Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Sep 1.
Published in final edited form as: Int J Toxicol. 2018 Aug 22;37(5):383–392. doi: 10.1177/1091581818790934

Paradoxical Protective Effect of Perfluorooctanesulfonic Acid Against High Fat Diet Induced Hepatic Steatosis in Mice

Ian Huck 1, Kevin Beggs 1, Udayan Apte 1
PMCID: PMC6150807  NIHMSID: NIHMS979935  PMID: 30134762

Abstract

Perfluorooctanesulfonic acid (PFOS) is a persistent organic pollutant (POP) with worldwide bioaccumulation due to a very long half-life. PFOS exposure results in significant hepatic effects including steatosis, proliferation, hepatomegaly and in rodents, carcinogenesis. The objective of this study was to determine if PFOS exposure exacerbates nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) pathogenesis. Eight-week-old male C57BL/6J mice (n=5 per group) were fed ad libitum either normal chow diet (ND) alone, 60% high fat diet (HFD) alone, ND+PFOS and HFD+PFOS (0.0001% w/w (1mg/kg) of PFOS) for 6 weeks. Both HFD alone and the ND+PFOS treatment induced significant adiposity and hepatomegaly, but the HFD+PFOS treatment showed a marked protection. Oil Red O staining and quantitative analysis of hepatic lipid content revealed increased hepatic steatosis in ND+PFOS and in HFD alone fed mice, which was prevented in HFD+PFOS treatment. Further studies revealed that ND+PFOS treatment significantly affected expression of lipid trafficking genes to favor steatosis but these changes were absent in HFD+PFOS group. Specifically, expression of CD36, the major lipid importer in the cells, and PPARγ, its major regulator, were induced in HFD+NT and ND+PFOS-fed mice but remained unchanged in HFD+PFOS mice. In conclusion, these data indicate that co-administration of PFOS with HFD mitigates steatosis and hepatomegaly induced by HFD and that by PFOS fed in ND diet via regulation of cellular lipid import machinery. These findings suggest dietary lipid content be considered when performing risk management of PFOS in humans and the elucidation of PFOS induced hepatotoxicity.

Introduction

Perfluorooctane sulfonic acid (PFOS) belongs to a class of chemicals known as perfluoroalkyl acids. These hydrophobic and lipophobic compounds are used in a variety of household and industrial applications due to their thermally and chemically stable properties [1]. PFOS is present in 99.9% of human serum samples in the US with a geometric mean serum concentration of 20.7 μg/L [2]. PFOS can be found in human and wildlife worldwide [3] PFOS undergoes bioaccumulation in humans due to the long serum half-life of 4.7 years [4]. PFOS distributes primarily to the liver of rodent adults and fetuses exposed in utero [5] where it induces hepatic steatosis, hepatomegaly and hepatic carcinogenesis [6–8].

Non-alcoholic fatty liver disease (NAFLD) is currently the major hepatic disorder with over 25% prevalence in the general population and is worldwide including in the US [9]. Patients with NAFLD are at higher risk of progressing to more severe forms of liver disease such as NASH, fibrosis, cirrhosis ultimately resulting in HCC, which is the second most common cause of cancer related deaths [10, 11]. NAFLD is the primary hepatic manifestation of metabolic syndrome, which is constellation of symptoms including obesity, diabetes mellitus, and dyslipidemia [12]. Recently, Toxicant Associated Fatty Liver Disease (TAFLD) has been defined as the fatty liver disease associated with chemical exposure [13]. It is plausible that PFOS is a TAFLD causing agent given its ability to induce hepatic steatosis and ubiquitous presence in human serum samples with the potential for bioaccumulation.

In this study, we used an experimental model of NAFLD induced by high fat diet feeding to test the ability of human relevant PFOS exposures exacerbate the formation of fatty liver disease. Contrary to our hypothesis, we observed a protective effect against HFD-induced NAFLD when PFOS was co-administered with HFD. We examined expression of metabolic genes and regulators to investigate the potential mechanisms of protection. Our findings reveal diet dependent toxicity of PFOS and provide evidence for its hormetic effects on the development of hepatic steatosis.

Materials and Methods

Animal Care and Tissue Preparation

All animal studies were approved by and performed in accordance with the Institutional Animal Care and Use Committee (IACUC) at the University of Kansas Medical Center. Eight-week-old male C57BL/6J mice, purchased from Jackson Laboratories (Bar Harbor, ME), received ad libitum access to either normal chow diet (ND) (73% kcal carbohydrates, 11% kcal fat, 16% kcal protein) (Custom Animal Diets, AD2001)) or high-fat diet (HFD) (24.8% kcal carbohydrates, 59.2% kcal fat, 15% kcal protein) (Custom Animal Diets, AD2002) with and without 0.0001% (1 mg/kg) perfluorooctanesulfonic acid (PFOS) (Sigma Aldrich, St. Louis, MO) for six weeks. Mice from each treatment cohort (n=5) were group-housed in temperature controlled conditions (23° C) with a 10 hour dark/14 hour light cycle. The dosing strategy was selected by extrapolating the dose used in a previous report when mice fed a diet containing 0.001% PFOS resulted in PFOS serum concentrations of 102 μM [14]. Furthermore, a serum PFOS concentration of 11 μg/ml (~23 μM) was achieved by feeding 0.0001% PFOS containing diet for 28 days [15]. Thus, the dose used in this study was expected to achieve serum concentrations nearing 10 μM, which previously published literature review suggests is comparable to occupational levels of exposure [16]. To prepare the diet used in this study, PFOS was dissolved in water and thoroughly mixed into pre-weighed powdered ND or HFD to a final concentration of 1mg/kg (0.0001%). Diets were left to dry overnight, and pellets were formed the next day. Untreated powdered diets were also mixed with water and formed into pellets to ensure feeding consistency. Liver and adipose tissue was harvested, weighed and flash frozen in liquid nitrogen at time of euthanasia. Blood glucose was measured with a glucometer using blood collected via retroorbital sinus at time of euthanasia.

Histology and Immunohistochemistry

Paraffin sections from mouse livers were stained for hematoxylin and eosin (H&E) and observed under light microscope. Paraffin sections from mouse livers were stained for proliferating cell nuclear antigen (PCNA) as previously described [17]. Fresh frozen liver sections were used to determine hepatic lipid content by staining with Oil Red O as previously described [18].

Protein Isolation and Western Blot Analysis

Protein isolation and Western blot analysis was performed as previously described [16]. Primary antibody used to detect proliferating cell nuclear antigen (PCNA) was purchased from Cell Signaling Technology (Cat. #2586, Danvers, MA).

Hepatic Triglyceride Isolation and Quantification

Total hepatic triglycerides (TG) were isolated from frozen liver using KOH digestion protocol as previously described [19]. Quantification of isolated TGs was performed using the Triglyceride (GPO) Reagent Set (Pointe Scientific, Catalog #T7532-500) and calculated by comparison to a standard curve of known TG concentrations using the Triglyceride Standard Reagent (Pointe Scientific, Catalog #T7531-STD) according to manufacturer’s protocol. TG content measured in each sample was normalized by the weight of liver used for TG isolation.

Serum Lipid Quantification

Serum was prepared from centrifugation of fresh blood at 5,000 rpm for 10 minutes. Serum triglyceride was measured using the Triglyceride (GPO) Reagent Set (Pointe Scientific, Catalog #T7532-500) and calculated by comparison to a standard curve of known TG concentrations using the Triglcyeride Standard Reagent (Pointe Scientific, Catalog #T7531-STD) according to manufacturer’s protocol. Serum Cholesterol concentration was measured using the Cholesterol Reagent Set (Pointe Scientific, Catalog #C7510) and calculated by comparison to a standard curve of known cholesterol concentration using the Cholesterol Standard Reagenet (Pointe Scientific, Catalog #C7509-STD) according to manufacturer’s protocol.

Real Time PCR

RNA isolation, conversion to cDNA and real time PCR (RT-PCR) analysis was performed as previously described without modification[20]. Fold change in expression compared to control diet fed, untreated group was determined using the ddCt method[21] with 18s used as a housekeeping control gene. Primer sequences for genes of interest are provided in Table 1.

Table 1.

Primer sequences used in this study

Gene Forward Primer (5′–3′) Reverse Primer (5′–3′)
apoal TGTGTCCCAGTTTGAATCCTC GTTATCCCAGAAGTCCCGAG
apoa2 GACACCCCTTGTCAGGTCAG TGGCACATCTCACTTAGCCG
apob CTGCAACCAAGCTGGCATAAG CCTCCATCCTGAGTTGGACA
mttp CAAGCTCACGTACTCCACTGAAG TCATCATCACCATCAGGATTCCT
cd36 ATGGGCTGTGATCGGAACTG GTCTTCCCAATAAGCATGTCTCC
pepck TGCGGATCATGACTCGGATG AGGCCCAGTTGTTGACCAAA
g6pc CCGGTGTTTGAACGTCATCT CAATGCCTGACAAGACTCCA
pparg CCACAGTTGATTTCTCCAGCATTTC CAGGTTCTACTTTGATCGCACTTTG
ppara ACAAGGCCTCAGGGTACCA GCCGAAAGAAGCCCTTACAG
srebf1 GGGCAAGTACACAGGAGGAC AGATCTCTGCCAGTGTTGCC
ces3 TGTATGAGTTTGAGTATCGCCC CATCTTGCTGAGGTTGGTCT
Open in a new tab

Statistical Analysis

All bar graphs depict the mean ± SEM. A Shapiro-Wilk test was performed to check for normality of distribution and Levene’s test was used to check for homogeneity of variance. All data met these requirements. Multiple comparisons were performed using a one-way analysis of variance (ANOVA) followed by a Duncan’s post-hoc analysis with p < 0.05 considered significant. Statistical analysis was performed using IBM SPSS Statistics Version 25.

Results

PFOS exacerbates adiposity and body weight gain in normal diet but not in high fat diet conditions

Mean food consumption per mouse did not differ between groups throughout the study (Fig 1A). Based on the body weight and food consumption data we calculated that ND+PFOS-fed mice received a dose of 0.089 mg/kg/day and HFD+PFOS-fed mice received a dose of 0.087 mg/kg/day. There was no statistical difference in the dose received between these groups (Table 2). Figure 1B details the differences in body mass that developed between groups during the study. No significant differences in body mass existed between groups at day 0. At day 4, HFD fed groups were significantly heavier than ND + NT mice, but not heavier than ND + PFOS mice. At days 18 and 35, HFD fed groups were significantly heavier than ND fed groups. By day 42, while HFD + NT mice were significantly heavier than ND fed groups, PFOS treatment increased weight in ND fed mice and decreased weight in HFD fed mice, resulting in no significant difference between ND + PFOS and HFD + PFOS treated mice. To determine the cause of differences in body weight, we determined adiposity by weighing epididymal fat pads (Fig 1C). HFD fed mice showed significant increase in epididymal fat mass as expected. However, while PFOS treatment increased epididymal fat mass in ND fed mice, PFOS treatment did not exacerbate accumulation of epididymal fat mass in HFD fed mice.

Figure 1.

Figure 1

Open in a new tab

PFOS exacerbates adiposity and body weight gain in normal diet but not in high fat diet conditions. (A) Average food consumption per mouse for each group throughout the study. (B) Body mass for each group throughout the study. (C) Average weight of epididymal adipose tissue collected per mouse. All values are expressed as mean ± SEM. Letters indicate homogenous subsets with P < 0.05.

Table 2.

Dose of PFOS (mg/kg/day) received by each treatment group calculated by average food consumption throughout the feeding period.

Dose PFOS (mg/kg/day)
ND + NT ND + PFOS HFD + NT HFD + PFOS
0 0.089 0 0.087
Open in a new tab

PFOS increases hepatomegaly in normal diet but not in high fat diet conditions

Liver to body weight ratios were used to identify hepatomegaly. ND+PFOS-fed mice showed significant increase in liver to body weight ratio as compared to ND-fed mice. Interestingly, a significant decline in liver to body weight ratio was observed in HFD alone treatment group, which further decreased and was lowest in HFD+PFOS mice (Fig 2A).

Figure 2.

Figure 2

Open in a new tab

PFOS increases hepatomegaly in normal diet but not high fat diet conditions. (A) Liver mass to body mass ratios calculated at the time of euthanasia. Representative photomicrographs (40×) of liver sections stained for (B) PCNA and (C) H&E from NT or PFOS treated mice fed normal or high fat diet. All values are expressed as mean ± SEM. Letters indicate homogenous subsets with P < 0.05.

Absence of hepatocyte proliferation after PFOS treatment

Immunohistochemical analysis of proliferating cell nuclear antigen (PCNA) was performed to determine if the differences in liver size were due to changes in hepatocyte proliferation. However, none of the treatment groups exhibited any PCNA positive nuclei (Fig 2B). Western Blot analysis further confirmed no differences in PCNA protein expression between all groups (data not shown).

PFOS protects against high fat diet induced hepatic steatosis

H&E stained liver sections were observed to identify differences in gross liver histology (Fig 2C). Significant micro and macrovesicular steatosis was evident in ND-fed mice following PFOS treatment. Similarly, a significant increase in hepatic steatosis was observed in HFD+NT mice. However, the HFD+PFOS mice showed normal liver histology without any steatosis resembling that of ND alone fed mice.

Next, we stained frozen liver sections for Oil Red O to determine hepatic lipid accumulation (Fig 3A). Extensive hepatic steatosis was observed in ND+PFOS mice. Hepatic steatosis was also observed in HFD+NT mice. However, HFD+PFOS mice were protected from hepatic steatosis. The degree of hepatic steatosis was determined by quantification of triglycerides (TG) isolated from frozen liver (Fig 3B). This analysis confirmed the results of Oil Red O staining. Hepatic TG were significantly induced in ND+PFOS and HFD+NT mice, but livers from HFD+PFOS mice contained the same amount of TG as ND+NT mice. Serum glucose was significantly elevated by PFOS in ND-fed mice but was not affected by PFOS in HFD-fed mice (Table 3). No significant changes in serum TG or serum cholesterol were observed in any groups (Table 3).

Figure 3.

Figure 3

Open in a new tab

PFOS protects against high fat diet induced hepatic steatosis. (A) Oil Red O stained liver sections from NT or PFOS treated mice fed normal or high fat diet. (B) Quantification of hepatic triglycerides isolated from NT or PFOS treated mice fed normal or high fat diet. All values are expressed as mean ± SEM. Letters indicate homogenous subsets with P < 0.05.

Table 3.

Average concentration of serum triglyceride (TG), serum cholesterol and blood glucose for each treatment group measured at the time of euthanasia. Values expressed as mean ± SEM. Letters indicate homogenous subsets with P < 0.05.

Serum TG
(mg/dl)		 Serum Cholesterol
(mg/dl)		 Blood Glucose
(mg/dl)
ND + NT 55.27 ± 3.60a 144.74 ± 5.45a 158.40 ± 5.38a
ND + PFOS 62.02 ± 1.96a 174.01 ± 16.95a 222.20 ± 17.78b
HFD + NT 56.77 ± 4.16a 162.05 ± 16.68a 173.20 ± 10.66a
HFD + PFOS 60.34 ± 3.92a 133.38 ± 6.48a 151.00 ± 9.41a
Open in a new tab

PFOS changes expression of metabolism genes in diet dependent manner

To explore potential mechanisms for the diet dependent effects of PFOS, we quantified mRNA of several genes associated with lipid and carbohydrate metabolism (Fig. 4). In ND+PFOS-fed mice, expression of apolipoprotein genes ApoA1, ApoA2, ApoB and the apolipoprotein packaging gene MTTP was reduced. In HFD+PFOS-fed mice, expression of these genes remained unaffected as compared to ND or HFD+NT. Expression of genes involved in gluconeogenesis (PEPCK, G-6-Pase), were inhibited by PFOS in ND-fed mice and were inhibited in both HFD fed groups compared to ND+NT. In HFD-fed mice, PFOS did not affect expression of these genes. Finally, we measured expression of two genes involved in lipid and sterol metabolism (CES3, SREBF1). CES3 expression was reduced by PFOS in ND-fed mice. PFOS did not affect CES3 expression in HFD-fed mice. SREBF1 was nonsignificantly induced by PFOS in ND-fed mice and was significantly induced by PFOS in HFD-fed mice.

Figure 4.

Figure 4

Open in a new tab

PFOS changes expression of metabolism genes in diet dependent manner. RT-PCR analysis of lipid and carbohydrate metabolism genes. All values are expressed as mean ± SEM. Letters indicate homogenous subsets with P < 0.05.

Protection from PFOS-induced hepatic steatosis correlates with changes in hepatic lipid import

Finally, we measured mRNA expression for CD36, the major lipid importer in the cell (Fig 5A). ND+PFOS-fed and HFD alone-fed mice had a significantly elevated CD36 expression. However, CD36 expression did not change in HFD+PFOS treated mouse livers. Next, we quantified mRNA of two nuclear receptors known to regulate CD36 expression including PPARα and PPARγ (Fig 5A). There was no change in PPARα expression in any groups. PPARγ expression exhibited similar pattern as that of CD36. There was a significant increase in PPARγ expression in HFD alone and ND+PFOS groups but no change in HFD+PFOS group.

Figure 5.

Figure 5

Open in a new tab

Protection from PFOS-induced hepatic steatosis correlates with changes in hepatic lipid import. (A) RT-PCR analysis of hepatic lipid import transporter CD36 and known PFOS targets PPARα and PPARγ. (B) Representative scheme of proposed pathways. In ND-fed mice, PFOS activates PPARγ leading to excess hepatic lipid import through CD36 resulting in NAFLD. In HFD-fed mice, PFOS suppresses PPARγ leading to decreased hepatic lipid import by decreased expression of CD36 and protection from HFD-induced NAFLD. All values are expressed as mean ± SEM. Letters indicate homogenous subsets with P < 0.05.

Discussion

PFOS has been used extensively for industrial and consumer applications [1] and is found in human serum samples worldwide [2, 3]. PFOS toxicity manifests in the liver as hepatomegaly, hepatic steatosis and hepatic carcinogenesis in rodents [6–8]. We hypothesized that PFOS exposure would exacerbate NAFLD associated high fat diet consumption. To test this, we used a well-established mouse model of 60% high fat diet [22]. Male mice were fed normal or high fat diet with and without PFOS for 6 weeks. The intent of the study was to test exposures of PFOS similar to those observed in humans. Literature survey revealed the highest levels of serum PFOS concentrations in humans with occupational exposures approaching 10 μM PFOS in blood [16]. Previous studies have achieved 100 μM serum PFOS concentrations by feeding mice fed 0.001% PFOS diet. We reduced this dose by one order of magnitude (0.0001% PFOS) to achieve an estimated serum concentration within range of occupational exposure levels. Previous studies have achieved serum PFOS concentrations of 11 μg/ml (~23 μM) after feeding 0.0001% PFOS for 28 days[15]. Our data indicate that dose of PFOS in ND+PFOS and HFD+PFOS is similar based on the bodyweight and food consumption calculation. Thus, the diet dependent responses to PFOS in body size, adiposity, hepatic steatosis and hepatic gene expression cannot be attributed to a difference in the dose of PFOS received between diets.

PFOS has been associated with obesogenic effects in humans [23] and exposure has been positively correlated with weight regain [24]. In our study, PFOS treatment significantly increased body mass and adiposity in ND fed mice which was not observed when PFOS was treated along with HFD. Consistent with these data, we observed a significant increase in PPARγ mRNA, a known adipogenic nuclear receptor only in mice fed ND+PFOS group. Not only did PFOS fail to induce PPARγ expression when fed with HFD, it reduced expression in HFD group. The mechanism behind this observation is not completely known.

Consistent with previous studies, PFOS treatment in normal diet fed mice resulted in hepatomegaly, but these effects were lost in HFD fed conditions. Previous reports have shown that hepatomegaly in PFOS treated rodents was caused by increased hepatocyte proliferation due to activation of PPARα and CAR [25]. However, we observed no hepatocyte proliferation in any of the treatment groups. This suggests the differences in liver size were caused by changes in hepatic lipid content rather than hepatocyte proliferation. The discrepancies in hepatocyte proliferation could be attributed to the much higher PFOS doses used in previous studies [25] since the lower dose used in this study did not lead to activation of the PPARα gene. Similarly, the PFAA perfluorooctanoic acid (PFOA), induces PPARα mediated hepatocyte proliferation at high but not at low doses[26].

The H&E and Oil Red O staining confirmed extensive micro and macrovescicular steatosis in ND+PFOS and HFD alone groups. Strikingly, HFD+PFOS treatment showed a complete protection from steatosis. These changes seemed to be isolated to the liver, as the diet dependent effects of PFOS did not directly translate to major changes to serum TG or cholesterol levels. However, we did observe hyperglycemia in ND fed mice with PFOS treatment. This was not due to increased hepatic gluconeogenesis according to expression of PEPCK and G6PC. Previous studies have reported in utero exposure to PFOS resulting in steatosis, insulin resistance, increased blood glucose and increased adiposity in the absence of major changes in serum TG or cholesterol [27]. We observed a similar phenotype in ND mice treated with PFOS. Why this does not occur in HFD conditions is of future interest.

We examined hepatic expression of genes involved in lipid metabolism which could be involved in the diet dependent effects of PFOS. Previous reports have shown that PFOS can cause hepatic steatosis by inhibiting expression of apolipoproteins [6]. We observed decreased expression of ApoA1, ApoA2 and ApoB in ND+PFOS mice. However, there was no change in expression of these genes between treatments in HFD-fed mice. The same pattern was observed for MTTP, a gene important for packaging of lipids into apolipoproteins. Ces3, known to be involved in regulation of hepatic cholesterol metabolism [28] and of major importance in VLDL assembly [29, 30], was inhibited by PFOS in ND but not in HFD. Finally, SREBF1, a major regulator of hepatic lipogenesis [31], was induced by ND+PFOS group and HFD+PFOS treatment led to further increase in expression. Together, these results suggest protection from hepatic steatosis in HFD conditions is due to restored lipid flux rather than induction of lipid synthesis.

It has previously been reported that PFOS can activate PPARα [25, 32, 33]. In this study, we did not observe significant activation of PPARα at the mRNA or target gene level (ACOX1, PDK4, CPT1, data not shown) in any of our treatment groups, which could be due to the single low dose used. However, the hepatotoxic effects of PFOS can also occur in a PPARα-independent manner [34, 35] and there is evidence that PFOS activates other nuclear receptors [36, 37]. Our previous work has suggested PFAAs can activate PPARγ [16] and has been further supported by transcriptional profiling studies [38]. We observed increased PPARγ mRNA expression following PFOS treatment in ND-fed mice, but a decrease in expression following PFOS treatment in HFD-fed mice. Hepatocyte-specific deletion of PPARγ protects mice from HFD-induced steatosis and results in downregulation of CD36, MTTP, PEPCK [39]. This is consistent with our observations and suggests activated PPARγ may be contributing to the steatosis observed in ND-fed mice treated with PFOS. Furthermore, CD36, the major hepatocyte lipid importer, was induced by PFOS in ND fed mice but was suppressed to ND+NT levels by PFOS in HFD fed mice suggesting hepatic lipid import is accelerated by PFOS in ND conditions and inhibited in HFD conditions. CD36 is a known target of PPARγ [40]. Previous reports have also found induction of CD36 following PFOS exposure [41]. CD36 is induced in livers with severe steatosis [42] and hepatocyte-specific deletion of CD36 can attenuate HFD-induced steatosis[43].

The schematic presented in Figure 4B represents our current understanding of the diet-dependent effects of PFOS on hepatic steatosis. It is not known at this time why PFOS could lead to activation of PPARγ and CD36 in ND conditions but suppress expression of these genes in HFD conditions. Potential mechanisms include a direct interaction between PPARγ or other transcription factors known to respond to PFOS exposure such as HNF4α, PXR or CAR [16, 36] and is further complicated when the activity of these transcription factors is dependent on metabolic conditions.

Together, these data report human-relevant exposures of PFOS offering protection against hepatic steatosis in a diet-dependent manner likely by affecting hepatic lipid import. These results impact our understanding of PFOS toxicity and other perfluorinated alkyls by recognizing the role of nutritional status when determining mechanism of toxicity. Finally, in combination with existing literature, these results suggest PFOS simultaneously activates multiple pathways of adverse outcome and the interplay between these pathways and environmental conditions determines final outcome.

Acknowledgments

Financial Support: These studies were supported by NIH-COBRE (P20 RR021940-03, P30 GM118247), NIEHS Toxicology Training Grant (T32ES007079-34) and NIH R01DK 0198414

References

  • 1.Buck RC, et al. Perfluoroalkyl and polyfluoroalkyl substances in the environment: terminology, classification, and origins. Integr Environ Assess Manag. 2011;7(4):513–41. doi: 10.1002/ieam.258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Calafat AM, et al. Polyfluoroalkyl chemicals in the U.S. population: data from the National Health and Nutrition Examination Survey (NHANES) 2003-2004 and comparisons with NHANES 1999-2000. Environ Health Perspect. 2007;115(11):1596–602. doi: 10.1289/ehp.10598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kato K, et al. Trends in exposure to polyfluoroalkyl chemicals in the U.S. Population: 1999-2008. Environ Sci Technol. 2011;45(19):8037–45. doi: 10.1021/es1043613. [DOI] [PubMed] [Google Scholar]
  • 4.Olsen GW, et al. Half-life of serum elimination of perfluorooctanesulfonate, perfluorohexanesulfonate, and perfluorooctanoate in retired fluorochemical production workers. 9. Vol. 115. Environ Health Perspect; 2007. pp. 1298–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Borg D, et al. Tissue distribution of (35)S-labelled perfluorooctane sulfonate (PFOS) in C57Bl/6 mice following late gestational exposure. Reprod Toxicol. 2010;30(4):558–65. doi: 10.1016/j.reprotox.2010.07.004. [DOI] [PubMed] [Google Scholar]
  • 6.Bijland S, et al. Perfluoroalkyl sulfonates cause alkyl chain length-dependent hepatic steatosis and hypolipidemia mainly by impairing lipoprotein production in APOE*3-Leiden CETP mice. Toxicol Sci. 2011;123(1):290–303. doi: 10.1093/toxsci/kfr142. [DOI] [PubMed] [Google Scholar]
  • 7.Butenhoff JL, et al. Chronic dietary toxicity and carcinogenicity study with potassium perfluorooctanesulfonate in Sprague Dawley rats. Toxicology. 2012;293(1–3):1–15. doi: 10.1016/j.tox.2012.01.003. [DOI] [PubMed] [Google Scholar]
  • 8.Qazi MR, et al. Dietary exposure to perfluorooctanoate or perfluorooctane sulfonate induces hypertrophy in centrilobular hepatocytes and alters the hepatic immune status in mice. Int Immunopharmacol. 2010;10(11):1420–7. doi: 10.1016/j.intimp.2010.08.009. [DOI] [PubMed] [Google Scholar]
  • 9.Younossi ZM, et al. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology. 2016;64(1):73–84. doi: 10.1002/hep.28431. [DOI] [PubMed] [Google Scholar]
  • 10.Llovet JM, et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2016;2:16018. doi: 10.1038/nrdp.2016.18. [DOI] [PubMed] [Google Scholar]
  • 11.GBD. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990-2013; 2013: a systematic analysis for the Global Burden of Disease Study 2013. The Lancet. 2015;385(9963):117–171. doi: 10.1016/S0140-6736(14)61682-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chalasani N, et al. The diagnosis and management of non-alcoholic fatty liver disease: practice Guideline by the American Association for the Study of Liver Diseases, American College of Gastroenterology, and the American Gastroenterological Association. Hepatology. 2012;55(6):2005–23. doi: 10.1002/hep.25762. [DOI] [PubMed] [Google Scholar]
  • 13.Al-Eryani L, et al. Identification of Environmental Chemicals Associated with the Development of Toxicant-associated Fatty Liver Disease in Rodents. Toxicol Pathol. 2015;43(4):482–97. doi: 10.1177/0192623314549960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Qazi MR, et al. The atrophy and changes in the cellular compositions of the thymus and spleen observed in mice subjected to short-term exposure to perfluorooctanesulfonate are high-dose phenomena mediated in part by peroxisome proliferator-activated receptor-alpha (PPARalpha) Toxicology. 2009;260(1–3):68–76. doi: 10.1016/j.tox.2009.03.009. [DOI] [PubMed] [Google Scholar]
  • 15.Qazi MR, et al. 28-Day dietary exposure of mice to a low total dose (7 mg/kg) of perfluorooctanesulfonate (PFOS) alters neither the cellular compositions of the thymus and spleen nor humoral immune responses: does the route of administration play a pivotal role in PFOS-induced immunotoxicity? Toxicology. 2010;267(1–3):132–9. doi: 10.1016/j.tox.2009.10.035. [DOI] [PubMed] [Google Scholar]
  • 16.Beggs KM, et al. The role of hepatocyte nuclear factor 4-alpha in perfluorooctanoic acid- and perfluorooctanesulfonic acid-induced hepatocellular dysfunction. Toxicol Appl Pharmacol. 2016;304:18–29. doi: 10.1016/j.taap.2016.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wolfe A, et al. Increased activation of the Wnt/beta-catenin pathway in spontaneous hepatocellular carcinoma observed in farnesoid X receptor knockout mice. J Pharmacol Exp Ther. 2011;338(1):12–21. doi: 10.1124/jpet.111.179390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Walesky C, et al. Hepatocyte-specific deletion of hepatocyte nuclear factor-4alpha in adult mice results in increased hepatocyte proliferation. Am J Physiol Gastrointest Liver Physiol. 2013;304(1):G26–37. doi: 10.1152/ajpgi.00064.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.McCracken JM, et al. C57BL/6 Substrains Exhibit Different Responses to Acute Carbon Tetrachloride Exposure: Implications for Work Involving Transgenic Mice. Gene Expr. 2017;17(3):187–205. doi: 10.3727/105221617X695050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Apte U, et al. Beta-catenin activation promotes liver regeneration after acetaminophen-induced injury. Am J Pathol. 2009;175(3):1056–65. doi: 10.2353/ajpath.2009.080976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 22.Guo T, et al. Berberine Ameliorates Hepatic Steatosis and Suppresses Liver and Adipose Tissue Inflammation in Mice with Diet-induced Obesity. Sci Rep. 2016;6:22612. doi: 10.1038/srep22612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Domazet SL, et al. Longitudinal Associations of Exposure to Perfluoroalkylated Substances in Childhood and Adolescence and Indicators of Adiposity and Glucose Metabolism 6 and 12 Years Later: The European Youth Heart Study. Diabetes Care. 2016;39(10):1745–51. doi: 10.2337/dc16-0269. [DOI] [PubMed] [Google Scholar]
  • 24.Liu G, et al. Perfluoroalkyl substances and changes in body weight and resting metabolic rate in response to weight-loss diets: A prospective study. PLoS Med. 2018;15(2):e1002502. doi: 10.1371/journal.pmed.1002502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Elcombe CR, et al. Hepatocellular hypertrophy and cell proliferation in Sprague-Dawley rats from dietary exposure to potassium perfluorooctanesulfonate results from increased expression of xenosensor nuclear receptors PPARalpha and CAR/PXR. Toxicology. 2012;293(1–3):16–29. doi: 10.1016/j.tox.2011.12.014. [DOI] [PubMed] [Google Scholar]
  • 26.Wolf DC, et al. Comparative hepatic effects of perfluorooctanoic acid and WY 14,643 in PPAR-alpha knockout and wild-type mice. Toxicol Pathol. 2008;36(4):632–9. doi: 10.1177/0192623308318216. [DOI] [PubMed] [Google Scholar]
  • 27.Lv Z, et al. Glucose and lipid homeostasis in adult rat is impaired by early-life exposure to perfluorooctane sulfonate. Environ Toxicol. 2013;28(9):532–42. doi: 10.1002/tox.20747. [DOI] [PubMed] [Google Scholar]
  • 28.Bie J, et al. Liver-specific cholesteryl ester hydrolase deficiency attenuates sterol elimination in the feces and increases atherosclerosis in ldlr−/− mice. Arterioscler Thromb Vasc Biol. 2013;33(8):1795–802. doi: 10.1161/ATVBAHA.113.301634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wei E, et al. Loss of TGH/Ces3 in mice decreases blood lipids, improves glucose tolerance, and increases energy expenditure. Cell Metab. 2010;11(3):183–93. doi: 10.1016/j.cmet.2010.02.005. [DOI] [PubMed] [Google Scholar]
  • 30.Dolinsky VW, et al. Triacylglycerol hydrolase: role in intracellular lipid metabolism. Cell Mol Life Sci. 2004;61(13):1633–51. doi: 10.1007/s00018-004-3426-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Moon YA. The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis. Endocrinol Metab (Seoul) 2017;32(1):6–10. doi: 10.3803/EnM.2017.32.1.6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Shipley JM, et al. Trans-activation of PPARalpha and induction of PPARalpha target genes by perfluorooctane-based chemicals. Toxicol Sci. 2004;80(1):151–60. doi: 10.1093/toxsci/kfh130. [DOI] [PubMed] [Google Scholar]
  • 33.Wolf CJ, et al. Activation of mouse and human peroxisome proliferator-activated receptor alpha by perfluoroalkyl acids of different functional groups and chain lengths. Toxicol Sci. 2008;106(1):162–71. doi: 10.1093/toxsci/kfn166. [DOI] [PubMed] [Google Scholar]
  • 34.Rosen MB, et al. Gene Expression Profiling in Wild-Type and PPARalpha-Null Mice Exposed to Perfluorooctane Sulfonate Reveals PPARalpha-Independent Effects. PPAR Res. 2010;2010 doi: 10.1155/2010/794739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Abbott BD, et al. Developmental toxicity of perfluorooctane sulfonate (PFOS) is not dependent on expression of peroxisome proliferator activated receptor-alpha (PPAR alpha) in the mouse. Reprod Toxicol. 2009;27(3–4):258–65. doi: 10.1016/j.reprotox.2008.05.061. [DOI] [PubMed] [Google Scholar]
  • 36.Ren H, et al. Evidence for the involvement of xenobiotic-responsive nuclear receptors in transcriptional effects upon perfluoroalkyl acid exposure in diverse species. Reprod Toxicol. 2009;27(3–4):266–77. doi: 10.1016/j.reprotox.2008.12.011. [DOI] [PubMed] [Google Scholar]
  • 37.Bjork JA, Butenhoff JL, Wallace KB. Multiplicity of nuclear receptor activation by PFOA and PFOS in primary human and rodent hepatocytes. Toxicology. 2011;288(1–3):8–17. doi: 10.1016/j.tox.2011.06.012. [DOI] [PubMed] [Google Scholar]
  • 38.Rosen MB, et al. PPARalpha-independent transcriptional targets of perfluoroalkyl acids revealed by transcript profiling. Toxicology. 2017;387:95–107. doi: 10.1016/j.tox.2017.05.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Moran-Salvador E, et al. Role for PPARgamma in obesity-induced hepatic steatosis as determined by hepatocyte- and macrophage-specific conditional knockouts. FASEB J. 2011;25(8):2538–50. doi: 10.1096/fj.10-173716. [DOI] [PubMed] [Google Scholar]
  • 40.Zhou J, et al. Hepatic fatty acid transporter Cd36 is a common target of LXR, PXR, and PPARgamma in promoting steatosis. Gastroenterology. 2008;134(2):556–67. doi: 10.1053/j.gastro.2007.11.037. [DOI] [PubMed] [Google Scholar]
  • 41.Wan HT, et al. PFOS-induced hepatic steatosis, the mechanistic actions on beta-oxidation and lipid transport. Biochim Biophys Acta. 2012;1820(7):1092–101. doi: 10.1016/j.bbagen.2012.03.010. [DOI] [PubMed] [Google Scholar]
  • 42.Sos BC, et al. Abrogation of growth hormone secretion rescues fatty liver in mice with hepatocyte-specific deletion of JAK2. J Clin Invest. 2011;121(4):1412–23. doi: 10.1172/JCI42894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wilson CG, et al. Hepatocyte-Specific Disruption of CD36 Attenuates Fatty Liver and Improves Insulin Sensitivity in HFD-Fed Mice. Endocrinology. 2016;157(2):570–85. doi: 10.1210/en.2015-1866. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES