Skip to main content
Springer logoLink to Springer
. 2018 Sep 4;30(1):32. doi: 10.1186/s12302-018-0163-z

A qPCR method to quantify bioavailable phosphorus using indigenous aquatic species

Yanan Yang 1, Jianghua Yang 1, Xiaowei Zhang 1,✉
PMCID: PMC6132795  PMID: 30221104

Abstract

Background

Bioavailable phosphorus (BAP) represents the sum of phosphorus that is readily available for algae growth and is useful to indicate the severity of eutrophication in aquatic environments.

Results

Here, a quantitative real-time PCR (qPCR)-based bioassay was developed to quantify BAP using the indigenous cyanobacterium species Anabaena sp. of Lake Tai, a large and shallow eutrophic lake in the Yangtze Valley, China. Primers were designed to quantify the gene expression of alkaline phosphatase (phoA/phoA-like) and phosphate transporter (pst1) genes of Anabaena. The specificity and efficiency of the primer sets were evaluated by gel electrophoresis and real-time PCR. The results showed that the primers developed here could successfully be used to measure BAP in the water. The linear range of BAP measurements by the pst1 gene after 2 h incubation was 0.125–2.00 mg/L. Then, the qPCR-based bioassay was applied to analyze water samples from Tai Lake, which had BAP levels in the range of 0.239–0.459 mg/L.

Conclusions

The qPCR-based bioassay represents a promising biomonitoring tool that can quantify phosphorus bioavailability in aquatic environments.

Keywords: Cyanobacteria, Algae bloom, Eutrophication, Bioreporters, Alkaline phosphatase, Phosphate transporter genes

Background

The eutrophication of aquatic ecosystems is a major environmental issue threatening water security and biodiversity. In recent years, lake eutrophication has intensified globally due to human activities such as aquaculture, agricultural fertilization, sewage discharge and tourism. Eutrophication causes algal blooms, hypoxia, acidification and fish deaths, raised water purification costs, and results in the loss of economic benefits associated with clean water [1]. Phosphorus is an important nutrient that restricts microbial production in freshwater and marine environments [2, 3]. A steady increase in phosphorus loading in a lake is usually the most important cause of eutrophication, causing rapid increase in algal productivity when the biological productivity of the lake is low or intermediate [4].

Phosphorus in water can be found in different organic or inorganic and dissolved or particulate forms. However, not all forms of phosphorus are equally important for eutrophication. Bioavailable phosphorus (BAP) is defined as the sum of immediately available phosphorus, which can be transformed into an available form by naturally occurring processes [5]. BAP is closely related to the growth of aquatic organisms. Therefore, measuring BAP in water is important to indicate the severity of eutrophication and provide early warnings for algal bloom outbreaks.

While analytical technologies measure a limited number of phosphorus species, bioassays can be used to detect all forms of BAP and indicate their biological effects [6]. Usually, algae cultures are used to estimate the bioavailable phosphorus content in water and sediment. Phosphatase activity is often a good indicator of phosphorus limitation [7]. Cyanobacteria respond to P-limiting conditions by increasing the surface phosphatase activities (such as alkaline phosphatases), and phosphatase activities will be completely suppressed under high ambient phosphate concentrations [7]. Phosphate-limited cyanobacteria will also increase the phosphate uptake rates [8]. Anabaena is a representative cyanobacteria, which are the most ancient phytoplankton on the planet and cause harmful algal blooms. Several model bacteria have been found to respond genetically to P limitation by up-regulating the expression of a series of genes, such as pho genes encoding alkaline phosphatases (APases) or pst genes encoding phosphate transporters that constitute a Pho regulon [9, 10]. The enzymes APases play a crucial role in the metabolism and regulation of phosphorus because they can catalyse the non-specific hydrolysis of phosphoesters or phosphodiesters to produce Pi [11].

The catchment of Lake Tai is one of the most densely populated and developed areas in China. But excessive nutrient loading by rapid industrialization and urbanization has caused rapid deterioration of water quality. Indigenous species are useful tools to provide ecologically relevant bioindicators of environmental change. Here, a quantitative real-time PCR (qPCR)-based bioassay was developed to assess phosphorus bioavailability in the water by measuring the transcriptional activity of alkaline phosphatase and phosphate transporter genes in the indigenous cyanobacterium species Anabaena sp. FACHB-1299 (Fig. 1).

Fig. 1.

Fig. 1

Technology roadmap

Methods

Bacterial strains and culture conditions

The cyanobacterium Anabaena sp. FACHB 1299 was obtained from the Freshwater Algae Culture Collection of the Institute of Hydrobiology (FACHB-Collection; Wuhan, China). FACHB 1299 and its derivatives were cultured in BG-11 medium at 28 °C [12]. In P-depleted medium, K2HPO4 was replaced by equimolar amounts of KCl.

Anabaena sp. strain FACHB-1299 genome sequencing

Because the genomic sequence of FACHB-1299 was not available, an analysis of the genome sequence of Anabaena sp. strain FACHB-1299 was first conducted. Total DNA was extracted from the Anabaena sp. FACHB 1299 culture and subjected to sequencing by the Personal Genome Machine (PGM) (Life Technologies, CA, USA). Bioinformatics analysis revealed that the genome of Anabaena sp. FACHB-1299 is approximately 11.3 Mbp in size. The complete annotation of the full genome is in progress. The DNA sequence alignment method was adopted for the full-length sequences of alkaline phosphatase and phosphate transporter genes.

Environmental water sampling in Lake Tai

Lake Tai is a large and shallow eutrophicated lake in the Yangtze valley. Surface water (30 cm under water) was sampled from 7 sampling sites (Table 1) across Lake Tai by a vertical water extractor from April 16 to 20, 2015. For each sampling site, 250 mL of the water sample was filtered immediately after sampling with a 0.22 μm Millipore membrane (Millipore), and the water was stored at 4 °C until use.

Table 1.

Geographical features of sampling sites

Sample ID Sample name Longitude Latitude
01 Xishanxi 120.150 31.140
02 Zeshan 120.268 31.014
03 Dongtaihu 120.507 31.071
04 Puzhuang 120.453 31.186
05 Jinshugang 120.361 31.384
06 Wuguishan 120.229 31.310
07 Tuoshan 120.162 31.392

P starvation and P re-feeding experiment

The cultures were pre-grown for 3 days in complete medium starting at an optical density of 0.2 at 750 nm (OD750). Anabaena sp. cells were collected from the mid-logarithmic-phase cultures by centrifugation and washed twice with P-depleted BG-11 medium. The cells were subsequently inoculated into P-depleted BG-11 for further growth. For the P re-feeding experiments, cells grown for 72 h in P-depleted medium were harvested by centrifugation at 3000×g with 30 min. An aliquot of 20 mL cells was added to 180 mL of P-depleted medium supplemented with different concentrations of K2HPO4. Cells were harvested after 2 h, 4 h and 8 h by centrifugation for 10 min at 23,000×g for RNA isolation.

Extraction of RNA and first-strand cDNA

Anabaena sp. RNA was extracted with the RNeasy Plant Mini Kit (QIAGEN, Germany), and RNA was determined by Qubit (Thermo Fisher, USA). First-strand cDNA was synthesized from total RNA with ReverTra Ace qPCR RT Kit (Toyobo, Shanghai, China) in accordance with the manufacturer’s instructions.

Real-time PCR analysis

Three genes encoding alkaline phosphatases and phosphate transporters were selected from the Anabaena sp. FACHB-1299 genome. The primers used for amplifying each gene were designed using Primer 5.0 (Primer, Canada) (Table 2). To verify that each primer hybridized to the target sequence only, gradient PCR were performed before the quantitative PCR. To determine the amplicon identity, all of the PCR products were cloned into PMD19-T vectors, and sequenced at Generay Co. (Shanghai, China). PCR product was analyzed on a 0.2% agarose gel. QPCR amplification and analysis were performed using the StepOne Real-Time PCR Systems (Thermo Fisher, USA). All reactions were performed using the StepOne Real-Time PCR Systems (Thermo Fisher, USA) according to the manufacturer’s instructions. The PCR reaction conditions were as follows: pre-incubation at 95 °C for 10 min; 40 cycles at 94 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s and a final extension at 72 °C for 3 min. Fluorescence was measured at the end of each annealing step. Amplification was followed by a melting curve analysis with continual fluorescence data acquisition during the 56–61 °C melt. The raw data were analysed with the StepOne Real-Time PCR Systems (Thermo Fisher, USA), and the gene expression levels were normalized to Anabaena sp. 16S (accession number 14088448) to minimize variations in the cDNA template. QPCR data were technical replicates with error bars, representing mean ± SE (n = 3). Statistical and correlation analyses were performed with SPSS. The 2−ΔΔCt method [13] was used to calculate the relative expression of the phosphorus metabolism-related enzyme genes.

Table 2.

Primers used to quantify the transcriptional activity of alkaline phosphatase and phosphate transporter genes in Anabaena sp. FACHB 1299

Primer Gene accession Sequence (5′–3′) Tm (°C) Product (bp)
pst1-F MH184530 GCCACAGCTCAAGCTCAAAC 60 138
pst1-R CCCACCACCACTACCAATCC
phoA-F MH184531 GTGGCTGGAGCAAGAACTTA 60 171
phoA-R CAGCATCTTGAGGGTTGTGT
phoAlike-F1 MH184532 TCGGCAGGAATAGTCAAGGT 60 124
phoAlike-R1 AAGTCATCGCCACTGTCGTA
16s-F 14088448 AAGCATCGGCTAACTCC 60 199
16s-R TTTCACCGCTACACCAG

Results and discussion

Transcriptional response of phoA-like, pst1, and phoA to phosphate

The targeted cDNA of alkaline phosphatase genes in FACHB 1299 was successfully detected by the three primer sets (Fig. 2). PCR with the pst1F/pst1R primer set produced an amplicon with a size of approximately 138 bp. The results of cloning and sequencing confirmed the PCR products by the three primer sets, pst1F/pst1R, phoA-F/R and phoAlike-F1/R1, with complete matches to the corresponding genome sequence.

Fig. 2.

Fig. 2

Gel electrophoresis of the PCR products by the designed primers using the genomic DNA template of cyanobacterium Anabaena sp. FACHB 1299

A concentration-dependent increase in transcriptional expression was observed for each of the three genes at 2 h, 4 h or 8 h after P re-feeding (Fig. 3). These patterns were consistent with previous observations made in another Anabaena sp. stain, PCC 7120, using a fluorescent reporter gene approach [14]). Another study in Anabaena sp. FACHB 709 showed four APases (phoA-709, phoD1-709, phoD2-709, and phoS-709) were involved in P metabolism and regulation, and PhoA-709 was the main APase involved in these processes [15].

Fig. 3.

Fig. 3

Gene expression of the three studied genes (phoA/phoA-like/pst1) in response to phosphorus (K2HPO4) exposure after 2, 4, and 8 h of incubation

It has been previously shown that pst1 is activated at a much higher level than phoA-like and phoA following P starvation [14].And the 2 h is more convenient than 4 h and 8 h for the operators. Therefore, the expression level of pst1 at 2 h was used as a bioindicator for BAP. A linear increase in pst1 gene expression at 2 h was observed in the full concentration range, which can be used as the standard curve for P bioavailability quantification (Fig. 4).

Fig. 4.

Fig. 4

Standard curve based on the mRNA expression of pst1-2 h in different concentrations of phosphorus (K2HPO4)

pst1 as bioreporters of P bioavailability in environmental samples

The BAP contents in the water from Lake Tai ranged from 0.239 to 0.459 mg/L based on the expression trend of pst1-2 h in the QPCR bioassay (Table 3). Although this is just one-time measurement, the result showed that this value was within the total P (TP) content range (0.051–0.770 mg/L) of Meiliang Bay of Tai Lake in 2013. A previous BAP measurement by the algae culture method provided a lower BAP concentration range (0.023–0.107 mg/L) [16], this difference might be due to differences in the technologies used. Together with the methods of this study, the biological-based approach can be supplementary to TP content monitoring in freshwater management.

Table 3.

Concentrations of bioavailable phosphorus (BAP) in different sampling sites

Sample ID Sample sites Relative gene expressions BAP (mg/L)
01 Xishanxi 2.163 0.411
02 Zeshan 1.979 0.397
03 Dongtaihu 0.538 0.246
04 Puzhuang 2.027 0.401
05 Jinshugang 0.495 0.239
06 Wuguishan 2.389 0.426
07 Tuoshan 2.936 0.459

The qPCR-based bioassay represents a promising biomonitoring tool that can quantify phosphorus bioavailability in aquatic environments. Many methods have been used to measure the dissolved inorganic phosphorus fraction, including electrochemical, chromatographic and enzymatic assays [17]. However, most of these chemical approaches may not be able to estimate the actual bioavailable phosphorus because of a lack of sensitivity and inability to be applied to environmental samples. An inverse relationship was found between values of bioavailable P, measured by enzymatic assays and phosphatase activities. Cyanobacteria from sampling sites with low bioavailable P showed high phosphatase activity and vice versa [18]. The standard algal available P (AAP) test provides biological estimates of bioavailable and limiting nutrients via extensive evaluations and applications [19, 20]. The BAP in sediments from West Lake and Lake Tai (China) and Lough Erne (Northern Ireland) has been evaluated using total P (TP), water soluble P (WSP), readily desorbable P (RDP), algal available P (AAP) and Olsen-P. The rank order of the extraction efficiency was the same in all lakes in the sequence and was as follows: AAP > Olsen-P > WSP > RDP [21]. The molecular method can be more sensitive and precise than the above methods for the detection of bioactive phosphorus. Quantitative RT-PCR from cultured marine Synechococcus sp. strain WH8102 and freshwater Synechococcus sp. ARC-21 demonstrated the induction of phnD expression in P-depleted media, suggesting that phn genes are regulated coordinately with genes under phoRB control [18].

Conclusion

In summary, a qPCR bioassay was developed to quantify phosphorus bioavailability in aquatic environments. The results showed that the primers designed in this study could successfully detect phosphorus bioavailability in the water. Overall, these bioreporters provide information on the BAP or of a specific analyze to the indigenous species. Future technological developments may make this method much more available for standardized application for environmental studies.

Authors’ contributions

YY and XZ conceived and designed the experiments. YY collected all samples and performed molecular biology experiments. YY and JY analyzed sequence data. YY and XZ wrote and edited the final manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

Materials described in the manuscript, including all relevant raw data, will be freely available to any scientist wishing to use them for non-commercial purposes.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Funding

For support, we thank Major Science and Technology Program for Water Pollution Control and Treatment (Grant#2017ZX07602002), Project funded by China Postdoctoral Science Foundation (Grant#2016M591827), and Environmental Protection Public Welfare Scientific Research Project of China (#201409040). The research is also supported by the Fundamental Research Funds for the Central Universities.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Abbreviations

BAP

bioavailable phosphorus

qPCR

quantitative real-time PCR

APases

alkaline phosphatases

FACHB-collection

the Freshwater Algae Culture Collection of the Institute of Hydrobiology

TP

total phosphorus

AAP

algal available phosphorus

WSP

water soluble phosphorus

RDP

readily desorbable phosphorus

Contributor Information

Yanan Yang, Email: yangyanan@nju.edu.cn.

Jianghua Yang, Email: yangjianghua1012@163.com.

Xiaowei Zhang, Phone: (86)-25-89680623, Email: zhangxw@nju.edu.cn, Email: Howard50003250@yahoo.com.

References

  • 1.Carpenter SR, Lathrop RC. Probabilistic estimate of a threshold for eutrophication. Ecosystems. 2008;11(4):601–613. doi: 10.1007/s10021-008-9145-0. [DOI] [Google Scholar]
  • 2.Scanlan DJ, Wilson WH. Application of molecular techniques to addressing the role of P as a key effector in marine ecosystems. Hydrobiologia. 1999;401(3):149–175. doi: 10.1023/A:1003742528262. [DOI] [Google Scholar]
  • 3.Hudson JJ, Taylor WD, Schindler DW. Phosphate concentrations in lakes. Nature. 2000;406(6791):54–56. doi: 10.1038/35017531. [DOI] [PubMed] [Google Scholar]
  • 4.Xie L, Xie P. Long-term (1956–1999) dynamics of phosphorus in a shallow, subtropical chinese lake with the possible effects of cyanobacterial blooms. Water Res. 2002;36(1):343–349. doi: 10.1016/S0043-1354(01)00198-1. [DOI] [PubMed] [Google Scholar]
  • 5.Boström B, Persson G, Broberg B. Bioavailability of different phosphorus forms in freshwater systems. Hydrobiologia. 1988;170(1):133–155. doi: 10.1007/BF00024902. [DOI] [Google Scholar]
  • 6.Köhler S, Belkin S, Schmid RD. Reporter gene bioassays in environmental analysis. Fresenius J Anal Chem. 2000;366(6–7):769–779. doi: 10.1007/s002160051571. [DOI] [PubMed] [Google Scholar]
  • 7.Mateo P, Berrendero E, Perona E, Loza V, Whitton BA. Phosphatase activities of cyanobacteria as indicators of nutrient status in a Pyrenees river. Hydrobiologia. 2010;652(1):255–268. doi: 10.1007/s10750-010-0338-0. [DOI] [Google Scholar]
  • 8.Ritchie RJ, Trautman DA, Awd L. Phosphate limited cultures of the Cyanobacterium Synechococcus are capable of very rapid, opportunistic uptake of phosphate. New Phytol. 2010;152(2):189–201. doi: 10.1046/j.0028-646X.2001.00264.x. [DOI] [Google Scholar]
  • 9.Antelmann H, Scharf C, Hecker M. Phosphate starvation-inducible proteins of Bacillus subtilis: proteomics and transcriptional analysis. J Bacteriol. 2000;182(16):4478–4490. doi: 10.1128/JB.182.16.4478-4490.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Suzuki S, Ferjani A, Suzuki I, Murata N. The SphS–SphR two component system is the exclusive sensor for the induction of gene expression in response to phosphate limitation in synechocystis. J Biol Chem. 2004;279(13):13234–13240. doi: 10.1074/jbc.M313358200. [DOI] [PubMed] [Google Scholar]
  • 11.Eder S, Shi L, Jensen K, Yamane K, Hulett FM. A Bacillus subtilis secreted phosphodiesterase/alkaline phosphatase is the product of a pho regulon gene, phod. Microbiology. 1996;142(Pt 8):2041–2047. doi: 10.1099/13500872-142-8-2041. [DOI] [PubMed] [Google Scholar]
  • 12.Rippka R, Deruelles J, Waterbury B. Generic assignments, strain histories and properties of pure cultures of cyano- bacteria. J Gen Microbiol. 1979;11:1–61. [Google Scholar]
  • 13.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 14.Muñoz-Martín MA, Mateo P, Leganés F, Fernández-Piñas F. Novel cyanobacterial bioreporters of phosphorus bioavailability based on alkaline phosphatase and phosphate transporter genes of Anabaena sp. pcc 7120. Anal Bioanal Chem. 2011;400(10):3573–3584. doi: 10.1007/s00216-011-5017-0. [DOI] [PubMed] [Google Scholar]
  • 15.Liu Z, Wu C. Response of alkaline phosphatases in the Cyanobacterium anabaena sp. FACHB 709 to inorganic phosphate starvation. Curr Microbiol. 2012;64(6):524–529. doi: 10.1007/s00284-012-0101-z. [DOI] [PubMed] [Google Scholar]
  • 16.Wang M, Wu XF, Li DP, Li X, Huang Y. Annual variation of different phosphorus forms and response of algae growth in Meiliang bay of Taihu lake. Environ Sci. 2015;36(1):80–86. [PubMed] [Google Scholar]
  • 17.Dorich RA, Nelson DW, Sommers LE. Availability of phosphorus to algae from eroded soil fractions. Agric Ecosyst Environ. 1984;11(3):253–264. doi: 10.1016/0167-8809(84)90034-3. [DOI] [Google Scholar]
  • 18.Muñozmartín MÁ, Martínezrosell A, Perona E, Fernándezpiñas F, Mateo P. Monitoring bioavailable phosphorus in lotic systems: a polyphasic approach based on cyanobacteria. Sci Total Environ. 2014;475:158–168. doi: 10.1016/j.scitotenv.2013.06.076. [DOI] [PubMed] [Google Scholar]
  • 19.Butkus SR, Welch EB, Horner RR, Spyridakis DE. Lake response modeling using biologically available phosphorus. Journal. 1988;60(9):1663–1669. [Google Scholar]
  • 20.Zhou Q, Gibson CE, Zhu Y. Evaluation of phosphorus bioavailability in sediments of three contrasting lakes in China and the UK. Chemosphere. 2001;42(2):221. doi: 10.1016/S0045-6535(00)00129-6. [DOI] [PubMed] [Google Scholar]
  • 21.Ilikchyan IN, Mckay RM, Zehr JP, Dyhrman ST, Bullerjahn GS. Detection and expression of the phosphonate transporter gene phnD, in marine and freshwater Picocyanobacteria. Environ Microbiol. 2010;11(5):1314–1324. doi: 10.1111/j.1462-2920.2009.01869.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Materials described in the manuscript, including all relevant raw data, will be freely available to any scientist wishing to use them for non-commercial purposes.


Articles from Environmental Sciences Europe are provided here courtesy of Springer

RESOURCES