Abstract
With the developments in taxonomy, the classically used highly conserved 16S rRNA molecular marker has shown some disadvantages among closely related species. For further taxonomic studies of the prokaryotes, specific PCR primers were designed from two conserved regions in the amino acid sequences of the 70-kDa heat shock protein sourced from 20 different genera in actinomycetes. These were used for the amplification of the hsp70 genes in 16 Streptomyces strains. Then, we investigated the phylogenetic relationships among these Streptomyces strains and compared the tree topology based on the hsp70 gene with those based on the previously used markers (16S rRNA and gyrB). To our knowledge, this is the first use of the hsp70 gene as a molecular marker for the taxonomic identification of Streptomyces.
Keywords: 16S rRNA, Molecular marker, hsp70, gyrB, Taxonomic identification
Introduction
The highly conserved 16S rRNA gene, also known as the ‘bacterial fossil’, encodes small subunit of the ribosomal RNA (rRNA) in prokaryotes. It contains 10 variable regions and 11 constant regions (Woese et al. 1975). Phylogenetic analysis based on the 16S rRNA gene is considered to be a simple and appropriate tool for the construction of bacterial phylogenetic relationships. Thus, it is one of the most commonly used methods for identifying microorganisms (Amann et al. 1995; Stackebrandt and Goebel 1994; Woese et al. 1990). Recently, molecular techniques based on the PCR, such as DGGE, LH-PCR, cPCR, SSCP, ARDRA, AFLP, RFLP, FISH and T-RFLP, have provided outstanding tools for the detection, identification, and characterisation of microorganisms based on this gene region (Giraffa and Neviani 2001). However, the high percentage of sequence similarity among closely related species limits its effectiveness (Ash et al. 1991; Christensen et al. 1998; Yamamoto and Harayama 1998).
Consequently, other protein-encoding gene sequences have been evaluated for use as tools in phylogenetic and taxonomic identification (Küpfer et al. 2006). The gap and ompA genes, which encode glyceraldehyde-3-phosphate dehydrogenase and outer-membrane protein 3A respectively, were used to identify five species of Escherichia, but these did not form a monophyletic group (Lawrence et al. 1991). In addition, the sequences of recA, rpoB, infB, fusA and nifD, which are involved in DNA recombination or DNA repair, the RNA polymerase β-subunit and translation initiation factor 2, the protein synthesis elongation factor-G and the α subunit of the dinitrogenase protein were also used to describe the phylogenetic relationships of different bacterial genera (Das et al. 2014; Hedegaard et al. 1999; Holmes et al. 2004; Lloyd and Sharp 1993; Mollet et al. 1997). Unfortunately, despite having a higher phylogenetic resolution than the 16S rRNA sequences (Yamamoto and Harayama 1996), some of the phylogenetic trees did not form distinct phylogenetic groups (Dauga 2002). Recently, the gyrB gene, which encodes the subunit B protein of DNA gyrase, was proposed as a suitable phylogenetic marker. It was most commonly used in the identification and classification of the evolutionary relationships of closely related species, due to its success (Kasai et al. 2000; Venkateswaran et al. 1998; Yamada et al. 1999; Yamamoto et al. 1999; Yamamoto and Harayama 1998).
Heat shock proteins (HSPs) are groups of stress-response proteins that have been demonstrated to be universally distributed across biological groups from bacterial to human beings (Hunt and Morimoto 1985). According to their biological activities and apparent molecular weights, HSPs are classified into four major families: hsp90, hsp70, hsp60, and small HSPs including hsp27. A study previously revealed that human hsp70 is 73% identical to Drosophila hsp70 and is 47% identical to Escherichia coli DnaK. These have been considered as useful phylogenetic markers (Hunt and Morimoto 1985). We aimed to develop a set of novel PCR primers that allow for the amplification of the hsp70 gene. These were then used to study the phylogenetic relationships among Streptomyces strains.
Materials and methods
Strains and culture conditions
All the Streptomyces strains used in this study were collected in our laboratory. E. coli strains were typically cultured in Luria–Bertani (LB) medium or on LB agar plates at 37 °C (Sambrook and Russell 2001). Where appropriate, the media contained the antibiotic ampicillin (1 μg/mL). To prepare the total genomic DNA of Streptomyces, Tryptone Soy Broth liquid medium containing 0.5% glycine was used for culturing the strains (Hopwood et al. 1985).
Chemicals and reagents
All the chemicals and reagents used were of the highest purity commercially available. Taq polymerase was purchased from TaKaRa Bio Inc. (Japan).
Preparation of genomic DNA
All bacteria genomic DNA was isolated using the method described by Hopwood (Hopwood et al. 1985).
PCR amplification of target genes
PCR amplification was performed using an Eppendorf Personal Master Cycler. A master mix of 50 μL used for the PCR reaction contained: 5.0 μL 10X PCR Buffer, 3.0 μL MgCl2 (25 mM), 4.0 μL dNTPs (2.5 mM each), 1.0 μL of degenerate PCR primers (20 mM each), 2.5 μL dimethyl sulfoxide, 1.0 μL genomic DNA (ca.0.2 μg) and 0.5 μL Taq polymerase. The amplification conditions were as follows: (a) 1 cycle for 3 min at 94 °C; (b) 94 °C for 1 min, 64 °C for 1 min, then 72 °C for 1.5 min for 35 cycles; (c) 1 cycle at 72 °C for 10 min.
In addition, the 16S rRNA gene and the gyrB gene were amplified by PCR using the primers as described previously (Calcutt 1994; Edwards et al. 1989). The PCR products were directly sequenced by an ABI Genetic Analyzer 3730 (Invitrogen Bio Inc., Shanghai, China) which used the 16S rRNA primers and F-1S (5′-GAGGTCGTGCTGACCGTGCTGCA-3′)/F-2R (5′-GTTGAT GTGCTGGCCGTCGACGT-3′) for gyrB (Hatano et al. 2003).
Gel analysis and DNA sequencing
All PCR products were analyzed using 1.0% agarose-gel electrophoresis, stained with ethidium bromide (AMRESCO, USA). PCR products were directly sequenced by ABI Genetic Analyzer 3730 (Invitrogen Bio Inc., Shanghai, China) which used the sequence primers U1F (5′-CGTGCAGTCGGTATCGACCTCGG-3′) and 2R (5′-CGATGCCGTTGGCGTCGATGTC-3′).
Phylogenetic analysis
16S rRNA and hsp70 gene sequences were compared to the GenBank nucleotide and protein databases using BLASTN and BLASTX (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Phylogenetic and molecular evolutionary analyses were conducted using MEGA 4.1 (Tamura et al. 2007). Briefly, for the construction of bootstrap test of 16S rRNA and hsp 70 gene phylogenetic trees, the algorithm for the neighbour-joining (NJ) method (Saitou and Nei 1987) and Kimura 2-parameter model (Kimura 1980) were used. Percentage bootstrap values based on 1000 resampled datasets are shown.
Nucleotide sequence accession numbers
All the sequences used in this paper were deposited into GenBank under the accession numbers JF443561–JF443576 and HQ607409–HQ607473, as indicated in Fig. 3.
Fig. 3.
Phylogenetic relationships based on the hsp70 (a), 16S rRNA (b) and gyrB (c) gene sequences of 16 Streptomyces strains
Results
Design primers for the PCR amplification of hsp70 genes
PCR primers for the amplification of hsp70 (Dna K) genes were designed from two conserved regions of the amino acid sequences of the 70-kDa heat shock protein from 20 genera in the actinomycetes (Fig. 1). Then, one primer pair was designed for amplifying approximately 1300 bp of the hsp70 gene fragment and the other primer pair was used to direct sequencing (Table 1). The primer pairs were aligned with the other gene sequences in the GenBank using BLAST (http://www.ncbi.nlm.nih.gov/BLAST).
Fig. 1.
Sequence alignment of approximately 480N-terminal amino acids of 20 selected 70-kDa heat shock proteins from actinomycetes. Each protein sequences were deposited in GeneBank (Acidothermus. cellulolyticus: CP000481; Actinomadura spadix: AF451887; Streptomyces coelicolor: L46700; Frankia alni: CT573213; Salinispora arenicola: CP000850; Stackebrandtia. nassauensis: CP001778; Actinosynnema mirum: NC_013093; Amycolatopsis mediterranei: CP002000; Saccharomonospora viridis: CP001683; Saccharopolyspora erythraea: AM420293; Catenulispora acidiphila: CP000431; Rhodococcus opacus: AP011115; Nocardia farcinica: AP006618; Corynebacterium jeikeium: CR931997; Cellulomonas flavigena: CP001964; Xylanimonas cellulosilytica: CP001821; Clavibacter michiganensis: AM849034; Micrococcus luteus: CP001628; Kineococcus radiotolerans: CP000750; Geodermatophilus obscurus: CP001867). “*” indicates where the residues are identical in all sequences in the alignment in that column. “:”, “.” indicates where conserved and semi-conserved substitutions are observed, respectively. Two conserved regions of the amino acid sequences enclosed in grey are used to design degenerated primers for the amplification of approximately 1300 bp hsp70 gene fragment
Table 1.
Primers used for the PCR amplification of the hsp70 gene of Streptomyces strains
| Primer | Oligonucleotide sequencea | Length (bases) | Positionsb | Orientation |
|---|---|---|---|---|
| hsp70-U7F | CGTGCAGTCGGTATCGACCTCGGBACVACBAACTC | 35 | 7–41 | Sense |
| hsp70-1326R | CGATGCCGTTGGCGTCGATGTCGAASGHSACCTCGA | 36 | 1326–1363 | Antisense |
| U1Fc | CGTGCAGTCGGTATCGACCTCGG | 23 | 7–29 | Sense |
| 2Rc | CGATGCCGTTGGCGTCGATGTC | 22 | 1326–1347 | Antisense |
aIUB code for degenerated base positions: B = G/C/T; V = A/G/C; S = C/G; H = A/C/T
bPositions correspond to the hsp70(DnaK) nucleotide sequence of S. coelicolor (GeneBank NO. L46700)
cDirect sequencing primers for hsp70-U7F/hsp70-1326R
PCR amplification of hsp70 genes
Primer optimization experiments were performed using a single primer pair (hsp70-U7F and hsp70-1326R) to amplify the hsp70 gene of Streptomyces coelicolor. The results showed that the sequences of the PCR product amplified from the primer pair was the same as the hsp70 genes retrieved from the Genbank database. Then, the primer pair described above was used to amplify the hsp70 genes in 16 Streptomyces strains. The PCR products with the expected size of approximately 1300 bp corresponded to those predicted from known hsp70 sequences (Fig. 2).
Fig. 2.
Gel electrophoresis of PCR products amplified with degenerate primers (hsp70-U7F and hsp70-1326R). Lanes M, 1 kb DNA marker; lanes 1 to 16, S. tendae strain 944, S. pluricolorescens strain 999, 1043 S. panayensis strain 1043, S. flavovariabilis strain 1067, S. macrosporeus strain 1076, S. drozdowiczii strain 1136, S. olivaceus strain 1137, S. chartreusis strain 1159, S. malaysiensis strain 1161, S. werraensis strain 1165, S. albogriseolus strain 1168, S. hawaiiensis strain 1183, S. castaneoglobisporus strain 1185, S. phaeofaciens strain 1187, S. acrimycini strain 1202
Comparison of hsp70 and 16S rRNA phylogenetic tree topologies
When the phylogenetic trees constructed from the nucleotide sequences of hsp70 and the 16S rRNA gene from the same 16 Streptomyces reference strains were compared, analysis showed there were only slight differences between the phylogenetic structures for these Streptomyces. Based on the bootstrap values and the level of the stability of the branches, the 16 strains of Streptomyces were divided into four stable subgroups (A, B, C and D) (Fig. 3a, b). According to the hsp70 phylogenetic tree, two strains, S. albogriseolus strain 1168 and S. acrimycini strain 1202, clustered closely in the A subgroup branch with a bootstrap value of 100%, whereas S. acrimycini strain 1202 and S. macrosporeus strain 1076 clustered closely in the 16S rRNA phylogenetic tree with a bootstrap value of 70%. Therefore, subgroup A of hsp70 phylogenetic tree showed higher stability than the 16S rRNA phylogenetic tree. Furthermore, the strains in B, C and D subgroups also displayed higher stability for the hsp70 phylogenetic tree compared to the phylogenetic tree constructed from 16S rRNA. In addition, two strains, S. viridis strain 1010 and S. panayensis strain 1043, were outside the four subgroups and clustered closely in hsp70 phylogenetic tree with a bootstrap value of 87%, and S. viridis strain 1010 clustered closely with S. castaneoglobisporus strain 1185; S. panayensis strain 1043 clustered closely with S. hawaiiensis strain 1183 with bootstrap values of 52% and 29%, respectively. These results showed that the phylogenetic tree constructed from hsp70 had a reasonable topology in comparison to the 16S rRNA phylogenetic tree.
Comparison of hsp70 and gyrB phylogenetic tree topologies
Comparison between the hsp70 and gyrB phylogenetic trees showed that there were some inconsistencies, leaving only 3 subgroups A, C and D (Fig. 3a, c). In both phylogenetic trees, these 3 subgroups were congruent and stable, but hsp70 phylogenetic tree was even more reasonable. For example, in the hsp70 and gyrB phylogenetic trees, subgroup D clustered closely with S. panayensis strain 1043 with a bootstrap value 87% and 62%, respectively; it seems that the branch in the hsp70 phylogenetic tree had a reasonable topology. Also, in the hsp70 phylogenetic tree, S. viridis strain 1010 and S. panayensis strain 1043 formed a more stable branch, but there were some differences from the phylogenetic tree based on gyrB. Among the phylogenetic trees (hsp70, 16S rRNA and gyrB), it seems that the phylogenetic relationships of S. viridis strain 1010 and S. panayensis strain 1043 in the hsp70 phylogenetic tree was more reasonable.
Discussion
In modern taxonomy classifying bacteria, the 16S rRNA and gyrB gene sequences have been considered to be simple and the most commonly used methods for the investigation of phylogenetic relationships (Dauga 2002; Fox et al. 1980; Fukushima et al. 2002; Hillis and Dixon 1991). Previous research has shown that the average substitution rate for 16S rRNA was 1% per 50 million years which is slower than that of gyrB gene (0.7%–0.8% per million years) (Ochman and Wilson 1987). Thus, the gyrB sequence analysis may better distinguish the phylogenetic relationships at the species level in some bacterial groups. However, this phylogenetic approach also has its limitations. Recently, rpoB and recA sequence analysis along with randomly amplified polymorphic fingerprinting could effectively identify Bacillus species with highly similar 16S rRNA gene sequences; these were hard to identify based on 16S rDNA sequence analysis (Mohkam et al. 2016). Further, several mass spectrometry methods were used for the classification and identification of bacteria and other microorganisms (Sauer and Kliem 2010). For example, MALDI-TOF MS analysis was demonstrated to be a rapid method for bacteria identification from mining samples (Avanzi et al. 2017; Książczyk et al. 2016; Schröttner et al. 2016). Although many new analytical tools were recently used for the classification and identification of bacteria, there is still urgency for the discovery of new molecular markers.
The 60 kDa heat-shock protein family hsp65 gene has also been used successfully for species identification of cultured clinical isolates of the genus Mycobacterium (Rogall et al. 1990). The hsp70 gene which is highly conserved between 16S rRNA and gyrB sequences is distributed universally from bacteria to human beings (Hunt and Morimoto 1985). Consequently, it has the potential to be used as a phylogenetic marker for the investigation of phylogenetic relationships. However, using hsp70 gene as a molecular marker for taxonomic identification is still rare to our knowledge.
Therefore, in this study, we attempted to develop novel PCR primers (hsp70-U7F and hsp70-1326R) for the investigation of the phylogenetic relationships of Streptomyces strains through amplification of the hsp70 gene. Furthermore, the PCR products can be directly and rapidly sequenced by the sequence primers U1F and 2R. Compared with the phylogenetic tree based on the 16S rRNA gene and the gyrB gene, the hsp70 phylogenetic tree has advantages for the investigation of the phylogenetic relationships of Streptomyces strains. Firstly, analysis based on the hsp70 provided a resolving power higher than that of the 16S rRNA gene analysis in differentiating among species. Secondly, separation among closely related species such as S. panayensis strain 1043, S. viridis strain 1010 and S. phaeofaciens strain 1187, show that the hsp70 phylogenetic tree provided convincing as well as reasonable phylogenetic relationships.
In conclusion, for the first time, this study develops novel PCR primers (hsp70-U7F and hsp70-1326R) were used for the investigation of the phylogenetic relationships between 16 Streptomyces strains through amplification of hsp70 gene. This gene may be a good alternative as a molecular marker for the phylogenetic analysis of Streptomyces strains. In the future, hsp70 combined with 16S rRNA and gyrB sequence method may be able to clarify molecular relationship of some controversial phylogenetic relationships of bacteria.
Authors’ contributions
WYL and YH conceived project, YH, FXS and WYL designed the study and wrote the paper. WYL and FXS performed the experiments, YH revised the English language. All authors reviewed the results. All authors read and approved the final manuscript.
Acknowledgements
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Availability of data and materials
All data analyzed in this article are included in the figures and tables. Any material used in this article is available for search purposes upon request.
Consent for publication
Not applicable.
Ethics approval and consent to participate
Not applicable.
Funding
This work was supported by the National Natural Science Foundation of China (81702905 and 81602512).
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abbreviations
- hsp70
heat shock protein 70
- gyrB
DNA gyrase, subunit B
- PCR
polymerase chain reaction
- DGGE
denaturing gradient gel electrophoresis
- LH-PCR
length heterogeneity polymerase chain reaction
- cPCR
comparative polymerase chain reaction
- SSCP
single stranded conformation polymorphisms
- ARDRA
amplified ribosomal DNA restriction analysis
- AFLP
amplified fragment length polymorphism
- RFLP
restriction fragment length polymorphism
- FISH
fluorescence in situ hybridization
- T-RFLP
terminal restriction fragment length polymorphisms
Contributor Information
Yang Hu, Email: huyang@tmu.edu.cn.
Fengxian Sun, Email: fengxian666@126.com.
Weiying Liu, Phone: +86 22 83336816, Email: liuweiying3@126.com.
References
- Amann R, Ludwig W, Schleifer K. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59(1):143–169. doi: 10.1128/mr.59.1.143-169.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ash C, Farrow J, Dorsch M, Stackebrandt E, Collins M. Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. Int J Syst Bacteriol. 1991;41(3):343–346. doi: 10.1099/00207713-41-3-343. [DOI] [PubMed] [Google Scholar]
- Avanzi IR, Gracioso LH, Karolski B, Perpetuo EA. Rapid bacteria identification from environmental mining samples using MALDI-TOF MS analysis. Environ Sci Pollut Res Int. 2017;24(4):3717–3726. doi: 10.1007/s11356-016-8125-8. [DOI] [PubMed] [Google Scholar]
- Calcutt M. Gene organization in the dnaA-gyrA region of the Streptomyces coelicolor chromosome. Gene. 1994;151(1–2):23–28. doi: 10.1016/0378-1119(94)90628-9. [DOI] [PubMed] [Google Scholar]
- Christensen H, Nordentoft S, Olsen J. Phylogenetic relationships of Salmonella based on rRNA sequences. Int J Syst Bacteriol. 1998;48(2):605–610. doi: 10.1099/00207713-48-2-605. [DOI] [PubMed] [Google Scholar]
- Das S, Dash HR, Mangwani N, Chakraborty J, Kumari S. Understanding molecular identification and polyphasic taxonomic approaches for genetic relatedness and phylogenetic relationships of microorganisms. J Microbiol Methods. 2014;103:80–100. doi: 10.1016/j.mimet.2014.05.013. [DOI] [PubMed] [Google Scholar]
- Dauga C. Evolution of the gyrB gene and the molecular phylogeny of Enterobacteriaceae: a model molecule for molecular systematic studies. Int J Syst Evol Microbiol. 2002;52(2):531–547. doi: 10.1099/00207713-52-2-531. [DOI] [PubMed] [Google Scholar]
- Edwards U, Rogall T, Blocker H, Emde M, Bottger E. Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res. 1989;17(19):7843–7853. doi: 10.1093/nar/17.19.7843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fox G, Stackebrandt E, Hespell R, Gibson J, Maniloff J, Dyer T, Wolfe R, Balch W, Tanner R, Magrum L. The phylogeny of prokaryotes. Science. 1980;209(4455):457–463. doi: 10.1126/science.6771870. [DOI] [PubMed] [Google Scholar]
- Fukushima M, Kakinuma K, Kawaguchi R. Phylogenetic analysis of Salmonella, Shigella, and Escherichia coli strains on the basis of the gyrB gene sequence. J Clin Microbiol. 2002;40(8):2779–2785. doi: 10.1128/JCM.40.8.2779-2785.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giraffa G, Neviani E. DNA-based, culture-independent strategies for evaluating microbial communities in food-associated ecosystems. Int J Food Microbiol. 2001;67(1–2):19–34. doi: 10.1016/S0168-1605(01)00445-7. [DOI] [PubMed] [Google Scholar]
- Hatano K, Nishii T, Kasai H. Taxonomic reevaluation of whorl-forming Streptomyces (formerly Streptoverticillium) species by using phenotypes, DNA-DNA hybridization and sequences of gyrB, and proposal of Streptomyces luteireticuli (ex Katoh and Arai 1957) corrig., sp. nov., nom. rev. Int J Syst Evol Microbiol. 2003;53(Pt 5):1519–1529. doi: 10.1099/ijs.0.02238-0. [DOI] [PubMed] [Google Scholar]
- Hedegaard J, Steffensen SA, Norskov-Lauritsen N, Mortensen KK, Sperling-Petersen HU. Identification of Enterobacteriaceae by partial sequencing of the gene encoding translation initiation factor 2. Int J Syst Bacteriol. 1999;49(Pt 4):1531–1538. doi: 10.1099/00207713-49-4-1531. [DOI] [PubMed] [Google Scholar]
- Hillis D, Dixon M. Ribosomal DNA: molecular evolution and phylogenetic inference. Q Rev Biol. 1991;66(4):411–453. doi: 10.1086/417338. [DOI] [PubMed] [Google Scholar]
- Holmes D, Nevin K, Lovley D. Comparison of 16S rRNA, nifD, recA, gyrB, rpoB and fusA genes within the family Geobacteraceae fam. nov. Int J Syst Evol Microbiol. 2004;54(Pt 5):1591–1599. doi: 10.1099/ijs.0.02958-0. [DOI] [PubMed] [Google Scholar]
- Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton CJ, Kieser HM, Lydiate DJ, Smith CP, Ward JM. Genetic manipulation of Streptomyces: a laboratory manual. Norwich: The John Innes Foundation; 1985. [Google Scholar]
- Hunt C, Morimoto R. Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70. Proc Natl Acad Sci USA. 1985;82(19):6455–6459. doi: 10.1073/pnas.82.19.6455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kasai H, Tamura T, Harayama S. Intrageneric relationships among Micromonospora species deduced from gyrB-based phylogeny and DNA relatedness. Int J Syst Evol Microbiol. 2000;50(1):127–134. doi: 10.1099/00207713-50-1-127. [DOI] [PubMed] [Google Scholar]
- Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16(2):111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
- Książczyk M, Kuczkowski M, Dudek B, Korzekwa K, Tobiasz A, Korzeniowska-Kowal A, Paluch E, Wieliczko A, Bugla-Płoskońska G. Application of routine diagnostic procedure, VITEK 2 compact, MALDI-TOF MS, and PCR assays in identification procedure of bacterial strain with ambiguous phenotype. Curr Microbiol. 2016;72(5):570–582. doi: 10.1007/s00284-016-0993-0. [DOI] [PubMed] [Google Scholar]
- Küpfer M, Kuhnert P, Korczak B, Peduzzi R, Demarta A. Genetic relationships of Aeromonas strains inferred from 16S rRNA, gyrB and rpoB gene sequences. Int J Syst Evol Microbiol. 2006;56(12):2743–2751. doi: 10.1099/ijs.0.63650-0. [DOI] [PubMed] [Google Scholar]
- Lawrence J, Ochman H, Hartl D. Molecular and evolutionary relationships among enteric bacteria. Microbiology. 1991;137(8):1911–1921. doi: 10.1099/00221287-137-8-1911. [DOI] [PubMed] [Google Scholar]
- Lloyd A, Sharp P. Evolution of the recA gene and the molecular phylogeny of bacteria. J Mol Evol. 1993;37(4):399–407. doi: 10.1007/BF00178869. [DOI] [PubMed] [Google Scholar]
- Mohkam M, Nezafat N, Berenjian A, Mobasher M, Ghasemi Y. Identification of Bacillus probiotics isolated from soil rhizosphere using 16S rRNA, recA, rpoB gene sequencing and RAPD-PCR. Probiotics Antimicrob Proteins. 2016;8(1):8–18. doi: 10.1007/s12602-016-9208-z. [DOI] [PubMed] [Google Scholar]
- Mollet C, Drancourt M, Raoult D. rpoB sequence analysis as a novel basis for bacterial identification. Mol Microbiol. 1997;26(5):1005–1011. doi: 10.1046/j.1365-2958.1997.6382009.x. [DOI] [PubMed] [Google Scholar]
- Ochman H, Wilson A. Evolution in bacteria: evidence for a universal substitution rate in cellular genomes. J Mol Evol. 1987;26(1):74–86. doi: 10.1007/BF02111283. [DOI] [PubMed] [Google Scholar]
- Rogall T, Flohr T, Bottger E. Differentiation of Mycobacterium species by direct sequencing of amplified DNA. Microbiology. 1990;136(9):1915–1920. doi: 10.1099/00221287-136-9-1915. [DOI] [PubMed] [Google Scholar]
- Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4(4):406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
- Sambrook J, Russell D. Molecular cloning: a laboratory manual. Cold Spring Harbor: CSHL press; 2001. [Google Scholar]
- Sauer S, Kliem M. Mass spectrometry tools for the classification and identification of bacteria. Nat Rev Microbiol. 2010;8(1):74–82. doi: 10.1038/nrmicro2243. [DOI] [PubMed] [Google Scholar]
- Schröttner P, Gunzer F, Schüppel J, Rudolph WW. Identification of rare bacterial pathogens by 16S rRNA gene sequencing and MALDI-TOF MS. J Vis Exp. 2016 doi: 10.3791/53176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stackebrandt E, Goebel B. Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol. 1994;44(4):846–849. doi: 10.1099/00207713-44-4-846. [DOI] [Google Scholar]
- Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24(8):1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
- Venkateswaran K, Dohmoto N, Harayama S. Cloning and nucleotide sequence of the gyrB gene of Vibrio parahaemolyticus and its application in detection of this pathogen in shrimp. Appl Environ Microbiol. 1998;64(2):681–687. doi: 10.1128/aem.64.2.681-687.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Woese C, Fox G, Zablen L, Uchida T, Bonen L, Pechman K, Lewis B, Stahl D. Conservation of primary structure in 16S ribosomal RNA. Nature. 1975;254(5495):83–86. doi: 10.1038/254083a0. [DOI] [PubMed] [Google Scholar]
- Woese C, Kandler O, Wheelis M. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci USA. 1990;87(12):4576–4579. doi: 10.1073/pnas.87.12.4576. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamada S, Ohashi E, Agata N, Venkateswaran K. Cloning and nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringiensis, B. mycoides, and B. anthracis and their application to the detection of B. cereus in rice. Appl Environ Microbiol. 1999;65(4):1483–1490. doi: 10.1128/aem.65.4.1483-1490.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamamoto S, Harayama S. Phylogenetic analysis of Acinetobacter strains based on the nucleotide sequences of gyrB genes and on the amino acid sequences of their products. Int J Syst Bacteriol. 1996;46(2):506–511. doi: 10.1099/00207713-46-2-506. [DOI] [PubMed] [Google Scholar]
- Yamamoto S, Harayama S. Phylogenetic relationships of Pseudomonas putida strains deduced from the nucleotide sequences of gyrB, rpoD and 16S rRNA genes. Int J Syst Bacteriol. 1998;48(3):813–819. doi: 10.1099/00207713-48-3-813. [DOI] [PubMed] [Google Scholar]
- Yamamoto S, Bouvet PJ, Harayama S. Phylogenetic structures of the genus Acinetobacter based on gyrB sequences: comparison with the grouping by DNA–DNA hybridization. Int J Syst Bacteriol. 1999;49(1):87–95. doi: 10.1099/00207713-49-1-87. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data analyzed in this article are included in the figures and tables. Any material used in this article is available for search purposes upon request.



