in the ventral spinal cords and cortex from 6 months old mice and quantification (50 slices/genotype) (mean ± SD). (B) MHC-II cytometry analysis of microglia (CD11b+LY6CCD45IntermediateCX3CR1+) in cerebrum and spinal cord of WT, Tbk1+/−;Tak1 ΔM/+ and Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (male, 6 months old; n = 2 per group). (C) GO analysis of genes that are either up-regulated in Tbk1+/−;Tak1 ΔM/+ microglia (D) or down- regulated in Tbk1+/−;Tak1 ΔM/+ microglia in RIPK1-dependent fashion (E). (F) The cytokine profiles in the spinal cords from 6 months old mice were measured by quantitative PCR (n=3, mean ± SEM). *p < 0.05, **p < 0.01, ***p < 0.001. See also Figure S6.

We analyzed the expression profile of microglia isolated from the brains of newborn mice by RNA-seq. Compared to WT microglia, Tbk1+/−;Tak1 ΔM/+microglia, but not Tbk1+/− orTak1 ΔM/+ microglia, showed markedly elevated expression of 40 genes involved in innate immunity including cytokines (such as Tnf) and chemokines (such as Cxcl10, Ccl5, Ccl7 and Ccl8), NOD- and RIG-I-like receptor signaling systems; and down-regulated mitotic signaling apparatus and lysosomal pathway (Figures 6C–6E). Interestingly, these gene expression abnormalities were restored to WT levels by genetic inhibition of RIPK1 in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ microglia. Using quantitative PCR, we confirmed the increased production of Tnf in Tbk1+/−;Tak1 ΔM/+ primary microglia as compared to WT, Tbk1+/− and Tak1 ΔM/+ primary microglia, which was suppressed by Ripk1D138N mutation (Figure S6K). Similarly, we detected an increased production of proinflammatory cytokines, such as Il1a and Tnf, in the spinal cords of Tbk1+/−;Tak1 ΔM/+ mice, which were reduced in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figure 6F). While no cell death was detected in Tbk1+/−;Tak1 ΔM/+ primary microglia (Figure S6L), there were increases in inflammatory responses at both steady states and upon TNFα treatment in Tbk1+/−;Tak1 ΔM/+ primary microglia, both of which were inhibited by Ripk1D138N/+ mutation (Figure S6M). Furthermore, RIPK1, but not JNK or ERK, was also significantly activated in Tbk1+/−;Tak1 ΔM/+ primary microglia treated with TNFα (Figures S6N and S6O). Taken together, these results suggest that double heterozygosity of TAK1 and TBK1 in myeloid lineage is sufficient to promote neuroinflammation by microglia.

TBK1/TAK1 double heterozygosity promotes axonal defects in spinal cords

Since these data suggest that TBK1 haploinsufficiency in the context of an aging-dependent reduction of TAK1 leads to a RIPK1-dependent neuroinflammatory response, we next examined whether this response could lead to a non-cell autonomous deleterious phenotype in the CNS. We therefore characterized the impact of TBK1/TAK1 double heterozygosity in the spinal cords of Tbk1+/−;Tak1 ΔM/+ mice. We observed a significant reduction in the number of motor axons and abnormal myelination in the white matter of the ventrolateral spinal cords of Tbk1+/−;Tak1 ΔM/+mice (6 months old), similar to the axonal pathology observed in the Optn−/− mice spinal cords (Ito et al., 2016) (Figures 7A, 7B and S7A). In contrast, Tbk1+/− mice and Tak1 ΔM/+ mice displayed normal myelination in the ventrolateral spinal cords (Figure S7B). The axonal pathology of Tbk1+/−;Tak1 ΔM/+ mice presented as a decompaction of myelin sheaths with a decreased g-ratio, an increased number of axons with large-diameters, and a decreased axonal number in the ventrolateral white matter (Figures 7A-7D and S7C). In addition, we observed denervation of neuromuscular junctions in the tibialis anterior muscle of Tbk1+/−;Tak1 ΔM/+ mice (Figures S7D and S7E). These results suggest that heterozygosity of TAK1 specifically in the myeloid lineage in Tbk1+/− mice is sufficient to promote axonal pathology and denervation of motor endplates in muscle. The motor axonal pathology was also observed in 2 months old Tbk1+/−;Tak1 ΔM/+mice (Figures S7F and S7G). The axonal pathology and denervation of neuromuscular endplates were all rescued upon inhibition of RIPK1 in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figures 7A-7D and S7A-S7E).

Figure 7. TBK1/TAK1 double heterozygosity promotes axonal defects in spinal cords and FTD phenotype in the CNS.

Figure 7.

(A) EM analysis of motor axonal myelination in the ventrolateral lumbar spinal cords from 6 months old mice. (B-D) The mean axonal numbers, mean g-ratios, and mean axonal diameters (B); individual axonal diameter distribution (C); and g-ratio distribution (D) in the ventrolateral lumbar spinal cord white matter of mice (mean ± SEM). (E) The number of TUNEL+ cells in the lumbar spinal cords of indicated genotype (15 sections from 3 mice for each genotype) (mean ± SEM). (F and G) Mice (6 months old. WT, n=10; Tbk1+/−, n=11; Tak1 ΔM/+, n=9; Tbk1+/−;Tak1 ΔM/+, n=10; Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+, n=9) were tested in open-field. The total distance traveled showed no difference (F). Tbk1+/−;Tak1 ΔM/+ mice, but not Tbk1+/− or Tak1 ΔM/+ mice, showed a significant deficit on the vertical rearing activity, which was blocked in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (G) (mean ± SD). (H) Representative images of NeuN-labeled cells in the cortex of WT mice (n=3), Tbk1+/−;Tak1 ΔM/+ mice (n=3) and Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (n=3) and quantification (right) (mean ± SEM). (I) The average percentage of cells with TDP-43 inclusions in mice of indicated genotypes was imaged and quantified (500 cells per mouse, n=3 mice). (J and K) Anxiety-related behavior was determined by bright open field test by quantifing the distance travelled in the center area normalized to total distance travelled (J), and elevated plus maze showing the percent of time spent on the open arm (K). (WT, n=10; Tbk1+/−, n=11; Tak1 ΔM/+, n=9; Tbk1+/−;Tak1 ΔM/+, n=10; Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+, n=10) (mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, n.s. not significant). See also Figure S7.

We characterized cell death in the spinal cord white matter of Tbk1+/−;Tak1 ΔM/+ mice. Consistent with the axonal pathology of Tbk1+/−;Tak1 ΔM/+ mice, we observed a significant increase in the number of cells positive for TUNEL staining in the ventrolateral white matter of spinal cords in Tbk1+/−;Tak1 ΔM/+ mice (6 months old), but not in Tbk1+/− mice or Tak1 ΔM/+ mice. This degenerative phenotype was rescued in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figure 7E).

Behaviorally, Tbk1+/−;Tak1 ΔM/+ mice showed no difference in total locomotor activity compared to WT mice or either heterozygous line alone (Figure 7F). Interestingly, the vertical rearing motor activity was significantly reduced in the Tbk1+/−;Tak1 ΔM/+ mice compared with WT, Tbk1+/− or Tak1 ΔM/+ mice, suggesting hindlimb weakness in Tbk1+/−;Tak1 ΔM/+ mice. This behavioral motor deficit in these double heterozygous animals was dependent on the kinase activity of RIPK1 as it was rescued in the Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figure 7G). On the other hand, the body weight of these mice showed no difference (Figure S7H). Thus, 50% reduction of TAK1 expression in myeloid lineage in Tbk1+/− background promotes cell death, motor axonal pathology, denervation of muscle endplates and hindlimb weakness, all in a RIPK1-dependent manner.

Double heterozygosity of TBK1 and TAK1 promotes FTD phenotype in the CNS

We next examined whether Tbk1+/−;Tak1 ΔM/+ and the consequent RIPK1 hyperactivation could contribute directly ALS/FTD pathology. We first evaluated whether double heterozygosity of TBK1 and TAK1 caused neurodegeneration mediated by RIPK1-driven inflammation and cell death. In 6 months old Tbk1+/−;Tak1 ΔM/+ mice, the number of NeuN-positive neurons in the cortex was reduced by 15%, which was rescued by genetic inhibition of the kinase activity of RIPK1 in the Ripk1D138N line (Figure 7H).

The presence of cytosolic TDP-43 inclusion in the CNS is a key neuropathological feature of FTD/ALS (Neumann et al., 2006). We found cytoplasmic inclusions of TDP-43 in ~6% cells in the cortex of 6 months old Tbk1+/−;Tak1 ΔM/+ mice (Figure 7I). However, no neuronal loss or TDP-43 inclusions were found in 2 months old Tbk1+/−;Tak1 ΔM/+ mice (Figures S7I-S7K). Increased levels of high-molecular-weight RIPK1 were found in both brain and spinal cord of Tbk1+/−;Tak1 ΔM/+ mice, which was inhibited by Ripk1D138N/+ mutation (Figure S7L). RIPK1 activation was further confirmed by p-RIPK1(S166)+ immunostaining in the brain of Tbk1+/−;Tak1 ΔM/+ mice, which was inhibited in Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice (Figure S7M).

To determine whether the combination of pathological features described above impacted behavior, we performed the bright open field test which assesses anxiety-like behavior in a novel environment. Tbk1+/−;Tak1 ΔM/+ mice exhibited a decreased tendency to explore the center of the open field (Figures 7J and S7N), suggestive of anxiety-like behavior. This behavior abnormality in the Tbk1+/−;Tak1 ΔM/+ mice was further confirmed by the elevated plus maze test (Figures 7K and S7O). These data suggest that de-repression of RIPK1 kinase activity leads to a neuroinflammatory environment in the CNS and onset of ALS/FTD-like pathology including axonal pathology, TDP43 inclusions, neurodegeneration and corresponding behavioral phenotypes.

Discussion

In this study, we demonstrate that TBK1 deficiency promotes RDA and inflammation to induce embryonic lethality and neurodegeneration in aging upon reduction of TAK1 expression. Since embryonic lethality in Tbk1−/− mice can also be prevented upon deletion of Tnfr1 (Bonnard et al., 2000) or Tnf (Matsui et al., 2006), our results suggest that RIPK1 is a key mediator of deleterious events downstream of TNFR1 by promoting not only necroptosis, but also RDA and inflammation. Hence, our results suggest that inhibition of RIPK1 activation is important for both normal embryonic development and the prevention of age-related neurodegenerative diseases. Furthermore, we propose that the aging-dependent reduction of TAK1 expression and reduced RIPK1 suppression in the human brains might be important not only as a mechanism to interact with the heterozygosity of TBK1 in individuals with inherited TBK1 mutations to promote the onset of ALS/FTD, but also to sensitize a variety of age-dependent chronic neurodegenerative diseases such as Alzheimer’s disease and Parkinson’s disease.

Tbk1−/− MEFs stimulated by TNFα display dramatic activation of RIPK1 in complex I, which may represent a critical step in the activation of RDA. Most activated RIPK1 in necroptosis stimulated by TNFα/CHX/zVAD is located in complex II (Dziedzic et al., 2018). We have previously shown that deficiency in OPTN, a ubiquitin binding protein that binds to RIPK1, leads to stabilization of RIPK1 due to reduced K48 ubiquitination and increased RIPK1 activation in complex II (Ito et al., 2016). Thus, disruption in the mechanisms that suppress the activation of RIPK1 may occur at different levels downstream of TNFR1 signaling to promote neurodegeneration.

TBK1 plays pivotal roles in antiviral innate immunity by mediating the activation of interferon regulatory factor (IRF) 3, leading to the induction of type I interferons (IFN-α/β). Multiple viruses have evolved elaborate strategies to evade anti-viral responses by targeting TBK1. Thus, viral inhibition of TBK1 might provide a sensitized background, as that of TBK1 heterozygosity, in aging brains to promote neuroinflammation and neurodegeneration. Taken together, our findings suggest that age-dependent reduction of RIPK1 inhibition in the brain might predispose to neuroinflammation and neurodegeneration in the setting of genetic or environmental stresses.

STAR★METHODS

KEY RESOURCES TABLE

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Junying Yuan (jyuan@hms.harvard.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animals

Tbk1+/− mice and Tak1fl/fl mice (Ishii et al., 2008; Sato et al., 2005), Ripk1D138N mice (Polykratis et al., 2014) and Ripk3−/− mice (Newton et al., 2004) were used in this study. Tbk1+/− mice were crossed with Ripk1D138N/D138N or Ripk3−/− mice to generate Tbk1+/−;Ripk1D138N/+ or Tbk1+/−;Ripk3+/−mice. Tbk1+/−;Ripk1D138N/+ or Tbk1+/−;Ripk3+/− mice were crossed with Ripk1D138N/D138N or Ripk3−/−mice, respectively, to generate Tbk1+/−;Ripk1D138N/D138N or Tbk1+/−;Ripk3−/− mice.Tbk1−/−;Ripk1D138N/+ mice were crossed with Tak1fl/fl;Lyz2Cre/Cre mice to generate Tbk1+/−;Tak1 ΔM/+ mice and Tbk1+/−;Tak1 ΔM/+;Ripk1D138N/+ mice. Lyz2Cre/Cre mice were from The Jackson Laboratory (Catalog No. 004781).

Mouse husbandry

Mice were group-housed in a 12 hr light/dark cycle (light between 07:00 and 19:00) in a temperature-controlled room (21.1 ± 1.1°C) at Harvard Medical School with free access to water and food and maintained according to protocols approved by the Harvard Medical School Animal Care Committee on Animal Care. The ages of mice are indicated in the figure legends or methods. Sex was not determined for embryos or neonatal pups. For analyses of older animals (>P21), only male mice were used unless indicated otherwise.

All experiments with mice were performed with the approval of the Harvard Medical School Animal Care Committee.

Mouse genotyping

Genomic DNA was extracted from mouse tails, PCR was performed with Ex Taq® DNA Polymerase (TaKaRa) or Phusion® High-Fidelity DNA P olymerase (NEB). Amplicons were analyzed by agarose gel electrophoresis. PCR primers, PCR conditions, and expected amplicon sizes are indicated in Table S1.

Human tissues

The research involving human pathological samples was approved by the Institutional Review Board (IRB) of Harvard University. The postmortem brain tissues were neuropathologically normal and derived from non-demented individuals. Human cortical grey matter samples were dissected from the frontal pole (Brodmann area 9, 10) and snap-frozen in liquid nitrogen and stored at −85°C. Human brain samples with a tissue pH > 6.5 were used to exclude prolonged terminal hypoxia. The brain tissues were allocated to two experimental groups as young ≤ 40 yr and aged ≥ 70 yr regardless of sex. For western blotting, tissues were homogenized in RIPA buffer containing protease inhibitors (Complete, Roche) with Na3VO4 (1 mM). Tissues were homogenized, sonicated, and centrifuged at 10,000 rpm at 4°C and the protein concentrations were adjusted to 1 mg/ml based on protein assay (Thermo protein assay). Samples were boiled in 1× SDS sample buffer containing DTT and resolved by 8% SDS-PAGE.

Cell lines and cell culture

All cells were cultured at 37°C with 5% CO2. Human cell lines were cultured as follows: HEK293T (ATCC) in DMEM (GIBCO) with 10% FBS (GIBCO); Jurkat (ATCC) in RPMI-1640 (Life Technologies) with 10% FBS. HEK29T is of female origin and Jurkat is of male origin, both cell lines are authenticated. All murine cell lines and primary cells were cultured in DMEM with 10% FBS.

Generation and immortalization of MEFs

MEFs were isolated from E11–13 embryos using trypsin/EDTA and sieved through 70-micron filter. Primary MEFs were cultured in high glucose DMEM supplemented with 15% FBS, non-essential amino acids, sodium pyruvate, penicillin, streptomycin and amphotericin B. At passages 4–6, primary MEFs were immortalized by transfection with SV40 large T antigen-expressing plasmid (Addgene 22298) using Lipofectamine 2000. Sex was not determined for embryos.

Primary microglia culture

Forebrains of 2-d-old mouse pups were digested with 0.01% trypsin and triturated with DMEM containing 10% heat-inactivated fetal bovine serum and 1% penicillin-streptomycin. Dissociat cells were plated onto poly-d-lysine coated 75 cm2 flasks and changed the medium after 7 days, then the cells were cultured for another 7 days. Following an initial 5 min shake of the culture, microglia were collected and cultured in DMEM+10%FBS. The quality of purification was analyzed by FACS using CD11b as a marker for microglia (>90% CD11b+). Sex was not determined for neonatal pups.

METHOD DETAILS

Plasmids construction

Full-length cDNAs for mouse/human RIPK1 and TBK1 were PCR-amplified from the plasmid library and cloned into pcDNA3.1 using Phanta® Max Super-Fidelity DNA Polymerase (Vazyme Biotech Co., Ltd) with appropriate tags. Retroviral virus production used Myc/HA tagged pMSCV-blasticidin vector. pMSCV was used as the plasmid backbone for all of the constructs used for reconstitution study. Mutant hRIPK1(T189A, T189E, K45M), mRIPK1(D138N, T190A, T190E) and mTBK1(K38A) were generated using MutExpress™ II mutagenesis kit (Vazyme Biotech Co., Ltd). cDNA encoding truncated mRIPK1 (aa1–567, WT or mutant), DmrA/C, myc/HA, GFP were ligated through Golden Gate assembly method and cloned into the XhoI/EcoRI sites in the pMSCV-blasticidin/puromycin vector. For protein purification, cDNA encoding hRIPK1(1–294) with 3C PreScission site at N-terminus was cloned into NdeI/EcoRI sites in pET-28a plasmid for E.coli expression, and cDNA encoding HA tagged hRIPK1(1–330, WT or mutant) was cloned into EcoRV/NotI sites in pEBG plasmid for mammalian expression. All plasmids were verified by DNA sequencing and the details of the plasmids sequences are available upon request.

FACS of microglia from adult mice

Mice were sacrificed, and the brains and spinal cords were isolated. After removal of cerebellum, the brain was chopped with a razor blade followed by homogenization with a 19-gauge needle and incubation in Accutase (Sigma) for 10 min at 37 °C. The brain lysates were homogenized twice with a 21-gauge needle. The suspension was filtered through 40 μm cell strainer and centrifuged at 300×g. The pellet was resuspended in PBS, and 25% BSA (IgG & Protease Free from Jackson ImmunoResearch) in PBS was added 1:1 on top. This suspension was centrifuged for 10 min (RT) at 1200×g. Myelin debris in the to p layer supernatant was removed. The pellet was resuspended in ACK Lysing Buffer (Thermo Fisher) and incubated for 5 min (RT). The cells were centrifuged for 5 min at 4 °C at 300×g. The resulting pellet was blocked with R at Anti-Mouse Fc (BD Biosciences) and stained with a Live/Dead marker, CD11b, CD45, CX3CR1, and Ly6C antibodies, for subsequent FACS analysis using a FACSAria III (BD Biosciences) and FACSDiva Software (BD Biosciences). Live microglia were identified as CD11bHighCD45Intermediate Ly6CLowCX3CR1High.

RNA-seq

RNA was isolated from primary microglia in culture using Quick™-RNA MiniPrep Plus kit (Zymo Research) with 3 replicates for each genotype. Each library was prepared using the Smart-seq2 protocol (Picelli et al., 2013) with a tagged oligo (dT) primer to make first strand cDNA from 1 ng total RNA input. Double-stranded cDNA was generated for library construction with 12 cycles of PCR and 0.3 ng of cDNA was used as input to the NexteraXT kit (Illumina). Libraries were sequenced with a NextSeq (Illumina) to generate 50 base paired end reads. Reads were aligned to the mm10 UCSC mouse transcriptome and expression values were determined using RSEM (Li and Dewey, 2011).

Reconstitution of Tbk1−/− MEFs and Tbk1−/−;Ripk1CrisprKO MEFs

For viral packaging, HEK293T cells were transfected with different vectors using PEI (Polysciences, Cat#23966–2). The medium was changed after 6h, and collected at 48h post-transfection. The virus-containing supernatant was then used to infect MEFs. Twelve hours after infection, viral infected MEFs were selected with blasticidin (10μg/ml). For Tbk1−/−;Ripk1CrisprKO MEFs, RIPK1 was knocked out in Tbk1+/+ and Tbk1−/− MEFs using CRISPR/Cas9 method. The target site for mRIPK1 was designed as ‘TGTGAAAGTCACGATCAACG’ (for sgRIPK1) and GFP target site ‘GAGCTGGACGGCGACGTAAA’ (for sgGFP) as a negative control, oligos were synthesized and ligated into LentiCRISPR V2-puro vector (Addgene plasmid # 52961) through standard protocol to generate sgRIPK1 and sgGFP. HEK293T cells were transfected with sgRIPK1 or sgGFP and pMD2.G (Addgene plasmid # 12259), psPAX (Addgene plasmid #12260) in a ratio of 4:1:3. The virus-containing supernatant was harvested as described above and used to infect Tbk1+/+ or Tbk1−/− MEFs. Twelve hours after infection, virus infected MEFs were selected using puromycin (2μg/ml) and validated. In order to reconstitute RIPK1 into this gRNA containing MEFs, a synonymous mutation was designed at the gRNA target site through amplifying N-terminal fragment (F: 5’-AACCGTCTCGGATCCATGCAACCAGACATGgaaTTGGACAATA TTAAGATGGC-3’, R:5’-AACCGTCTCCTTAATaTGgAAaTCtCGgTCtACcAatATATTCTCA GGCTTCAGGTCCTTGT-3’ ) and C-terminal fragment (F:5’ -AACCGTCTCATTAAGATAGC CGATCTTGGTGTGGC-3’, R:5’-AACCGTCTCGAATTCTTAGCTCTGGC TGGCAC-3’), and ligated into BamHI/EcoRI sites using Golden Gate assembly method in modified pMSCV-blasticidin vector with a HA-tag at N-terminus. Virus-containing supernatant was harvested and used to infect Tbk1−/− MEFs as described above and positive MEFs were selected using blasticidin (10μg/ml) and verified.

Generation of RIPK1 heterodimerization system

The DmrA/C heterodimer system is from ARIAD’s ARGENT cell signaling regulation kit (Bayle et al., 2006). The addition of rapamycin derivative AP21967 allows the heterodimerization of FKBP(DmrA)-fused-tagged protein with FRBT2098L(DmrC)-fused-tagged protein, but does not allow homodimerization of FKBP(DmrA)-fused-tagged protein by itself, or that of FRBT2098L(DmrC)-fused-tagged protein by itself. AP21967 was used to induce heterodimerization of murine RIPK1 ΔDD-DmrA-Myc and murine RIPK1 ΔDD-DmrC-HA-GFP. The details and molecular weight of the two constructs are shown in Figure 4B. HA and Myc tags were used for antibody identification and GFP tag was fused to DmrC for separation of two RIPK1 fusion proteins on SDS-PAGE.

Analysis of cytotoxicity and viability

The rates of cell death were measured in triplicate or quadruplicate in a 96-well or 384-well plate by using SYTOX™ Green Nucleic Acid Stain (Invitroge n) or ToxiLight™ Non-destructive Cytotoxicity BioAssay Kit (Lonza). The intensity of luminescence was determined in an EnSpire Multimode Plate Reader (PerkinElmer). Cytotoxicity is expressed as percentages of cell death per well after deducting the background signal in non-induced cells and compared to that of the maximal cell death with 100% Lysis Reagent. The rates of cell viability were determined by using CellTiter-Glo® Luminescent Cell Viability Ass ay (Promega) following the manufacturer’s protocol and the results are expressed as percentages of luminescence intensity per well after deducting the background signal in blank well and compared to that of the viability in the non-treated wells.

Caspase-8 activity assay

Caspase-Glo 8 assay (Promega) was used to detect the activity of caspase-8 in cells by following manufacture’s protocol.

TUNEL

TUNEL assay was used to detect dead cells with DNA fragmentation using In Situ Cell Death Detection Kit, POD (Roche) by following manufacture’s protocol.

Histology and immunochemistry

Animals were sacrificed and perfused with PBS followed by 4% paraformaldehyde. Then, 20-μm sections were prepared on a cryostat. For immunostaining, tissue sections were mounted and blocked with 10% normal goat serum and 1% BSA, and then incubated with primary antibodies at 4°C overnight. Images were collected with a Niko n Ti-E confocal microscope equipped with A1R scan head with spectral detector and resonant scanners and acquired with Nikon elements software. Z-series optical sections were collected with a step size of 0.2 microns, using a Prior Proscan focus motor.

Protein expression and purification

Recombinant His-RIPK1(aa1–294) protein fragment was expressed in BL21(DE3) E. coli after induction with 0.1mM IPTG overnight at 16°C. Bacter ia were harvested by centrifugation and cell pellet was lysed in 50mM Tris-HCl[pH8.0] containing 5% Triton X-100 with sonication at 4°C for 15min. The lysates were centrifuged and res uspended again in 50mM Tris-HCl[pH8.0]/1M NaCl with sonication at 4°C for 15min. The lysates were then centrifuged and resuspended in 50mM Tris-HCl[pH8.0]/6M Guanidine-HCl with sonication at 4°C for 30min. The final lysates were cleared by centrifugation. His-tagged RIPK1 was purified using Ni-NTA agarose (GE Healthcare) and further purified by HPLC.

In vitro kinase assay

Flag-tagged RIPK1 was immunoprecipitated from HEK293T cells expressing Flag-RIPK1 and washed with high-salt lysis buffer [5% glycerol, 0.5% NP-40, 500mM NaCl and 50mM Tris-HCl (pH7.4)] for 5 times and then with water for 3 additional times. 10 μL beads with Flag-RIPK1 were resuspended in 24μL 1×kinase buffer [20 mM MgCl 2,100 μM ATP, 2 mM DTT, 50 μM inhibitors as indicated and 40 mM Tris-HCl(pH7.5)] after the final wash step. TBK1 kinase assays were performed with 50ng TBK1 protein and recombinant RIPK1 kinase domain (aa 1-(5 μg) purified from E. coli or truncated RIPK1(aa1–330) (400 ng) expressed and purified from 293T cells in 24 μL 1×kinase buffer. Kinase reactions were performed for 30min at 30°C and quenched by the addition of 6 μL 5×sample loading buffer and boiling at 100 °C for 10min.

Mass spectrometry and data analysis

Recombinant His-RIPK1 kinase domain (a.a. 1–294) purified from E. coli (20 μg) was incubated in vitro with or without recombinant full length His-TBK1 purified from sf9 cells (200 ng) in the presence of 100μM ATP at 30°C for 30min. The samples were resolved by SDS-PAGE and stained with Coomassie blue. The RIPK1 band was cut and digested in gel. The resulting peptides were subjected to the enrichment of phosphorylated peptides by using TiO2. The enriched phosphorylated peptides were analyzed on the Q Exactive HF mass spectrometer (Thermo Scientific). The identification and quantification of phosphorylated peptides was done by MaxQuant (Cox and Mann, 2008). The tandem mass spectra were searched against UniProt human protein database together with a set of commonly observed contaminants. The precursor mass tolerance was set as 20 ppm, and the fragment mass tolerance was set as 0.1 Da. The cysteine carbamidomethylation was set as a static modification, and the methionine oxidation as well as serine, threonine and tyrosine phosphorylations were set as variable modifications. The FDR at peptide spectrum match level and protein level were controlled below 1%.

In vitro dephosphorylation assay with λPPase

For λPPase treatment after immunoprecipitation, beads were resuspended with manufacturer-provided buffer (2μl 10×PMP, 2 μL 10mM MnCl2), lambda protein phosphatase(800U) in 20μL total volume. Dephosphorylation reactions were performed for 30min at 30°C and stopped by addition of 6μL 5×sample loading buffer and boiling at 100 °C for 10min.

Transmission electron microscopy

Animals were sacrificed and perfused with PBS followed by fixation solution of 2.5% glutaraldehyde/2% paraformaldehyde in 0.1 M sodium cacodylate buffer (pH 7.4). Small pieces (1–2mm3 cubes) of lumbar spinal cords (L1-L4) and the associated ventral roots from a perfusion fixed animal were post-fixed for at least 2 hrs at RT in the above fixative, washed in 0.1M cacodylate buffer and post-fixed with 1% osmiumtetroxide (OsO4)/1.5% potassium ferrocyanide (KFeCN6) for 1 hr, washed in water 3× and incubated in 1% aqueous uranyl acetate for 1hr, followed by 2 washes in water and subsequent dehydration in grades of alcohol (10min each; 50%, 70%, 90%, 2×10min 100%). The samples were then put in propyleneoxide for 1 hr and infiltrated overnight in a 1:1 mixture of propyleneoxide and TAAB Epon (Marivac Canada Inc. St. Laurent, Canada). The samples were then embedded in TAAB Epon and polymerized at 60 °C for 48 hrs. Ultrathin sections (60nm) were cut with a Reichert Ultracut-S microtome, picked up on to copper grids stained with lead citrate and examined using a JEOL 1200EX Transmission electron microscope or a TecnaiG² Spirit BioTWIN and images were recorded with an AMT 2k CCD camera. Myelination, axonal morphology and g-ratios of different genotypes were determined from counting of ~200 axons in the ventrolateral lumbar spinal cord white matter of 3 mice for each genotype at 6 months of age using ImageJ analysis.

Axonal diameter and g-ratio determination

The axonal diameters were measured on EM images using ImageJ. G-ratio was determined as the ratio of inner axonal diameter to the outer diameter of each axon fiber. ~200 axons from the ventral lateral white matter of lumbar spinal cords (L1-L4, one section each) of 3 mice (6 months old) were measured in each analysis.

Animal behavior study

The animal behavior study was conducted by the NeuroBehavior Laboratory, Harvard Institute of Medicine. The mouse genotypes were blinded to the testers. For data analysis, Shapiro-Wilks’s test was used to check suitability of parametric tests. All the pairwise comparisons are significant using this method.

Locomotor activity –

Mice were tested in locomotor activity chambers under low light to assess spontaneous exploratory activity. The apparatus consisted of 27.3cm × 27.3cm x 20.3cm, clear Plexiglas arenas equipped with infrared arrays (Med Associates; St Albans, VT, USA). Mice were placed into the center of the arena and allowed to freely explore for a total of 60 min. The movements of mice were tracked and recorded automatically via Med Associates software (Activity Monitor, Version 5.9) that measures the total distance traveled as well as vertical beam breaks for assessing rearing behavior.

Bright open field –

Mice were tested in an open field under bright light to assess anxiety-like behavior. The open field was a square box (50cm×50 cm×40cm) with black Plexiglas side walls and a light-colored floor. Mice were placed in the center of the open field and allowed to explore for 30min. Time spent and distance traveled in the center of the open field were tracked by computer-assisted video-tracking system (TopScan, CleverSys Inc., Reston, VA). An increased amount of time spent and distance traveled in the center of the open field was used as a measure of anxiolytic-like behavior.

Elevated plus maze –

Mice were tested in the elevated plus maze under dim light to assess anxiety-like behavior. The elevated plus maze was raised 91cm from the floor and consisted of two open and two closed arms (each 34cm long, 5cm wide) extended out from a central square. Mice were placed near the center compartment of the maze, facing an open arm, and allowed to explore the apparatus for 5 minutes. A computer-assisted video-tracking system (TopScan, CleverSys Inc., Reston, VA) was used to record the number of open and closed arm entries as well as the total time spent in open, closed, and center compartments. An increase in the percent time spent in the open arms (time in open arms/time in open arms + time in closed arms) *100 or an increase in the percent entries into the open arms was used as a surrogate measure of anxiolytic-like behavior.

Characterization of neuromuscular junctions

Tibialis anterior muscles from mice at 12 weeks of age were dissected, pinned in mild stretch and immersion-fixed for 30 min in 4% paraformaldehyde at RT. Fixed muscles were cryoprotected in 30% sucrose/phosphate-buffered saline (48h at 4°C). 50-μm thick frozen sections were cut longitudinally through the entire muscle. Sections were incubated overnight at RT in a cocktail of primary antibodies with anti-neurofilament 2H3 (1:250) and anti-SV2 (1:250), in PBS, 0.3% Triton-X100, 3% BSA. Sections were washed and incubated overnight with an Alexa-Fluor-488 conjugated anti-mouse IgG1 and Alexa-Fluor-594 conjugated α-bungarotoxin (Invitrogen), each at a 1:1000 dilution in the same buffer as above. Sections were then mounted in fluorescence mounting medium and imaged using fluorescence microscopy at 40x magnification and analyzed using ImageJ. The data were obtained from analyzing ~100 NMJs from 3 mice of each genotype (6 months old).

QUANTIFICATION AND STATISTICAL ANALYSIS

Multiple comparisons were statistically evaluated using a two-tailed Student’s t-test. Differences were considered statistically significant if p<0.05(*); p<0.01 (**) or p<0.001(***). Pairwise comparisons between two groups were performed using the Student’s t-test. For multiple comparisons with the three genotypes, we performed one-way Anova. Two-way Anova was performed for multiple comparisons with genotypes, and the results obtained by standard least squares fits followed by appropriate post hoc tests are shown. RNA sequencing reads were mapped against mouse mm10 transcriptome using STAR and size factors of each sample were calculated for the normalization of the count data by DEseq2 in R version 3.3.1. The heatmaps were generated using the heatmap function in the stats library.

DATA AND SOFTWARE AVAILABILITY

The accession number for the sequencing data reported in this paper is GEO: GSE116613. The Mendeley link for the original blots reported in this paper is DOI: 10.17632/pcch8m27ty.1.

Supplementary Material

1

Figure S1. Inhibition of RIPK1 kinase activity blocks embryonic lethality of Tbk1−/− mice. Related to Figure 1. (A and B) Number of offspring from intercrossing Tbk1+/− parents (A) and Tbk1+/−;Ripk1D138N/+ parents (B). (C) Representative WT, Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice at 8 weeks of age. Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice appear normal as WT mice. (D) Body weight of the control littermates, Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice. (E) A Kaplan-Meier plot of mouse survival. (F) Number of offspring from crossing Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N parents. (G) Brain sections from E13.5 pups were stained for CC3. Representative images 10 shown. (H) Liver sections from E13.5 pups were immunostained for RIPK1 and DAPI for nuclei. Representative images shown. (I) Validation of the newly developed rabbit monoclonal anti-p-RIPK1(S166) antibody for immunostaining on WT and Ripk1D138N MEFs treated with TNFα (10ng/ml)/SM164 (50nM)/zVAD-fmk (20μM) for 15 min. (J) Liver sections from E13.5 pups were immunostained 15 for RIPK1 (H) or p-RIPK1(S166) (I) and DAPI for nuclei. Representative images shown.

2

Figure S2. RIPK3 knockout partially suppresses the embryonic lethality of Tbk1−/− mice, Related to Figure 1. (A and B) Number of offspring from intercrossing Tbk1+/−;Ripk3+/− parents (A) and Tbk1+/−;Ripk3−/− parents (B). (C) Low power view of E13.5 Tbk1+/−;Ripk3−/− and Tbk1−/−;Ripk3−/− embryos. Notice RIPK3 knockout restored the development in only a subset of E13.5 20 Tbk1−/− embryos. (D) Validation of p-RIPK3(T231/S232) antibody for immunostaining on MEFs treated with TNFα (10ng/ml)/SM164 (50nM)/zVAD-fmk (20μM), with or without Nec-1s as indicated. (E) The embryos of indicated genotypes at E13.5 were isolated and dissected. Tissue lysates from the livers were subject to analysis by immunoblotting using indicated antibodies.

3

Figure S3. TBK1 deficiency promotes RIPK1 activation and RDA. Related to Figure 2. (A) Tbk1+/+ or Tbk1−/− MEFs were treated with 100nM staurosporine for indicated periods of time and cell viability was assessed by CellTiter-Glo assay. (B) Tbk1−/− MEFs 5 were retrovirally reconstituted with the expression of myc-tagged empty vector (EV), full-length TBK1 (WT) or kinase-dead TBK1(K38A). TBK1 protein levels were determined by immunoblotting the wholecell lysates of the reconstituted cells (left panel). Reconstituted cells were stimulated with TNFα for 24h. Cell viability was measured by CellTiter-Glo assay. (C) Tbk1+/+ and Tbk1−/− MEFs were 10 treated with 10 ng/ml TNFα for different periods of time as indicated and then were immunostained for p65 (green) and nuclei (DAPI). Representative images shown. The percentage of cells with nuclear p65 translocation is presented as mean ± SD of 5 experiments with about 300 cells analyzed per condition and experiment. (D) Tbk1+/+ or Tbk1−/− MEFs were stimulated with 10ng/ml TNFα for indicated time points and the whole-cell lysates were 15 immunoblotted as indicated. (E-G) MEFs of indicated genotypes were treated with different concentrations of TNFα (E) or 10 ng/ml TNFα (F and G) in the presence or absence of Nec-1s for 12 h (E) or indicated periods of time (G), and cell death was measured by SytoxGreen positivity (E) or CellTiter-Glo assay (F). The levels of p-RIPK1(S166) and cleaved caspase-3 were determined by immunoblotting (G). (H and I) MEFs of indicated genotypes were treated 20 with 1 μM CHX for 0.5 h following TNFα stimulation in the presence or absence of Nec-1s, and cell death was measured by CellTiter-Glo assay (H). The levels of p-RIPK1(S166) and cleaved caspase-3 were determined by immunoblotting (I). (J-M) MEFs of indicated genotypes were treated with or without (5Z)-7-Oxozeaeno for 0.5 h following TNFα stimulation in the presence or absence of Nec-1s, and cell survival was measured by CellTiter-Glo assay (J) or Crystal violet staining (K) or SytoxGreen positivity (L). The levels of p-RIPK1(S166) and cleaved caspase-3 were determined by immunoblotting (M). (N and O) MEFs of indicated genotypes were treated with 10 ng/ml TNFα in the presence or absence of Nec-1s for 12 h (N) or indicated periods of time (O), and cell death was measured by SytoxGreen positivity (N). The 5 levels of cleaved caspase-3 were determined by immunoblotting (O). (P) Tbk1+/+, Tbk1−/−, Tbk1−/−;Ripk1D138N/D138N and Tbk1−/−;Ripk3−/− MEFs were treated with TNFα for 12 h. The mRNA levels of cytokines and chemokines as indicated were determined by RT2 profiler PCR array. The data is presented as mean ± SD of 4 replicates. (Q) The excessive inflammation in Tbk1 deficient systems does not 10 attribute to JNK and ERK pathways. Tbk1+/+ and Tbk1−/− MEFs were pretreated with either JNK inhibitor SP600125 (10 μM) or ERK inhibitor U0126 (10 μM) for 0.5 h, then stimulated with TNFα for 12 h. The mRNA levels of Tnfα and Ifng were determined by quantitative PCR.

4

Figure S4. TBK1 is recruited into TNF-RSC to inhibit RIPK1 activation. Related to Figure 3. (A and B). MEFs of indicated genotypes were stimulated by Flag-mTNFα (100 ng/ml) for the 15 indicated periods of time, Nec-1s (10 μM) was added in selected samples as indicated. TNF-RSC (Complex I) was immunoprecipitated using anti-Flag resin, and the recruitment of TBK1 and RIPK1 were analyzed by immunoblotting. TNFR1 was a control for TNF-RSC. (C) MEFs of indicated genotypes were stimulated by Flag-mTNFα (100 ng/ml) for 5 min. TNFR1 complex I was then Flag immunoprecipitated, incubated with the deubiquitylating enzyme USP2 as 20 indicated, and RIPK1 ubiquitilation and phosphorylation finally analyzed by immunoblotting. (D) WT and Tbk1−/− MEFs were pre-incubated with 20 μM zVAD-fmk in the presence or absence of Nec-1s for 0.5 h and then stimulated with mTNFα for indicated periods of time. Complex II was isolated by anti-FADD immunoprecipitation and RIPK1 binding was revealed by immunoblotting. (E) HEK293T cells were co-transfected with expression vectors for HAhRIPK1 and myc-hTBK1 WT/K38A for 20h, and whole-cell lysates were immunoblotted as indicated. (F) HEK293T cells were co-transfected with expression vectors for Flag-hRIPK1 and Myc-hTBK1 for 20 h. The cell lysates were then immunoprecipitated using anti-Flag, incubated with lambda phosphatase (λPPase) as indicated for 30min at 30°C. The samples 5 were analyzed by immunoblotting using indicated abs. (G) Expression vectors for truncated Flag-hRIPK1(aa1-330, 1μg) with that of myc-hTBK1 (0μg, 1μg or 2μg) were co-transfected into HEK293T cells and whole-cell lysates were immunoblotted as indicated. (H) An expression vector of Flag-hRIPK1 was co-transfected with (sample 2#) or without (sample 1#) that of myc-hTBK1 into 10 HEK293T cells and cells were treated with 10 μM Nec-1s at the same time for 20h. Flag-RIPK1 was then immunoprecipitated using anti-Flag and incubated with or without Nec-1s in the presence of 100 μM ATP at 30°C for 0.5 h in vitro. Input samples and samples from kinase assay were analyzed by SDS-PAGE and immunoblotted for p-RIPK1(S166) and other protein levels as indicated.

5

Figure S5. TBK1 inhibits RIPK1 by direct phosphorylation. Related to Figure 4. (A) A schematic representation of mass spectrometry sample preparation. Recombinant His-RIPK1 kinase domain(aa1-294) purified from E. coli (20 μg) was incubated in vitro with or without recombinant full length His-TBK1 purified from sf9 cells (200 ng) in the presence of 100 μM ATP at 30°C for 30min. The samples were resolved by SDS-PAGE and stained with Coomassie 20 blue. RIPK1 band (1-294) was digested in gel and an alyzed by mass spectrometry after phosphor-peptide enrichment. (B) T189 is identified as a dominant phosphorylation site of TBK1 by mass spectrometry. (C) A sequence alignment of human RIPK1 (Homo sapiens), rat RIPK1 (Rattus norvegicus), murine RIPK1 (Mus musculus), chicken RIPK1 (Gallus gallus), turtle RIPK1 (Pelodiscus sinensis) and zebrafish RIPK1 (Danio rerio) using Clustal Omega is shown around T189. (D) Validation of a custom-made p-RIPK1(T189) antibody. Expression vectors for Flag-RIPK1 wild-type, T190A or T190E were co-transfected with or without that of myc-TBK1 into HEK293T cells for 24h. Flag-RIPK1 was then isolated by anti-FLAG immunoprecipitation and immunoblotted as indicated. (E) Validation of mass spectrometry result. The samples from in vitro kinase assay in Figure S5A were directly immunoblotted with p-RIPK1(T189) antibody. (F) Recombinant wild-type or T189A mutant truncated HA-RIPK1 (aa1-330) isolated from HEK293T cells (400 ng) was incubated with or without recombinant full length His-TBK1 purified from sf9 cells (50 ng) in vitro in the presence of ATP, Nec-1s or MRT67307 as indicated 10 at 30°C for 30min. The samples were analyzed by SDS-PAGE and immunoblotted with p-RIPK1(T189) and other antibodies as indicated. (G) An expression vector for Flag-RIPK1 was co-transfected with or without that of myc-TBK1 into HEK293T cells for 18h. The cells were treated with MRT67307 or vehicle as indicated for the last 6h before harvesting. Phosphorylated RIPK1 was immunoprecipitated with p-RIPK1(T189) antibody and analyzed by immunoblotting. (H) Validation of Tbk1−/−;Ripk1CrisprKO MEFs and RIPK1 complemented MEFs. Tbk1+/+ and Tbk1−/− MEFs were infected with lentiviral RIPK1 guide RNA to generate Tbk1−/−;Ripk1CrisprKO MEFs. The RIPK1 and TBK1 protein expression levels in stable cell lines were analyzed by immunoblotting. Tbk1−/−;Ripk1CrisprKO MEFs were retrovirally reconstituted with expression vectors of HA-tagged wild-type, T190E or T190A mutant RIPK1. The expression levels in stable 20 cell lines were also validated by immunoblotting.

6

Figure S6. Over-activation of TAK1 in TBK1 deficient cells and reduction of TAK1 in human aging brains. Related to Figure 5 and Figure 6. (A) Tbk1+/+ and Tbk1−/− MEFs were stimulated with 10 ng/ml TNFα for indicated periods of time and the whole-cell lysates were immunoblotted as indicated. (B) Tbk1+/+ and Tbk1−/− MEFs were treated with 100 nM 5z7 for 30min, and then stimulated with 10 ng/mL TNF-α for 15min or 30min as indicated. The total cell lysates were analyzed by immunoblotting using indicated abs. (C) In PFC microarray data, 3 of 4 Tak1 probesets, 206854_s_at, 211536_x_at and 211537_x_at, indicate that it is downregulated with age (41 individuals aged 24-106) with FDR<0.01 for both probes. Young 5 <40 vs old >60 gives about 1.33-fold change. Fitting a linear model with age of death as the predictor (instead of young, middle, old classes) adjusted for sex gave a similar result. (D) Immunoblotting analysis of human frontal cortex from 3 ALS patient and 3 age-matched controls using indicated antibodies (top) and the quantification of TAK1 levels (bottom). (E) Validation of TBK1, TAK1 and Cre expression levels in MEFs with indicated genotypes. (F) MEFs of indicated genotypes were treated with 10 ng/ml TNFα in the presence or absence of Nec-1s, and caspase-8 activity were measured by Caspase-Glo 8 assay. (G and H) Sections of frontal cortex from mouse brain (G) or human brains (H) were immunostained for IBA1, TAK1 or DAPI for nuclei. (I) Validation of TBK1 and TAK1 knockdown in Tbk1+/−;Tak1ΔM/+ and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ microglia by quantitative PCR. (J) Representative images of immunostaining using IBA1 in cortical slices from 6 months old mice with indicated genotypes. (K) The mRNA levels of TNFα in primary microglia of indicated genotypes were determined by quantitative PCR. The mRNA levels of Tbk1 and Tak1 were also validated (WT, n=6; Tbk1+/−, n=6; Tak1ΔM/+, n=6; Tbk1+/−;Tak1ΔM/+, n=9; Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+, n=6). (L) No cell death was detected in Tbk1+/−;Tak1ΔM/+ microglia at steady state and upon TNFα treatment. Microglia were seeded on plate for 12 h, then stimulated with different concentration of TNFα as indicated for 24 h. Cell viability was measured by CellTiter-Glo assay. (M) Tbk1+/−;Tak1ΔM/+ microglia exhibited increased inflammatory responses at steady state and upon TNFα treatment. Microglia of indicated genotypes were treated with 20 ng/ml TNFα for indicated period of time. The mRNA levels of Il1α and Tnfα were measured by quantitative PCR. (N) Validation of TBK1 and TAK1 knockdown in Tbk1+/−;Tak1ΔM/+ and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ primary microglia by immunoblotting. (O) Primary microglia of indicated genotypes were stimulated with 20 ng/ml TNFα for indicated periods of time and the whole-cell lysates were immunoblotted as indicated.

7

Figure S7. TBK1/TAK1 double heterozygosity promotes axonal defects in spinal cords, cortical neuronal loss and behavior abnormality. Related to Figure 7. (A) The distribution of individual axonal diameter in the ventrolateral lumbar spinal cord white matter of mice with indicated genotypes. (B) Electron microscopic analysis of motor axonal myelination in the ventrolateral lumbar spinal cords from 6 months old WT, Tbk1+/−, and Tak1ΔM/+ mice. (C) The distribution of individual axonal g-ratios in the ventrolateral lumbar spinal cord white matter of mice with indicated genotypes. (D and E) Motor endplates are identified with α-bungarotoxin (red); axons are identified with neurofilament + SV2 (green). Images depict innervated endplates (yellow indicates overlap) in WT and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ mice, denervated endplates in Tbk1+/−;Tak1ΔM/+ mice (D), and quantitative analysis is shown below (E). Data are shown as % of endplates classified as innervated in Tbk1+/−;Tak1ΔM/+ muscle compared to that of WT and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ mice. ~100 endplates from 3 mice (6 months old) per genotype were analyzed. (F and G) Electron microscopic analysis of motor axonal myelination in the ventrolateral lumbar spinal cords from 2 months old WT and Tbk1+/−;Tak1ΔM/+ mice (F). The mean axonal numbers, mean g-ratios, and mean axonal diameters in the ventrolateral lumbar spinal cord white matter of mice with indicated genotype (G). Data are represented as mean ± SEM. (H) Body weight of mice used for behavior test. Each symbol represents one mouse. (I and J) Representative images of NeuN-labeled cells in the cortex of 2 months old WT mice and Tbk1+/−;Tak1ΔM/+ mice (I). Quantification of NeuN-positive cells in the whole cortex is shown below (J). Data are represented as mean ± SEM. (K) Representative images of TDP-43 staining in 2 months old WT and Tbk1+/−;Tak1ΔM/+ mice frontal cortex sections. (L) Brains and spinal cords of indicated genotypes aged 6 months were isolated. Tissue lysates from these samples were subject to analysis by immunoblotting using indicated antibodies (n = 5 3 per group). (M) Anti-p-RIPK1(S166) immunostaining of the cortex of WT, Tbk1+/−;Tak1ΔM/+ and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ mice aged 6 months (n = 3 per group). (N and O) Representative traces showing the path of the animals in the bright open field (30 min) and elevated plus maze (5 min) apparatus.

8

Highlights:

  • - Embryonic lethality of Tbk1−/− mice is blocked by inactivating RIPK1 kinase;

  • - TBK1 is a suppressor of RIPK1 kinase activation;

  • - Reduced expression of TAK1, another RIPK1 inhibitor, in aging human brains;

  • - TBK1+/− cooperates with reduced myeloid TAK1 expression to promote ALS/FTD in mice.

Acknowledgments

We thank Drs. Shizuo Akira of Osaka University, Japan, for Tbk1+/− mice and Tak1fl/fl mice, Michelle Kelliher of University of Massachusetts and Manolis Pasparakis of University of Cologne, Germany, for Ripk1D138N mice, and Vishva Dixit of Genentech for Ripk3−/− mice. We thank Drs. Maria Ericsson of the HMS Electron Microscopy Facility for assistance with electron microscopy, Jennifer Waters at the HMS Nikon microscope facility for help with microscopy and Barbara Caldarone of the Neuro Behavior Laboratory, HIM, for assisting mouse behavior analysis. This work was supported by grants from the NINDS (1R01NS082257), the NIA (1R01AG047231; RF1AG055521), the National Key R&D Program of China (2016YFA0501900), the China National Natural Science Foundation (31530041), the Chinese Academy of Sciences (to J.Y.), grants from the NIA (RO1AG046174) and NIMH (RO1MH113279) to B.A.Y., and a grant from the National Natural Science Foundation of China (31701207) to H.C.

Footnotes

Declaration of Interests

JY is a consultant of Denali Therapeutics.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References(Dobin et al., 2013; Kendall et al., 2007; Love et al., 2014; Sanjana et al., 2014)

  1. Barron KD (1995). The microglial cell. A historical review. Journal of the neurological sciences 134 Suppl, 57–68. [DOI] [PubMed] [Google Scholar]
  2. Bayle JH, Grimley JS, Stankunas K, Gestwicki JE, Wandless TJ, and Crabtree GR (2006). Rapamycin analogs with differential binding specificity permit orthogonal control of protein activity. Chemistry & biology 13, 99–107. [DOI] [PubMed] [Google Scholar]
  3. Berger SB, Kasparcova V, Hoffman S, Swift B, Dare L, Schaeffer M, Capriotti C, Cook M, Finger J, Hughes-Earle A, et al. (2014). Cutting Edge: RIP1 kinase activity is dispensable for normal development but is a key regulator of inflammation in SHARPIN-deficient mice. J Immunol 192, 5476–5480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bonnard M, Mirtsos C, Suzuki S, Graham K, Huang J, Ng M, Itie A, Wakeham A, Shahinian A, Henzel WJ, et al. (2000). Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-kappaB-dependent gene transcription. EMBO J 19, 4976–4985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caccamo A, Branca C, Piras IS, Ferreira E, Huentelman MJ, Liang WS, Readhead B, Dudley JT, Spangenberg EE, Green KN, et al. (2017). Necroptosis activation in Alzheimer’s disease. Nat Neurosci 20, 1236–1246. [DOI] [PubMed] [Google Scholar]
  6. Chen ZJ (2012). Ubiquitination in signaling to and activation of IKK. Immunol Rev 246, 95–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cho YS, Challa S, Moquin D, Genga R, Ray TD, Guildford M, and Chan FK (2009). Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation. Cell 137, 1112–1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cirulli ET, Lasseigne BN, Petrovski S, Sapp PC, Dion PA, Leblond CS, Couthouis J, Lu YF, Wang Q, Krueger BJ, et al. (2015). Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways. Science 347, 1436–1441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Conde JR, and Streit WJ (2006). Microglia in the aging brain. Journal of neuropathology and experimental neurology 65, 199–203. [DOI] [PubMed] [Google Scholar]
  10. Cox J, and Mann M (2008). MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 26, 1367–1372. [DOI] [PubMed] [Google Scholar]
  11. Degterev A, Hitomi J, Germscheid M, Ch’en IL, Korkina O, Teng X, Abbott D, Cuny GD, Yuan C, Wagner G, et al. (2008). Identification of RIP1 kinase as a specific cellular target of necrostatins. Nat Chem Biol 4, 313–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Degterev A, Huang Z, Boyce M, Li Y, Jagtap P, Mizushima N, Cuny GD, Mitchison TJ, Moskowitz MA, and Yuan J (2005). Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat Chem Biol 1, 112–119. [DOI] [PubMed] [Google Scholar]
  13. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dondelinger Y, Aguileta MA, Goossens V, Dubuisson C, Grootjans S, Dejardin E, Vandenabeele P, and Bertrand MJ (2013). RIPK3 contributes to TNFR1-mediated RIPK1 kinase-dependent apoptosis in conditions of cIAP1/2 depletion or TAK1 kinase inhibition. Cell Death Differ 20, 1381–1392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dondelinger Y, Jouan-Lanhouet S, Divert T, Theatre E, Bertin J, Gough PJ, Giansanti P, Heck AJ, Dejardin E, Vandenabeele P, et al. (2015). NF-kappaB-Independent Role of IKKalpha/IKKbeta in Preventing RIPK1 Kinase-Dependent Apoptotic and Necroptotic Cell Death during TNF Signaling. Mol Cell 60, 63–76. [DOI] [PubMed] [Google Scholar]
  16. Dziedzic SA, Su Z, Jean Barrett V, Najafov A, Mookhtiar AK, Amin P, Pan H, Sun L, Zhu H, Ma A, et al. (2018). ABIN-1 regulates RIPK1 activation by linking Met1 ubiquitylation with Lys63 deubiquitylation in TNF-RSC. Nat Cell Biol 20, 58–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Freischmidt A, Muller K, Ludolph AC, Weishaupt JH, and Andersen PM (2017). Association of Mutations in TBK1 With Sporadic and Familial Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. JAMA Neurol 74, 110–113. [DOI] [PubMed] [Google Scholar]
  18. Geng J, Ito Y, Shi L, Amin P, Chu J, Ouchida AT, Mookhtiar AK, Zhao H, Xu D, Shan B, et al. (2017). Regulation of RIPK1 activation by TAK1-mediated phosphorylation dictates apoptosis and necroptosis. Nature communications 8, 359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ghasemi M, and Brown RH Jr. (2017). Genetics of Amyotrophic Lateral Sclerosis. Cold Spring Harb Perspect Med. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hawley SA, Ross FA, Gowans GJ, Tibarewal P, Leslie NR, and Hardie DG (2014). Phosphorylation by Akt within the ST loop of AMPK-alpha1 down-regulates its activation in tumour cells. The Biochemical journal 459, 275–287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ishii KJ, Kawagoe T, Koyama S, Matsui K, Kumar H, Kawai T, Uematsu S, Takeuchi O, Takeshita F, Coban C, et al. (2008). TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature 451, 725–729. [DOI] [PubMed] [Google Scholar]
  22. Ito Y, Ofengeim D, Najafov A, Das S, Saberi S, Li Y, Hitomi J, Zhu H, Chen H, Mayo L, et al. (2016). RIPK1 mediates axonal degeneration by promoting inflammation and necroptosis in ALS. Science 353, 603–608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jaco I, Annibaldi A, Lalaoui N, Wilson R, Tenev T, Laurien L, Kim C, Jamal K, Wicky John S, Liccardi G, et al. (2017). MK2 Phosphorylates RIPK1 to Prevent TNF-Induced Cell Death. Mol Cell 66, 698–710 e695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kendall J, Liu Q, Bakleh A, Krasnitz A, Nguyen KC, Lakshmi B, Gerald WL, Powers S, and Mu D (2007). Oncogenic cooperation and coamplification of developmental transcription factor genes in lung cancer. Proceedings of the National Academy of Sciences of the United States of America 104, 16663–16668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kuai J, Wooters J, Hall JP, Rao VR, Nickbarg E, Li B, Chatterjee-Kishore M, Qiu Y, and Lin LL (2004). NAK is recruited to the TNFR1 complex in a TNFalpha-dependent manner and mediates the production of RANTES: identification of endogenous TNFR-interacting proteins by a proteomic approach. J Biol Chem 279, 53266–53271. [DOI] [PubMed] [Google Scholar]
  26. Lall D, and Baloh RH (2017). Microglia and C9orf72 in neuroinflammation and ALS and frontotemporal dementia. J Clin Invest 127, 3250–3258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li B, and Dewey CN (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics 12, 323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Loerch PM, Lu T, Dakin KA, Vann JM, Isaacs A, Geula C, Wang J, Pan Y, Gabuzda DH, Li C, et al. (2008). Evolution of the aging brain transcriptome and synaptic regulation. PLoS One 3, e3329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Matsui K, Kumagai Y, Kato H, Sato S, Kawagoe T, Uematsu S, Takeuchi O, and Akira S (2006). Cutting edge: Role of TANK-binding kinase 1 and inducible IkappaB kinase in IFN responses against viruses in innate immune cells. Journal of immunology 177, 5785–5789. [DOI] [PubMed] [Google Scholar]
  31. McCartney RR, Garnar-Wortzel L, Chandrashekarappa DG, and Schmidt MC (2016). Activation and inhibition of Snf1 kinase activity by phosphorylation within the activation loop. Biochimica et biophysica acta 1864, 1518–1528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Meng H, Liu Z, Li X, Wang H, Jin T, Wu G, Shan B, Christofferson DE, Qi C, Yu Q, et al. (2018). Death-domain dimerization mediated activation of RIPK1 controls necroptosis and RIPK1-dependent apoptosis. Proc Natl Acad Sci U S A In press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Menon MB, Gropengiesser J, Fischer J, Novikova L, Deuretzbacher A, Lafera J, Schimmeck H, Czymmeck N, Ronkina N, Kotlyarov A, et al. (2017). p38(MAPK)/MK2-dependent phosphorylation controls cytotoxic RIPK1 signalling in inflammation and infection. Nat Cell Biol 19, 1248–1259. [DOI] [PubMed] [Google Scholar]
  34. Mihaly SR, Ninomiya-Tsuji J, and Morioka S (2014). TAK1 control of cell death. Cell Death Differ 21, 1667–1676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Morioka S, Broglie P, Omori E, Ikeda Y, Takaesu G, Matsumoto K, and Ninomiya-Tsuji J (2014). TAK1 kinase switches cell fate from apoptosis to necrosis following TNF stimulation. J Cell Biol 204, 607–623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, et al. (2006). Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130–133. [DOI] [PubMed] [Google Scholar]
  37. Newton K, Sun X, and Dixit VM (2004). Kinase RIP3 is dispensable for normal NF-kappa Bs, signaling by the B-cell and T-cell receptors, tumor necrosis factor receptor 1, and Toll-like receptors 2 and 4. Mol Cell Biol 24, 1464–1469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Niccoli T, Partridge L, and Isaacs AM (2017). Ageing as a risk factor for ALS/FTD. Hum Mol Genet 26, R105–R113. [DOI] [PubMed] [Google Scholar]
  39. Ofengeim D, Ito Y, Najafov A, Zhang Y, Shan B, DeWitt JP, Ye J, Zhang X, Chang A, Vakifahmetoglu-Norberg H, et al. (2015). Activation of necroptosis in multiple sclerosis. Cell reports 10, 1836–1849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ofengeim D, Mazzitelli S, Ito Y, DeWitt JP, Mifflin L, Zou C, Das S, Adiconis X, Chen H, Zhu H, et al. (2017). RIPK1 mediates a disease-associated microglial response in Alzheimer’s disease. Proc Natl Acad Sci U S A 114, E8788–E8797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Onyike CU, and Diehl-Schmid J (2013). The epidemiology of frontotemporal dementia. International review of psychiatry 25, 130–137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Perry VH, Matyszak MK, and Fearn S (1993). Altered antigen expression of microglia in the aged rodent CNS. Glia 7, 60–67. [DOI] [PubMed] [Google Scholar]
  43. Picelli S, Bjorklund AK, Faridani OR, Sagasser S, Winberg G, and Sandberg R (2013). Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nat Methods 10, 1096–1098. [DOI] [PubMed] [Google Scholar]
  44. Polykratis A, Hermance N, Zelic M, Roderick J, Kim C, Van TM, Lee TH, Chan FK, Pasparakis M, and Kelliher MA (2014). Cutting edge: RIPK1 Kinase inactive mice are viable and protected from TNF-induced necroptosis in vivo. J Immunol 193, 1539–1543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Pomerantz JL, and Baltimore D (1999). NF-kappaB activation by a signaling complex containing TRAF2, TANK and TBK1, a novel IKK-related kinase. EMBO J 18, 6694–6704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sanjana NE, Shalem O, and Zhang F (2014). Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 11, 783–784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sato S, Sanjo H, Takeda K, Ninomiya-Tsuji J, Yamamoto M, Kawai T, Matsumoto K, Takeuchi O, and Akira S (2005). Essential function for the kinase TAK1 in innate and adaptive immune responses. Nat Immunol 6, 1087–1095. [DOI] [PubMed] [Google Scholar]
  48. Sun L, Wang H, Wang Z, He S, Chen S, Liao D, Wang L, Yan J, Liu W, Lei X, et al. (2012). Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell 148, 213–227. [DOI] [PubMed] [Google Scholar]
  49. Weinlich R, Oberst A, Beere HM, and Green DR (2017). Necroptosis in development, inflammation and disease. Nat Rev Mol Cell Biol 18, 127–136. [DOI] [PubMed] [Google Scholar]
  50. White MA, and Sreedharan J (2016). Amyotrophic lateral sclerosis: recent genetic highlights. Current opinion in neurology 29, 557–564. [DOI] [PubMed] [Google Scholar]
  51. Xie T, Peng W, Liu Y, Yan C, Maki J, Degterev A, Yuan J, and Shi Y (2013). Structural Basis of RIP1 Inhibition by Necrostatins. Structure 21, 493–499. [DOI] [PubMed] [Google Scholar]
  52. Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O’Keeffe S, Phatnani HP, Guarnieri P, Caneda C, Ruderisch N, et al. (2014). An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34, 11929–11947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zimmermann KC, and Green DR (2001). How cells die: apoptosis pathways. J Allergy Clin Immunol 108, S99–103. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Figure S1. Inhibition of RIPK1 kinase activity blocks embryonic lethality of Tbk1−/− mice. Related to Figure 1. (A and B) Number of offspring from intercrossing Tbk1+/− parents (A) and Tbk1+/−;Ripk1D138N/+ parents (B). (C) Representative WT, Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice at 8 weeks of age. Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice appear normal as WT mice. (D) Body weight of the control littermates, Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N mice. (E) A Kaplan-Meier plot of mouse survival. (F) Number of offspring from crossing Tbk1−/−;Ripk1D138N/+ and Tbk1−/−;Ripk1D138N/D138N parents. (G) Brain sections from E13.5 pups were stained for CC3. Representative images 10 shown. (H) Liver sections from E13.5 pups were immunostained for RIPK1 and DAPI for nuclei. Representative images shown. (I) Validation of the newly developed rabbit monoclonal anti-p-RIPK1(S166) antibody for immunostaining on WT and Ripk1D138N MEFs treated with TNFα (10ng/ml)/SM164 (50nM)/zVAD-fmk (20μM) for 15 min. (J) Liver sections from E13.5 pups were immunostained 15 for RIPK1 (H) or p-RIPK1(S166) (I) and DAPI for nuclei. Representative images shown.

2

Figure S2. RIPK3 knockout partially suppresses the embryonic lethality of Tbk1−/− mice, Related to Figure 1. (A and B) Number of offspring from intercrossing Tbk1+/−;Ripk3+/− parents (A) and Tbk1+/−;Ripk3−/− parents (B). (C) Low power view of E13.5 Tbk1+/−;Ripk3−/− and Tbk1−/−;Ripk3−/− embryos. Notice RIPK3 knockout restored the development in only a subset of E13.5 20 Tbk1−/− embryos. (D) Validation of p-RIPK3(T231/S232) antibody for immunostaining on MEFs treated with TNFα (10ng/ml)/SM164 (50nM)/zVAD-fmk (20μM), with or without Nec-1s as indicated. (E) The embryos of indicated genotypes at E13.5 were isolated and dissected. Tissue lysates from the livers were subject to analysis by immunoblotting using indicated antibodies.

3

Figure S3. TBK1 deficiency promotes RIPK1 activation and RDA. Related to Figure 2. (A) Tbk1+/+ or Tbk1−/− MEFs were treated with 100nM staurosporine for indicated periods of time and cell viability was assessed by CellTiter-Glo assay. (B) Tbk1−/− MEFs 5 were retrovirally reconstituted with the expression of myc-tagged empty vector (EV), full-length TBK1 (WT) or kinase-dead TBK1(K38A). TBK1 protein levels were determined by immunoblotting the wholecell lysates of the reconstituted cells (left panel). Reconstituted cells were stimulated with TNFα for 24h. Cell viability was measured by CellTiter-Glo assay. (C) Tbk1+/+ and Tbk1−/− MEFs were 10 treated with 10 ng/ml TNFα for different periods of time as indicated and then were immunostained for p65 (green) and nuclei (DAPI). Representative images shown. The percentage of cells with nuclear p65 translocation is presented as mean ± SD of 5 experiments with about 300 cells analyzed per condition and experiment. (D) Tbk1+/+ or Tbk1−/− MEFs were stimulated with 10ng/ml TNFα for indicated time points and the whole-cell lysates were 15 immunoblotted as indicated. (E-G) MEFs of indicated genotypes were treated with different concentrations of TNFα (E) or 10 ng/ml TNFα (F and G) in the presence or absence of Nec-1s for 12 h (E) or indicated periods of time (G), and cell death was measured by SytoxGreen positivity (E) or CellTiter-Glo assay (F). The levels of p-RIPK1(S166) and cleaved caspase-3 were determined by immunoblotting (G). (H and I) MEFs of indicated genotypes were treated 20 with 1 μM CHX for 0.5 h following TNFα stimulation in the presence or absence of Nec-1s, and cell death was measured by CellTiter-Glo assay (H). The levels of p-RIPK1(S166) and cleaved caspase-3 were determined by immunoblotting (I). (J-M) MEFs of indicated genotypes were treated with or without (5Z)-7-Oxozeaeno for 0.5 h following TNFα stimulation in the presence or absence of Nec-1s, and cell survival was measured by CellTiter-Glo assay (J) or Crystal violet staining (K) or SytoxGreen positivity (L). The levels of p-RIPK1(S166) and cleaved caspase-3 were determined by immunoblotting (M). (N and O) MEFs of indicated genotypes were treated with 10 ng/ml TNFα in the presence or absence of Nec-1s for 12 h (N) or indicated periods of time (O), and cell death was measured by SytoxGreen positivity (N). The 5 levels of cleaved caspase-3 were determined by immunoblotting (O). (P) Tbk1+/+, Tbk1−/−, Tbk1−/−;Ripk1D138N/D138N and Tbk1−/−;Ripk3−/− MEFs were treated with TNFα for 12 h. The mRNA levels of cytokines and chemokines as indicated were determined by RT2 profiler PCR array. The data is presented as mean ± SD of 4 replicates. (Q) The excessive inflammation in Tbk1 deficient systems does not 10 attribute to JNK and ERK pathways. Tbk1+/+ and Tbk1−/− MEFs were pretreated with either JNK inhibitor SP600125 (10 μM) or ERK inhibitor U0126 (10 μM) for 0.5 h, then stimulated with TNFα for 12 h. The mRNA levels of Tnfα and Ifng were determined by quantitative PCR.

4

Figure S4. TBK1 is recruited into TNF-RSC to inhibit RIPK1 activation. Related to Figure 3. (A and B). MEFs of indicated genotypes were stimulated by Flag-mTNFα (100 ng/ml) for the 15 indicated periods of time, Nec-1s (10 μM) was added in selected samples as indicated. TNF-RSC (Complex I) was immunoprecipitated using anti-Flag resin, and the recruitment of TBK1 and RIPK1 were analyzed by immunoblotting. TNFR1 was a control for TNF-RSC. (C) MEFs of indicated genotypes were stimulated by Flag-mTNFα (100 ng/ml) for 5 min. TNFR1 complex I was then Flag immunoprecipitated, incubated with the deubiquitylating enzyme USP2 as 20 indicated, and RIPK1 ubiquitilation and phosphorylation finally analyzed by immunoblotting. (D) WT and Tbk1−/− MEFs were pre-incubated with 20 μM zVAD-fmk in the presence or absence of Nec-1s for 0.5 h and then stimulated with mTNFα for indicated periods of time. Complex II was isolated by anti-FADD immunoprecipitation and RIPK1 binding was revealed by immunoblotting. (E) HEK293T cells were co-transfected with expression vectors for HAhRIPK1 and myc-hTBK1 WT/K38A for 20h, and whole-cell lysates were immunoblotted as indicated. (F) HEK293T cells were co-transfected with expression vectors for Flag-hRIPK1 and Myc-hTBK1 for 20 h. The cell lysates were then immunoprecipitated using anti-Flag, incubated with lambda phosphatase (λPPase) as indicated for 30min at 30°C. The samples 5 were analyzed by immunoblotting using indicated abs. (G) Expression vectors for truncated Flag-hRIPK1(aa1-330, 1μg) with that of myc-hTBK1 (0μg, 1μg or 2μg) were co-transfected into HEK293T cells and whole-cell lysates were immunoblotted as indicated. (H) An expression vector of Flag-hRIPK1 was co-transfected with (sample 2#) or without (sample 1#) that of myc-hTBK1 into 10 HEK293T cells and cells were treated with 10 μM Nec-1s at the same time for 20h. Flag-RIPK1 was then immunoprecipitated using anti-Flag and incubated with or without Nec-1s in the presence of 100 μM ATP at 30°C for 0.5 h in vitro. Input samples and samples from kinase assay were analyzed by SDS-PAGE and immunoblotted for p-RIPK1(S166) and other protein levels as indicated.

5

Figure S5. TBK1 inhibits RIPK1 by direct phosphorylation. Related to Figure 4. (A) A schematic representation of mass spectrometry sample preparation. Recombinant His-RIPK1 kinase domain(aa1-294) purified from E. coli (20 μg) was incubated in vitro with or without recombinant full length His-TBK1 purified from sf9 cells (200 ng) in the presence of 100 μM ATP at 30°C for 30min. The samples were resolved by SDS-PAGE and stained with Coomassie 20 blue. RIPK1 band (1-294) was digested in gel and an alyzed by mass spectrometry after phosphor-peptide enrichment. (B) T189 is identified as a dominant phosphorylation site of TBK1 by mass spectrometry. (C) A sequence alignment of human RIPK1 (Homo sapiens), rat RIPK1 (Rattus norvegicus), murine RIPK1 (Mus musculus), chicken RIPK1 (Gallus gallus), turtle RIPK1 (Pelodiscus sinensis) and zebrafish RIPK1 (Danio rerio) using Clustal Omega is shown around T189. (D) Validation of a custom-made p-RIPK1(T189) antibody. Expression vectors for Flag-RIPK1 wild-type, T190A or T190E were co-transfected with or without that of myc-TBK1 into HEK293T cells for 24h. Flag-RIPK1 was then isolated by anti-FLAG immunoprecipitation and immunoblotted as indicated. (E) Validation of mass spectrometry result. The samples from in vitro kinase assay in Figure S5A were directly immunoblotted with p-RIPK1(T189) antibody. (F) Recombinant wild-type or T189A mutant truncated HA-RIPK1 (aa1-330) isolated from HEK293T cells (400 ng) was incubated with or without recombinant full length His-TBK1 purified from sf9 cells (50 ng) in vitro in the presence of ATP, Nec-1s or MRT67307 as indicated 10 at 30°C for 30min. The samples were analyzed by SDS-PAGE and immunoblotted with p-RIPK1(T189) and other antibodies as indicated. (G) An expression vector for Flag-RIPK1 was co-transfected with or without that of myc-TBK1 into HEK293T cells for 18h. The cells were treated with MRT67307 or vehicle as indicated for the last 6h before harvesting. Phosphorylated RIPK1 was immunoprecipitated with p-RIPK1(T189) antibody and analyzed by immunoblotting. (H) Validation of Tbk1−/−;Ripk1CrisprKO MEFs and RIPK1 complemented MEFs. Tbk1+/+ and Tbk1−/− MEFs were infected with lentiviral RIPK1 guide RNA to generate Tbk1−/−;Ripk1CrisprKO MEFs. The RIPK1 and TBK1 protein expression levels in stable cell lines were analyzed by immunoblotting. Tbk1−/−;Ripk1CrisprKO MEFs were retrovirally reconstituted with expression vectors of HA-tagged wild-type, T190E or T190A mutant RIPK1. The expression levels in stable 20 cell lines were also validated by immunoblotting.

6

Figure S6. Over-activation of TAK1 in TBK1 deficient cells and reduction of TAK1 in human aging brains. Related to Figure 5 and Figure 6. (A) Tbk1+/+ and Tbk1−/− MEFs were stimulated with 10 ng/ml TNFα for indicated periods of time and the whole-cell lysates were immunoblotted as indicated. (B) Tbk1+/+ and Tbk1−/− MEFs were treated with 100 nM 5z7 for 30min, and then stimulated with 10 ng/mL TNF-α for 15min or 30min as indicated. The total cell lysates were analyzed by immunoblotting using indicated abs. (C) In PFC microarray data, 3 of 4 Tak1 probesets, 206854_s_at, 211536_x_at and 211537_x_at, indicate that it is downregulated with age (41 individuals aged 24-106) with FDR<0.01 for both probes. Young 5 <40 vs old >60 gives about 1.33-fold change. Fitting a linear model with age of death as the predictor (instead of young, middle, old classes) adjusted for sex gave a similar result. (D) Immunoblotting analysis of human frontal cortex from 3 ALS patient and 3 age-matched controls using indicated antibodies (top) and the quantification of TAK1 levels (bottom). (E) Validation of TBK1, TAK1 and Cre expression levels in MEFs with indicated genotypes. (F) MEFs of indicated genotypes were treated with 10 ng/ml TNFα in the presence or absence of Nec-1s, and caspase-8 activity were measured by Caspase-Glo 8 assay. (G and H) Sections of frontal cortex from mouse brain (G) or human brains (H) were immunostained for IBA1, TAK1 or DAPI for nuclei. (I) Validation of TBK1 and TAK1 knockdown in Tbk1+/−;Tak1ΔM/+ and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ microglia by quantitative PCR. (J) Representative images of immunostaining using IBA1 in cortical slices from 6 months old mice with indicated genotypes. (K) The mRNA levels of TNFα in primary microglia of indicated genotypes were determined by quantitative PCR. The mRNA levels of Tbk1 and Tak1 were also validated (WT, n=6; Tbk1+/−, n=6; Tak1ΔM/+, n=6; Tbk1+/−;Tak1ΔM/+, n=9; Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+, n=6). (L) No cell death was detected in Tbk1+/−;Tak1ΔM/+ microglia at steady state and upon TNFα treatment. Microglia were seeded on plate for 12 h, then stimulated with different concentration of TNFα as indicated for 24 h. Cell viability was measured by CellTiter-Glo assay. (M) Tbk1+/−;Tak1ΔM/+ microglia exhibited increased inflammatory responses at steady state and upon TNFα treatment. Microglia of indicated genotypes were treated with 20 ng/ml TNFα for indicated period of time. The mRNA levels of Il1α and Tnfα were measured by quantitative PCR. (N) Validation of TBK1 and TAK1 knockdown in Tbk1+/−;Tak1ΔM/+ and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ primary microglia by immunoblotting. (O) Primary microglia of indicated genotypes were stimulated with 20 ng/ml TNFα for indicated periods of time and the whole-cell lysates were immunoblotted as indicated.

7

Figure S7. TBK1/TAK1 double heterozygosity promotes axonal defects in spinal cords, cortical neuronal loss and behavior abnormality. Related to Figure 7. (A) The distribution of individual axonal diameter in the ventrolateral lumbar spinal cord white matter of mice with indicated genotypes. (B) Electron microscopic analysis of motor axonal myelination in the ventrolateral lumbar spinal cords from 6 months old WT, Tbk1+/−, and Tak1ΔM/+ mice. (C) The distribution of individual axonal g-ratios in the ventrolateral lumbar spinal cord white matter of mice with indicated genotypes. (D and E) Motor endplates are identified with α-bungarotoxin (red); axons are identified with neurofilament + SV2 (green). Images depict innervated endplates (yellow indicates overlap) in WT and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ mice, denervated endplates in Tbk1+/−;Tak1ΔM/+ mice (D), and quantitative analysis is shown below (E). Data are shown as % of endplates classified as innervated in Tbk1+/−;Tak1ΔM/+ muscle compared to that of WT and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ mice. ~100 endplates from 3 mice (6 months old) per genotype were analyzed. (F and G) Electron microscopic analysis of motor axonal myelination in the ventrolateral lumbar spinal cords from 2 months old WT and Tbk1+/−;Tak1ΔM/+ mice (F). The mean axonal numbers, mean g-ratios, and mean axonal diameters in the ventrolateral lumbar spinal cord white matter of mice with indicated genotype (G). Data are represented as mean ± SEM. (H) Body weight of mice used for behavior test. Each symbol represents one mouse. (I and J) Representative images of NeuN-labeled cells in the cortex of 2 months old WT mice and Tbk1+/−;Tak1ΔM/+ mice (I). Quantification of NeuN-positive cells in the whole cortex is shown below (J). Data are represented as mean ± SEM. (K) Representative images of TDP-43 staining in 2 months old WT and Tbk1+/−;Tak1ΔM/+ mice frontal cortex sections. (L) Brains and spinal cords of indicated genotypes aged 6 months were isolated. Tissue lysates from these samples were subject to analysis by immunoblotting using indicated antibodies (n = 5 3 per group). (M) Anti-p-RIPK1(S166) immunostaining of the cortex of WT, Tbk1+/−;Tak1ΔM/+ and Tbk1+/−;Tak1ΔM/+;Ripk1D138N/+ mice aged 6 months (n = 3 per group). (N and O) Representative traces showing the path of the animals in the bright open field (30 min) and elevated plus maze (5 min) apparatus.

8

RESOURCES