Abstract
Transforming growth factor-β (TGFβ) plays a central role in renal scarring, controlling extracellular matrix deposition by interstitial cells and mesangial cells. TGFβ signals through Smad and mitogen-activated protein kinase (MAPK) pathways. To understand the role of MAPK in interstitial and mesangial cells, we genetically inactivated TGFβ-activated kinase-1 (Map3k7) using Foxd1+/cre. Embryonic kidney development was unperturbed in mutants, but spontaneous scarring of the kidney ensued during the first postnatal week, with retention of embryonic nephrogenic rests and accumulation of collagen IV in the mesangium. MAPK signaling in the mesangium of mutant mice was skewed, with depressed p38 but elevated c-Jun NH2-terminal kinase (JNK) activation at postnatal day 3. Despite normal expression of platelet-derived growth factor receptor-β (PDGFRβ) in the mesangium of mutants at birth, expression was lost concomitantly with the increase in JNK activation, and studies in isolated mesangial cells revealed that JNK negatively regulates Pdgfrβ. In summary, we show that MAP3K7 balances MAPK signaling in mesangial cells, suppressing postnatal JNK activation. We propose that the balance of MAPK signaling is essential for appropriate postnatal regulation of mesangial PDGFRβ expression.
Keywords: glomerulosclerosis, kidney development, mesangial cell, TGFβ
INTRODUCTION
Renal interstitial and mesangial cells belong to a lineage derived from Foxd1-expressing progenitors, which contributes to scarring in the adult kidney (11). Signaling pathways that regulate proliferation, migration, and extracellular matrix deposition in this lineage are thus essential determinants of chronic kidney disease (CKD). Transforming growth factor-β (TGFβ) is an important driver of mesangial matrix expansion and glomerular scarring (14, 19). The TGFβ receptor activates SMAD2/3 transcription factors directly and p38 and c-Jun NH2-terminal kinase (JNK) mitogen-activated protein kinase (MAPK) signaling via the TGFβ-associated kinase-1 (MAP3K7) (12, 27, 29). Genetic studies suggest that both arms of the TGFβ signaling pathway are involved in CKD. The Smad3-null mouse is resistant to fibrosis following unilateral urethral obstruction (24). Similarly, global postnatal inactivation of Map3k7 ameliorates fibrosis in response to kidney injury (22). Mesangial cell culture studies have shown that TGFβ1 promotes collagen expression through MAP3K7 (16). With the objective of generating a mouse strain resistant to the profibrotic effects of TGFβ signaling through MAPK, we inactivated Map3k7 in the Foxd1 lineage. Fetal kidney development was unperturbed in Foxd1+/cre;Map3k7c/c mice, but surprisingly, these animals developed spontaneous scarring of the kidney starting in the first postnatal week and retained subcapsular rests of embryonic nephrons with macrophage infiltration. We found that Map3k7 is required for postnatal maintenance of PDGFRβ, an important regulator of glomerular integrity. Thus, contrary to the expected profibrotic role of MAP3K7, we find that MAP3K7 potently counteracts spontaneous mesangial scarring in the perinatal period.
METHODS
Animals.
Animal care in accordance with the National Research Council Guide for the Care and Use of Laboratory Animals was approved by the Maine Medical Center IACUC. Foxd1+/cre (10), Map3k7c/c (34), and R26RLacZ (28) mice were all on a C57BL/6J background.
Genotyping PCR.
Map3k7c/c mice were genotyped with the following primers (F, forward; R, reverse): Cre F, TTC GGC TAT ACG TAA CAG GG; Cre R, TCG ATG CAA CGA GTG ATG AG; Il-2 F, TGAGCAGGATGGAGAATTACAGG; Il-2 R, GTCCAAGTTCATCTTCTAGGCAC; Map3K7 WT F, GCTTGGGACAGGCTGGTAAAG; Map3K7 Universal R, GCACAGAAAATGCACAGTGCTC; and Map3K7 Floxed F, CTTACAAGCCGAATTCCAGCA.
Single cell genotyping.
Five E17.5 litters were harvested, kidneys were dissected, and nephrogenic zone cells were isolated using a published partial enzymatic digestion procedure (2). The cell mix was labeled with phycoerythrin (PE)-tagged anti-CD140a antibody (Miltenyi 130-102-502) bound to anti-PE antibody conjugated to supramagnetic microbeads (Miltenyi 130-048-801) and positively selected using the Miltenyi Automacs system. Flow cytometry to detect PE labeling showed enrichment to over 95%. Single cells were picked into 96-well plates and subjected to Repli-G single cell amplification (Qiagen 150345) according to the manufacturer’s instructions.
Glomerular isolation and RNA extraction.
Postnatal day 7 (P7) mice were anesthetized by intraperitoneal injection of 105 mg/kg ketamine, 16 mg/kg xylazine, and 500 U/kg heparin. Glomerular isolation was performed by magnetic separation as described (30). RNA was purified using the RNeasy Mini kit per manufacturer’s protocol with optional on-column DNase digestion (Qiagen).
Primary cell isolation and culture.
Mouse primary mesangial cells were isolated and cultured as described (8). Cell purity was confirmed at week 4 using PDGFRβ and WT1 immunofluorescence. Cells underwent 20-min serum depletion in medium plus 2% bovine growth serum followed by 10-min pretreatment with 10 µM JNK inhibitor II (VWR) or 0.38 µM p38 inhibitor (Calbiochem) before 8-h stimulation with vehicle or 100 nM anisomycin A (Sigma).
Immunostaining.
Tissue was fixed in 4% paraformaldehyde for 1 h per millimeter thickness at room temperature before paraffin sectioning. Immunostaining was performed as described (2). Primary antibody concentrations were as follows: 1:50 PAX8 (Proteintech), 1:100 F4/80-BM8 (Santa Cruz Biotechnology), 1:50 desmin (DAKO), 1:100 PDGFRβ (Abcam), 1:100 α-smooth muscle actin (Invitrogen), CD31 (BD Biosciences), 1:50 collagen I (Rockland), 1:50 collagen IV (Rockland), 1:50 collagen IVα1 (Abnova), 1:50 collagen IVα5 (Abnova), 1:50 phosphorylated (p)JNK (Cell Signaling Technology), 1:200 diphosphorylated extracellular signal-related kinase (dpERK, Sigma), 1:50 pp38 (Cell Signaling Technology), 1:100 Wilms tumor 1 (WT1, Santa Cruz Biotechnology). Secondary antibodies were 1:200 goat anti-rabbit Alexa 568 (Invitrogen), 1:200 mouse anti-rat biotin (Jackson Immunoresearch), 1:200 chick anti-mouse Alexa 488 (Invitrogen), 1:200 Avidin-488 (Invitrogen). β-Galactosidase (β-Gal) immunofluorescence was performed with1:100 anti-β-Gal (Capel) staining amplified by tyramide signal amplification (TSA, PerkinElmer) according to the manufacturer’s protocol. TUNEL staining was performed using the Apoptag Peroxidase in situ kit (Millipore) according to the manufacturer’s protocol.
X-GAL staining.
Sections were prepared and stained as described (1).
Immunoblot.
Analysis was performed as described (2). Primary antibody concentrations were 1:5,000 pJNK (Cell Signaling Technolgy), 1:10,000 dpERK (Sigma), 1:5,000 pp38 (Cell Signaling Technology), and 1:5,000 β-tubulin (Santa Cruz Biotechnology).
Silver Gel.
Five microliters of a 1:10 dilution of freshly collected urine was run on a 15% SDS-PAGE gel. Silver staining was carried out using the SilverXpress kit (Invitrogen) according to the manufacturer’s protocol. Relative intensities of signal in the 65- to 75-kDa range between lanes was determined using the gel quantification function in ImageJ; the intensities of signals in samples from wild types were averaged and used to determine the fold change in samples from the mutants (25).
Hematology.
Blood analysis was carried out on freshly collected heparinized blood with a Procyte Analyzer.
Quantitative real-time PCR analysis.
cDNA was synthesized with qScrip cDNA SuperMix (Quanta BioSciences), and qRT-PCR reactions (three technical replicates) were run using iQ SYBR Green SuperMix (Bio-Rad). All changes were normalized to β-actin: Map3k7 F, AGATCGACTACAAGGAGATCGAG; Map3k7 R, TGCACGCACATTATACAATGAGCC; Pdgfrβ F, GTGGTCCTTACCGTCATCTCTC; and Pdgfrβ R, GTGGAGTCGTAAGGCAACTGCA.
Quantitative analysis of fluorescence.
Images (.tif) were cropped and analyzed by color threshold for area and intensity using ImageJ. Values were normalized to glomerular size.
Scoring of histological features.
Total glomeruli, trichrome-positive glomeruli, and aneurysmic glomeruli were counted in transverse sections from the center of each kidney of wild-type and mutant mice, and the percentage of glomeruli with each feature was calculated.
RESULTS AND DISCUSSION
Expression of Map3k7 and Cre recombination by Foxd1+/cre.
MAP3K7 is expressed in mesangial cells and is a key component of the MAPK response elicited by TGFβ in these cells (16). Foxd1 is expressed in the nephrogenic zone interstitial cells of the developing kidney. These cells are the progenitors of mature interstitial cells, pericytes, vascular smooth muscle cells, and mesangial cells of the mature kidney (11, 18). Partial recombination in podocytes has also been reported using the Foxd1+/cre strain (3, 18).
To evaluate MAP3K7 function in the Foxd1 lineage, we crossed Foxd1+/cre;Map3k7+/c to Map3k7c/c mice. Foxd1+/cre;Map3k7c/c (mutant) animals were born at the expected Mendelian ratio, did not display any overt malformations, and were grossly indistinguishable from wild-type (Foxd1+/+;Map3k7c/c) littermates at P0. To determine the frequency of cre-mediated inactivation of Map3k7, we conducted single cell genotyping on Foxd1-expressing cortical interstitial cells isolated from wild-type and mutant littermates. Briefly, cells of the nephrogenic zones of E17.5 kidneys were liberated by partial enzymatic digestion as previously described (2). Multiple individuals from five litters were batched to yield a sufficient number of cells for the enrichment procedure. PDGFRα-expressing cortical interstitial cells were enriched to over 95% by magnetic separation (4). Single cells from this population were picked, their DNA was subjected to unbiased whole genome amplification, and this genomic DNA was subjected to genotyping for cre and recombination at the Map3k7 locus. We found that 6% of cortical interstitial cells were unrecombined, while 22% had a single copy of Map3k7 recombined, and 72% had both copies of Map3k7 recombined. Because Foxd1cre is actively expressed in PDGFRα-expressing cells, they may be undergoing active recombination leading to underrepresentation of Map3k7-null cells. In conclusion, recombination yields close to 75% completely null cells in the Foxd1 lineage, providing a robust basis for loss-of-function analysis.
Inactivation of Map3k7 in the Foxd1 lineage causes kidney scarring.
Animals of mutant and wild-type genotypes were represented at approximately Mendelian ratios; 64 wild-type and 29 mutant animals were observed and harvested at a series of time points from birth to 6 wk of age, as shown in Fig. 1A. Size differences between mutant and wild-type littermates were apparent in the first week after birth. Mutant mice were divided into two groups: long-term survivors (LTS) gained weight at approximately the same rate as wild-type controls yet remained significantly smaller; short-term survivors (STS) died within the first 28 days after birth.
Fig. 1.
Characterization of mutant mice. A: postnatal growth curve of wild type (WT), long-term survivor (LTS), and short-term survivor (STS) mutants. B–F: Masson’s trichrome staining of WT and mutant kidneys. B: representative histology of WT kidney at 6 wk. C: representative histology of mutant kidney at 6 wk. Boxed region is shown in D. Black arrow indicates subcapsular scarring; yellow arrow indicates glomerular scarring. E: representative glomerulus from WT. F: representative glomerulus from mutant. G: percentage of trichrome-positive glomeruli within each transverse sections of 3 WT and 9 mutant animals was scored at 6 wk of age. H: ratio of kidney weight to body weight (KW:BW) of WT and mutants at 3 and 6 wk of age. I: examples of WT, mild, and strong mutant phenotypes from representative sections of kidneys from 3-wk-old animals. Arrowheads indicate trichrome-positive capsule thickening; arrows indicate trichrome-positive glomeruli. Asterisks indicate glomeruli with mildly elevated trichrome staining. Scale bars, 50µm.
At 6 wk of age, mutants displayed spontaneous scarring. Figure 1, B–F, shows representative histology from five wild-type and nine mutant animals analyzed by trichrome staining at this age. With the exception of one outlier that showed no phenotype, trichrome staining revealed collagen deposition consistently in mutants. Characteristically, collagen deposition was seen in the subcapsular region and in the glomerular mesangium. Little variability was seen between glomeruli within any single mutant, and all appeared collagen laden with the exception of one mutant. In wild-type animals, less than 15% of glomeruli displayed trichrome staining, whereas 90–100% of glomeruli in the majority of mutants showed trichrome staining (Fig. 1G). Involvement of the tubular interstitium was, however, sporadic and focal, generally localizing to regions contiguous with the subcapsular region. Analysis of CD31 staining did not reveal overt differences in the capillary network surrounding tubules between wild types and mutants (data not shown). Thus, inactivation of Map3k7 in the Foxd1 lineage results in scarring of the kidney with two characteristic patterns of collagen accumulation: under the kidney capsule and in the glomerular mesangium. In comparison, inactivation of Map3k7 in podocytes, using the Nphs2-cre deleter, resulted in a much more severe phenotype, with ~90% of mice dying within the first week after birth and obvious glomerular vascular malformations at birth (17). Comparison of the ratio of kidney weight to body weight between wild types and mutants at 3 and 6 wk of age showed that there was more phenotypic variability at 3 wk of age than at 6 and suggests that the animals that survive to 6 wk of age are a subset with a less severe phenotype (Fig. 1H). Histological evaluation revealed variability of the phenotype at 3 wk, with some animals showing subcapsular collagen accumulation and modest collagen accumulation in glomeruli, and others showing both subcapsular collagen accumulation and severe collagen accumulation in glomeruli (Fig. 1I).
To better describe events that initiate the scarring process in the mutant, we focused on defining the earliest stage at which kidney damage could be seen. Histological analyses revealed two characteristic pathologies in the first week after birth. This stage precedes expression of Foxd1 in podocytes, allowing us to observe effects primarily in the stromal lineage. First, the subcapsular regions of mutant kidneys were disorganized and highly cellular at P7, with islands of epithelial structures resembling developing nephrons. These nephrogenic structures were not seen in any of the wild-type sections. Representative sections from six wild types and six mutants are shown in Figs. 2, A–C. These structural abnormalities at the outer edge of the cortex in the neonate precede subcapsular scarring in the adult kidney. Second, trichrome staining showed that glomeruli of P7 mutants exhibited collagen accumulation within the mesangium (Fig. 2, D and E). Between 40 and 70% of glomeruli in mutants showed trichrome staining compared with 10–15% in wild types (Fig. 2F). Thus, the glomerular collagen deposition seen at 3 and 6 wk was evident already in the neonatal period. Furthermore, a subset of glomeruli in mutants displayed an aneurysmic phenotype, which was not seen in wild types (Fig. 2, G–I). Quantification of nuclei in wild-type and mutant glomeruli indicated that scarring was not associated with increased numbers of mesangial cells (Fig. 2J). To understand the functional significance of the scarring, we measured blood urea nitrogen at 6 wk. Of six mutants analyzed, all were within reference values (data not shown). However, measurement of protein in urine by PAGE analysis with subsequent silver staining showed elevated protein in the 65- to 75-kDa range that included murine serum albumin in two of six mutants measured at P7 and in three of four measured at 6 wk of age (Fig. 2K). Thus, the kidneys appeared to maintain their capacity to excrete urea but showed signs of protein leakage.
Fig. 2.
Mutant kidneys display spontaneous glomerular scarring and cortical expansion in the first postnatal week. A and B: representative hematoxylin-eosin (H&E) staining of postnatal day 7 (P7) wild-type (WT) and mutant (Mut) kidneys. White arrows indicate compact subcapsular area containing nephrogenic structures. C: examples of nephrogenic structures found under the expanded capsule in 4 different mutant kidneys. These structures are not found in the WT. D and E: Masson’s trichrome staining of P7 WT and mutant kidneys. F: percentage of trichrome-positive glomeruli was scored in transverse sections of both kidneys from 2 WT and 5 mutant animals. G and H: examples of aneurysmic glomeruli found in mutants. I: percentage of glomeruli displaying aneurysmic phenotype was scored in transverse sections of both kidneys from 2 WT and 5 mutant animals. J: graph depicting DAPI+ area of P0–P7 WT and mutant glomeruli. *P < 0.05. K: silver-stained urinary proteins from WT and mutant P7 and 6-wk animals; 50- and 80-kDa molecular markers are depicted in the middle of the gel. Fold difference in intensity in the 65- to 75-kDa range in mutants relative to the average of the WT is shown at the bottom of each lane. L–O: hematological analysis of WT (blue) and mutant (orange) mice at P7 (left) and 6 wk (right). L: red blood cells (RBC). M: hematocrit (HCT). N: hemoglobin. O: mean corpuscular hemoglobin concentration (MCHC). Scale bars, 50 µm.
Because the Foxd1 lineage includes the erythropoietin-expressing cells of the kidney interstitium, we were interested in determining whether mutants showed signs of diminished red blood cell production. Blood samples from four wild-type and four mutant animals were analyzed at P7 and at 6 wk of age (Fig. 2, L–O). Whereas red blood cell count, hematocrit, and total hemoglobin were comparable between mutants and wild types at P7, these values were modestly reduced in mutants at 6 wk, consistent with mild anemia. Because blood values are within the normal range in the neonate we conclude that circulating red blood cells are reduced as a consequence of the progressive scarring seen in the mutant kidney.
Gross anatomic dissection indicated that scarring was restricted to the kidneys of mutants. To determine whether there was any evidence of scarring in other organ systems, trichrome staining of heart, lung, liver, small intestine, and large intestine was compared between six wild-type and six mutant individuals at 6 wk of age (data not shown). Collagen deposition was comparable between wild types and mutants for each organ system, and we concluded that scarring was indeed restricted to the kidney.
Subcapsular thickening in the neonate is associated with accumulation of macrophages around residual developing nephron structures.
In the wild-type mouse, replenishment of embryonic nephron progenitor cells ceases by approximately P2, and PAX8-expressing renal vesicles undergo differentiation to nephrons by P6 (9, 23). This final round of nephron differentiation known as cessation of nephrogenesis results in replacement of the fetal subcapsular nephrogenic zone with differentiated lotus lectin-expressing nephron tubules by P7 (Fig. 3A). In contrast, we found that the subcapsular region of all five P7 mutant kidneys analyzed was disorganized, and in kidneys from three of five mutants we identified foci of nascent nephrons with typical S-shaped morphologies that expressed PAX8 (Fig. 3, B and C). Marker analysis revealed F4/80+ presumptive macrophages scattered sparsely throughout wild-type kidneys (Fig. 3D), but foci of cells were found in the mutants surrounding the pericapsular nephrogenic rests (Fig. 3, E and F). TUNEL staining was rare in wild-type kidneys (Fig. 3G), whereas clusters of dead cells were seen in the foci of nephrogenic structures and presumptive macrophages in mutants, suggesting that the F4/80+ infiltrates consisted of phagocytic macrophages (Fig. 3, H and I). Kidney macrophages arise both from tissue progenitor cells that are deposited during the embryonic period and from bone marrow-derived monocytes (20, 26). To determine whether the pericapsular macrophage accumulation in mutant kidneys derived from Foxd1-expressing cells, we costained for β-Gal and F4/80 in kidneys from Foxd1+/cre;Map3k7c/c;R26RLacZ animals (Fig. 3, J–L). Only a small subset of pericapsular macrophages displayed colocalization, and the pericapsular thickening therefore does not represent an accumulation of Foxd1-derived F4/80+ cells. Interestingly, a small fraction of F4/80+ cells in the cortex of the wild-type kidney displayed colocalization, indicating there is normally a minor contribution of tissue macrophages from the Foxd1 lineage (Fig. 3M). In summary, delayed cessation of nephrogenesis in the mutant neonate (Fig. 3, B and C) was associated with elevated cell death (Fig. 3, H and I). Macrophage infiltration can be seen in this region (Fig. 3, E and F), and by 6 wk of age the pericapsular region had formed a scar (Fig. 1, C and D). We could not find any precedent in the literature for this unexpected phenotype, which resembled the nephrogenic rest formation that is seen in Denys Drash syndrome (5, 7). However, in contrast to the nephrogenic rests that precede development of Wilms’ tumor formation in this syndrome, the subcapsular structures seen in Foxd1+/cre;Map3k7loxp/loxp kidneys do not stain for markers of cap mesenchyme such as SIX2 and CITED1 (data not shown), and their expression of PAX8 indicates that they represent a later stage of differentiation.
Fig. 3.
Cortical expansion in mutant kidneys consists of nephrogenic structures and infiltrating macrophages. A–C: PAX8 (red) and lotus lectin (green) immunofluorescence in P7 WT and mutant (Mut) kidney sections. Arrows denote retained nephrogenic structures. Dotted line marks location of the capsule. D–F: F4/80 immunohistochemistry in P7 WT and mutant kidneys. Arrowheads indicate sparsely distributed macrophages in WT. Arrows denote collections of macrophages surrounding nephrogenic structures. G–I: TUNEL staining in WT and mutant kidney sections. Arrowheads indicate rare TUNEL-stained cells in WT. Arrows point to apoptotic cells near nephrogenic structures. J–L: β-Galactosidase (β-Gal; red) and F4/80 (green) coimmunofluorescence in expanded cortex of mutant kidneys. Arrows denote colabeled cells. M: graph depicting numbers of F4/80+, β-Gal+, or F4/80+:β-Gal+ cells per ×63 field of cortical (Cort) and medullary (Med) regions of WT and mutant kidney sections. Scale bars, 50 µm.
Collagen IV accumulates in the mesangium of mutants.
Trichrome staining clearly indicated collagen deposition in the mesangium of the mutant glomerulus, and to better understand the basis for this, we compared expression of collagens I and IV in mutant and wild-type kidneys at P0, P3, P7, and 6 wk of age. Both kidneys from three individuals of each genotype were analyzed, and representative data are show in Fig. 4. Comparison of kidneys at P3 did not reveal any difference in trichrome staining between wild types and mutants (data not shown), and we conclude that the onset of the phenotype occurs between P3 and P7, at which time trichrome staining can clearly be seen in 40–70% of mutant kidneys (Fig. 2F). Collagen I, a known downstream target of MAP3K7 in mesangial cells, was expressed similarly in wild-type and mutant glomeruli (Fig. 4, A–I), and we conclude that trichrome staining is not due to accumulation of collagen I. In the wild type, there is a reduction of collagen IV in the glomerulus as it matures from P0 to 6 wk (Fig. 4, J–M). In the mutant, however, mesangial collagen IV accumulation increased postnatally, providing an explanation for the strong trichrome staining (Fig. 4, N–R). Isoform switching of collagens occurs in the neonatal period, and perturbations in this process underlie Alport syndrome (15). To determine whether extracellular matrix maturation might be perturbed in mutants, we compared localization of α1 (immature) and α5 (mature) isoforms of collagen IV. At P7, collagen IVα1 was retained in the mutant mesangium, similar to wild type, and collagen IVα5 was produced, indicating appropriate isoform maturation (data not shown). From this analysis, we conclude that trichrome staining in glomeruli of mutant kidneys associates with accumulation of collagen IV, most likely in its mature form.
Fig. 4.
Elevated collagen IV in mutant glomeruli. Representative glomeruli from 3 biological replicates per stage are shown. A–H: collagen I (red) immunofluorescence in WT and mutant glomeruli at P0 to 6 wk of age. I: quantification of fluorescence signal in 20 glomeruli per genotype and stage; fluorescence intensity is expressed as fold change relative to P0 WT. J–Q: collagen IV (red) immunofluorescence in WT and mutant glomeruli at P0 to 6 wk of age. R: quantification of fluorescence signal in 20 glomeruli per genotype and stage; fluorescence intensity is expressed as fold change relative to P0 WT. Scale bars, 50 µm.
MAPK signaling is perturbed in mutant glomeruli.
Next, we wanted to understand if misregulated MAP3K7 signaling correlated with the alteration of the mesangial phenotype seen in the mutant. MAP3K7 activates p38 and JNK downstream of TGFβ1 (27); we therefore compared activation of these pathways in wild-type and mutant glomeruli at P0, before the onset of pathological change, and at P3, the earliest time point at which glomerular pathology was seen (Fig. 5). In wild-type glomeruli, the abundance of pp38 increased slightly from P0 to P3 (Fig. 5, A and B). Mutant glomeruli exhibited less pp38 than those of wild type at both P0 and P3 (Fig. 5, C and D), indicating loss of signaling in the absence of Map3k7. pJNK activation decreased in wild type between P0 and P3 (Fig. 5, E and F). In contrast, mutant glomeruli displayed significantly higher pJNK at P3 compared with P0 (Fig. 5, G and H). Thus, compared with wild types, mutants displayed depressed p38 but elevated JNK activation coinciding with the onset of mesangial scarring at P3. Our analysis indicates that MAP3K7 balances the distinct MAPK signaling pathways in the mesangium of the juvenile glomerulus.
Fig. 5:
Transforming growth factor-β (TGFβ)-associated kinase-1 (MAP3K7) balances mitogen-activated protein kinase (MAPK) signaling in juvenile mesangium. A–H: immunofluorescent staining for activated p38 (pp38) and c-Jun NH2-terminal kinase (pJNK) in WT and mutant kidneys. Representative glomeruli from 3 individuals at each stage are shown. I: quantitative analysis of phosphoprotein-stained glomeruli at P0 and P3. Scale bars, 50 µm. *P < 0.05, **P < 0.005).
Map3k7 is required for postnatal maintenance of PDGFRβ in mesangial cells.
Molecular marker analysis was performed to define glomerular changes associated with scarring. Podocyte-specific Wilms’ tumor 1 (WT1) and synaptopodin staining revealed comparable staining in wild-type and mutant glomeruli at P3, indicating that podocytes were intact (data not shown). However, a proportion of mutant glomeruli exhibited an aneurysmic phenotype, evident already at P7 (Fig. 2, G–I). Glomerular capillary convolution depends on interaction with the mesangium (32), and we were therefore interested in defining the differentiation state of the mutant mesangium. We hypothesized that cellular changes before P7 underlie scarring and therefore included the P3 time point in our analysis. Mesangial cells of mutant kidneys exhibited a reactive phenotype with increased α-smooth muscle actin expression compared with wild type at P3 (Fig. 6, A–F). Interestingly, the mesangial cell marker PDGFRβ was lost in mutant glomeruli with elevated α-smooth muscle activation (Fig. 6, A and D). To understand if this represented a loss of mesangial identity or a specific loss of PDGFRβ, we costained for PDGFRβ and the independent marker desmin. Although PDGFRβ was almost completely lost in mutant mesangial cells at P3, desmin expression was maintained, suggesting that mesangial cells retained their identity but lost expression of PDGFRβ (Fig. 6, G–L). Pdgfrß inactivation prevents mesangial cell differentiation, resulting in severely disturbed glomerulogenesis (21). However, P0 glomerular endowment in the mutant resembled that of wild type, suggesting that the loss of mesangial PDGFRβ expression occurred after embryonic glomerulogenesis. We therefore compared PDGFRβ expression at P0, P3, and P7. PDGFRβ expressions in mutant and wild-type glomeruli were comparable at P0 (Fig. 6, M and N). However, expression was severely attenuated in the mutant by P3 and reduced further by P7 (Fig. 6, O–R). Quantification of fluorescence area in three sections from each kidney from three mutants and three wild types at each time point revealed slightly diminished PDGFRβ expression already at P0, which declined to ~50% of wild type by P3 and ~20% by P7 (Fig. 6S). From this analysis, we conclude that Map3k7 maintains postnatal PDGFRβ expression. To determine whether this regulation might be at the transcriptional level, we measured Pdgfrß transcript levels using qRT-PCR in isolated wild-type and mutant glomeruli and correlated expression with Map3k7 in seven mutants and 10 wild types at P7 (Fig. 6T). We found a direct correlation between Map3k7 and Pdgfrß in both wild types and mutants, suggesting that Map3k7 is required for the maintenance of Pdgfrß transcription in the glomerular mesangium. To understand if there might be a causal connection between the misregulation of JNK signaling in mutants at P3 and the loss of Pdgfrß expression, we evaluated the effect of inhibiting or promoting JNK activation in primary mouse mesangial cells (Fig. 6U). We found that JNK inhibitor treatment elevated Pdgfrß expression 3.45-fold, whereas treatment with the JNK activator anisomycin A reduced expression to approximately one-half. The effect of anisomycin A was reversed by JNK inhibition but was unaffected by p38 inhibition, demonstrating JNK pathway specificity. Thus, JNK controls Pdgfrß expression in mesangial cells, and elevated JNK signaling in P3 mutant mesangium suppresses Pdgfrß.
Fig. 6.
Transforming growth factor-β (TGFβ)-associated kinase-1 (MAP3K7) is required for postnatal platelet-derived growth factor recpetor-β (PDGFRβ) expression. A–F: α-smooth muscle actin (αSMA; green) and PDGFRβ (red) expression in WT and mutant P7 glomeruli. G–L: desmin (green) and PDGFRβ (red) expression in WT and mutant P3 glomeruli. M–R: PDGFRβ (red) expression in WT and mutant P0–P7 glomeruli. S: quantitative analysis of PDGFRβ immunofluorescence in WT and mutant P0–P7 glomeruli. T: graph depicting correlation between Pdgfrβ and Map3k7 expression levels in WT and mutant individuals. Data points represent qRT-PCR measurements of Pdgfrβ and Map3k7 transcripts normalized to β-actin housekeeping gene. Each point represents one individual. U: qRT-PCR of Pdgfrβ levels in response to c-Jun NH2-terminal kinase inhibitor (JNKi), p38 inhibitor (p38i), and/or anisomycin A (AnisA). Bars represent fold change relative to 2% bovine growth serum (BGS) control. Scale bars, 50 µm. *P < 0.05.
The relationship between Map3k7 and Pdfgrß is unexpected on two different levels. First, MAP3K7 is known as an activator of JNK (27), and the elevation of JNK in the mutant mesangium is surprising. However, the kinases that directly activate JNK are MAP2K4 (6) and MAP2K7 (31), which are activated by multiple kinases including MAP3K7. Thus, JNK could be elevated by increased activation of another kinase at the MAP3K level, perhaps a cellular stress responder such as ASK1 (MAP3K5) (13). Second, the suppression of Pdgfrß expression by JNK is unexpected. Review of the literature indicates that this relationship may be novel, but a similar relationship exists between PDGFRα and MAPK in pulmonary myofibroblasts. PDGFRα is activated by IL-1β signaling in these cells, and inhibition of p38 MAPK strongly augments PDGFRα expression in response to IL-1β stimulation (33).
We propose, on the basis of our studies, that embryonic and neonatal regulations of PDGFRβ expression differ mechanistically. MAP3K7 plays an active role in this mechanism only after birth, balancing MAPK activation in the mesangial cell and suppressing JNK, which in turn allows expression of PDGFRβ. Loss of PDGFRβ expression is the earliest difference that we see between mutant and wild type, and our working hypothesis is that the loss of PDGFRβ signaling in the mesangial cell initiates scarring. Further inquiry using genetic models carrying mutations in kinases associated with MAP3K7 will aim to define the molecular mechanisms by which PDGFRβ expression is regulated in the differentiating and maturing mesangium.
GRANTS
This work was supported by the National Institutes of Diabetes and Digestive and Kidney Disease (NIDDK) Grant R01 DK-078161 (L. Oxburgh). Additional support was provided by a predoctoral fellowship from the American Heart Association (J. A. Guay). Core facilities support was provided by Maine Medical Center Research Institute core facilities for Molecular Phenotyping (supported by National Institutes of General Medicine (NIGM) P30 GM-106391), Histopathology (NIGM P30 GM-106391, P20 GM-121301, P20 GM-103392), and the Mouse Transgenic and In Vivo Core (NIGM P30 GM-103392), and by the Hematology Core of The Jackson Laboratory.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
M.J.K., J.A.G., and L.O. conceived and designed research; M.J.K., J.A.G., and L.O. performed experiments; M.J.K., J.A.G., and L.O. analyzed data; M.J.K., J.A.G., and L.O. interpreted results of experiments; M.J.K., J.A.G., and L.O. prepared figures; M.J.K., J.A.G., and L.O. edited and revised manuscript; M.J.K., J.A.G., and L.O. approved final version of manuscript; J.A.G. and L.O. drafted manuscript.
ACKNOWLEDGMENTS
We thank Profs. Michael Schneider and Laurie Glimcher for providing the Map3k7 conditional strain.
REFERENCES
- 1.Adams D, Karolak M, Robertson E, Oxburgh L. Control of kidney, eye and limb expression of Bmp7 by an enhancer element highly conserved between species. Dev Biol 311: 679–690, 2007. doi: 10.1016/j.ydbio.2007.08.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Blank U, Brown A, Adams DC, Karolak MJ, Oxburgh L. BMP7 promotes proliferation of nephron progenitor cells via a JNK-dependent mechanism. Development 136: 3557–3566, 2009. doi: 10.1242/dev.036335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Boyle SC, Liu Z, Kopan R. Notch signaling is required for the formation of mesangial cells from a stromal mesenchyme precursor during kidney development. Development 141: 346–354, 2014. doi: 10.1242/dev.100271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Brown AC, Muthukrishnan SD, Guay JA, Adams DC, Schafer DA, Fetting JL, Oxburgh L. Role for compartmentalization in nephron progenitor differentiation. Proc Natl Acad Sci USA 110: 4640–4645, 2013. doi: 10.1073/pnas.1213971110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Denys P, Malvaux P, Van Den Berghe H, Tanghe W, Proesmans W. [Association of an anatomo-pathological syndrome of male pseudohermaphroditism, Wilms’ tumor, parenchymatous nephropathy and XX/XY mosaicism]. Arch Fr Pediatr 24: 729–739, 1967. [PubMed] [Google Scholar]
- 6.Dérijard B, Raingeaud J, Barrett T, Wu IH, Han J, Ulevitch RJ, Davis RJ. Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. Science 267: 682–685, 1995. doi: 10.1126/science.7839144. [DOI] [PubMed] [Google Scholar]
- 7.Drash A, Sherman F, Hartmann WH, Blizzard RM. A syndrome of pseudohermaphroditism, Wilms’ tumor, hypertension, and degenerative renal disease. J Pediatr 76: 585–593, 1970. doi: 10.1016/S0022-3476(70)80409-7. [DOI] [PubMed] [Google Scholar]
- 8.Grimwood L, Masterson R. Propagation and culture of renal fibroblasts. Methods Mol Biol 466: 25–37, 2009. doi: 10.1007/978-1-59745-352-3_3. [DOI] [PubMed] [Google Scholar]
- 9.Hartman HA, Lai HL, Patterson LT. Cessation of renal morphogenesis in mice. Dev Biol 310: 379–387, 2007. doi: 10.1016/j.ydbio.2007.08.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Humphreys BD, Valerius MT, Kobayashi A, Mugford JW, Soeung S, Duffield JS, McMahon AP, Bonventre JV. Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell 2: 284–291, 2008. doi: 10.1016/j.stem.2008.01.014. [DOI] [PubMed] [Google Scholar]
- 11.Humphreys BD, Lin SL, Kobayashi A, Hudson TE, Nowlin BT, Bonventre JV, Valerius MT, McMahon AP, Duffield JS. Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. Am J Pathol 176: 85–97, 2010. doi: 10.2353/ajpath.2010.090517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Huse M, Muir TW, Xu L, Chen YG, Kuriyan J, Massagué J. The TGF beta receptor activation process: an inhibitor- to substrate-binding switch. Mol Cell 8: 671–682, 2001. doi: 10.1016/S1097-2765(01)00332-X. [DOI] [PubMed] [Google Scholar]
- 13.Ichijo H, Nishida E, Irie K, ten Dijke P, Saitoh M, Moriguchi T, Takagi M, Matsumoto K, Miyazono K, Gotoh Y. Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways. Science 275: 90–94, 1997. doi: 10.1126/science.275.5296.90. [DOI] [PubMed] [Google Scholar]
- 14.Isaka Y, Fujiwara Y, Ueda N, Kaneda Y, Kamada T, Imai E. Glomerulosclerosis induced by in vivo transfection of transforming growth factor-beta or platelet-derived growth factor gene into the rat kidney. J Clin Invest 92: 2597–2601, 1993. doi: 10.1172/JCI116874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kalluri R, Shield CF, Todd P, Hudson BG, Neilson EG. Isoform switching of type IV collagen is developmentally arrested in X-linked Alport syndrome leading to increased susceptibility of renal basement membranes to endoproteolysis. J Clin Invest 99: 2470–2478, 1997. doi: 10.1172/JCI119431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kim SI, Kwak JH, Zachariah M, He Y, Wang L, Choi ME. TGF-beta-activated kinase 1 and TAK1-binding protein 1 cooperate to mediate TGF-beta1-induced MKK3-p38 MAPK activation and stimulation of type I collagen. Am J Physiol Renal Physiol 292: F1471–F1478, 2007. doi: 10.1152/ajprenal.00485.2006. [DOI] [PubMed] [Google Scholar]
- 17.Kim SI, Lee SY, Wang Z, Ding Y, Haque N, Zhang J, Zhou J, Choi ME. TGF-β-activated kinase 1 is crucial in podocyte differentiation and glomerular capillary formation. J Am Soc Nephrol 25: 1966–1978, 2014. doi: 10.1681/ASN.2013030252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kobayashi A, Mugford JW, Krautzberger AM, Naiman N, Liao J, McMahon AP. Identification of a multipotent self-renewing stromal progenitor population during mammalian kidney organogenesis. Stem Cell Reports 3: 650–662, 2014. doi: 10.1016/j.stemcr.2014.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kopp JB, Factor VM, Mozes M, Nagy P, Sanderson N, Böttinger EP, Klotman PE, Thorgeirsson SS. Transgenic mice with increased plasma levels of TGF-beta 1 develop progressive renal disease. Lab Invest 74: 991–1003, 1996. [PubMed] [Google Scholar]
- 20.Lichanska AM, Browne CM, Henkel GW, Murphy KM, Ostrowski MC, McKercher SR, Maki RA, Hume DA. Differentiation of the mononuclear phagocyte system during mouse embryogenesis: the role of transcription factor PU.1. Blood 94: 127–138, 1999. [PubMed] [Google Scholar]
- 21.Lindahl P, Hellström M, Kalén M, Karlsson L, Pekny M, Pekna M, Soriano P, Betsholtz C. Paracrine PDGF-B/PDGF-Rbeta signaling controls mesangial cell development in kidney glomeruli. Development 125: 3313–3322, 1998. [DOI] [PubMed] [Google Scholar]
- 22.Ma FY, Tesch GH, Ozols E, Xie M, Schneider MD, Nikolic-Paterson DJ. TGF-β1-activated kinase-1 regulates inflammation and fibrosis in the obstructed kidney. Am J Physiol Renal Physiol 300: F1410–F1421, 2011. doi: 10.1152/ajprenal.00018.2011. [DOI] [PubMed] [Google Scholar]
- 23.Rumballe BA, Georgas KM, Combes AN, Ju AL, Gilbert T, Little MH. Nephron formation adopts a novel spatial topology at cessation of nephrogenesis. Dev Biol 360: 110–122, 2011. doi: 10.1016/j.ydbio.2011.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sato M, Muragaki Y, Saika S, Roberts AB, Ooshima A. Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. J Clin Invest 112: 1486–1494, 2003. doi: 10.1172/JCI200319270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671–675, 2012. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Schulz C, Perdiguero EG, Chorro L, Szabo-Rogers H, Cagnard N, Kierdorf K, Prinz M, Wu B, Jacobsen SE, Pollard JW, Frampton J, Liu KJ, Geissmann F. A lineage of myeloid cells independent of Myb and hematopoietic stem cells. Science 336: 86–90, 2012. doi: 10.1126/science.1219179. [DOI] [PubMed] [Google Scholar]
- 27.Shim JH, Xiao C, Paschal AE, Bailey ST, Rao P, Hayden MS, Lee KY, Bussey C, Steckel M, Tanaka N, Yamada G, Akira S, Matsumoto K, Ghosh S. TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev 19: 2668–2681, 2005. doi: 10.1101/gad.1360605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21: 70–71, 1999. doi: 10.1038/5007. [DOI] [PubMed] [Google Scholar]
- 29.Sorrentino A, Thakur N, Grimsby S, Marcusson A, von Bulow V, Schuster N, Zhang S, Heldin CH, Landström M. The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nat Cell Biol 10: 1199–1207, 2008. doi: 10.1038/ncb1780. [DOI] [PubMed] [Google Scholar]
- 30.Takemoto M, Asker N, Gerhardt H, Lundkvist A, Johansson BR, Saito Y, Betsholtz C. A new method for large scale isolation of kidney glomeruli from mice. Am J Pathol 161: 799–805, 2002. doi: 10.1016/S0002-9440(10)64239-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Tournier C, Whitmarsh AJ, Cavanagh J, Barrett T, Davis RJ. Mitogen-activated protein kinase kinase 7 is an activator of the c-Jun NH2-terminal kinase. Proc Natl Acad Sci USA 94: 7337–7342, 1997. doi: 10.1073/pnas.94.14.7337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Vaughan MR, Quaggin SE. How do mesangial and endothelial cells form the glomerular tuft? J Am Soc Nephrol 19: 24–33, 2008. doi: 10.1681/ASN.2007040471. [DOI] [PubMed] [Google Scholar]
- 33.Wang YZ, Zhang P, Rice AB, Bonner JC. Regulation of interleukin-1beta -induced platelet-derived growth factor receptor-alpha expression in rat pulmonary myofibroblasts by p38 mitogen-activated protein kinase. J Biol Chem 275: 22550–22557, 2000. doi: 10.1074/jbc.M909785199. [DOI] [PubMed] [Google Scholar]
- 34.Xie M, Zhang D, Dyck JR, Li Y, Zhang H, Morishima M, Mann DL, Taffet GE, Baldini A, Khoury DS, Schneider MD. A pivotal role for endogenous TGF-beta-activated kinase-1 in the LKB1/AMP-activated protein kinase energy-sensor pathway. Proc Natl Acad Sci USA 103: 17378–17383, 2006. doi: 10.1073/pnas.0604708103. [DOI] [PMC free article] [PubMed] [Google Scholar]






