Skip to main content
Cell Cycle logoLink to Cell Cycle
. 2018 Sep 6;17(15):1931–1945. doi: 10.1080/15384101.2018.1509636

TLR-4/microRNA-125a/NF-κB signaling modulates the immune response to Mycobacterium tuberculosis infection

Wenyi Niu 1,✉, Bing Sun 1, Mingying Li 1, Junwei Cui 1, Jian Huang 1, Ligong Zhang 1
PMCID: PMC6152532  PMID: 30153074

ABSTRACT

Tuberculosis (TB), caused by Mycobacterium tuberculosis, could lead to kinds of clinical disorders and remains a leading global health problem, resulting in great morbidity and mortality worldwide. Previous studies have firmly demonstrated that M. tuberculosis (M.tb) has evolved to utilize different mechanisms to evade or attenuate the host immune response, such as regulation of immune-related genes by modulation of miRNAs of host or bacteria. However, the knowledge of functions of miRNAs during M.tb infection remains limited. Here, we reported that a host microRNA, miR-125a, was significantly up-regulated by M.tb infection in both RAW264.7 and THP-1cells, in a TLR4 signaling-dependent manner. Subsequently, our results demonstrated that miR-125a was a negative regulator of NF-kB pathway by directly targeting TRAF6, resulting in the suppression of cytokines, attenuation of immune response and promotion of M.tb survival. Taken together, our findings provide a novel detailed molecular mechanism in which miR-125a was enhanced to inhibit inflammatory cytokines secretion and attenuate the immune response during M.tb infection in RAW264.7 and THP-1 cells, and suggest an intrinsic a promising anti-M.tb therapeutic target.

KEYWORDS: Mycobacterium tuberculosis, miR-125a, TLR-4, TRAF6, NF-kB

Introduction

Mycobacterium tuberculosis (M.tb), one of the dominant global bacterial causes of death, would lead to Tuberculosis (TB) and result in an estimated one-third of the global population latently infected and even about 2 million deaths per year [1,2]. As the first line of host defense against bacterial infection and major susceptible host for M.tb, macrophages would engulf the M.tb and then degrade the harbored M.tb by acidic phagolysosome, making the antigens available for priming of T cell responses [3,4]. Simultaneously, a serial of anti-pathogen mechanisms would be activated. To reside and replicate within phagocytes, M.tb has been shown to inhibit phagolysosome fusion and to neutralize the acidic environment of the phagolysosomal compartment [5], as well as to induce macrophage necrosis and to inhibit apoptosis [6,7]. In addition, it has been reported that M. tuberculosis could combat the innate immune defense of the host to favor its infection and replication in the infected cells and tissues by kinds of ways, for example, by inhibiting production of pro-inflammatory cytokines [8,9]. During these responses, the reprogramming of the host transcriptome usually occurs. Specially, the expression levels of kinds of immune-related genes are always affected, such as members of Nuclear factor κB (NF-κB) family, which would affect inflammation and other immune process.

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules which are usually composed of 21–25 nucleotides [10]. Previous studies have demonstrated that they always serve as regulators of immune homeostatic mechanisms, by posttranscriptionally regulating gene and/or protein expression [11–13]. Mounting evidences have shown that dysfunction or dysregulation of miRNAs are involved in immune response against kinds of cancers, viruses and bacteria. For example, it has been reported that overexpression of miR-24 could inhibit the effects of Staphylococcus aureus in Osteomyelitis Caused by S. aureus [14], while miR-302b is demonstrated to enhance host defense to bacteria by regulating inflammatory responses upon Gram-negative bacterium Pseudomonas aeruginosa infection [15]. As with M.tb, although several miRNAs have been identified as regulators that positively or negatively regulate innate immune response in the regulation of M.tb replication and infection by targeting different cytokines [16–19], the detailed molecular mechanisms still need to be further illustrated.

TNF receptor associated factor 6 (TRAF6) belonging toTNF receptor associated factor (TRAF) protein family, has been reported to be associated with, and to mediate signal transduction from members of the TNF receptor superfamily [20], and hence functioning as one pivotal regulator in many cellular pathways. In fact, TRAF6 could mediate signaling from not only members of the TNF receptor superfamily but also the Toll/IL-1 family [20,21]. TRAF6 also serve as a link between distinct signaling pathways by interacts with various proteins kinases including IRAK1/IRAK [22]. Specially, TRAF6 could function as a signal transducer in the NF-κB pathway that activates IκB kinase (IKK) in response to proinflammatory cytokines, by binding with TAK1 to promote the activation of IκB kinase (IKK) and further phosphorylation [23,24], ubiquitination and degradation of IκB, which leads to the disassociation of p50/p65 heterodimer . Then, the released p65 and p50 protein would be translocated into the nuclear to bind to sequence-specific DNA to activate the transcription of many immune-related genes, such as TNF-a, IL-12 [25,26].

In the present study, the gene expression profiles of M. tb infected patients with normal controls downloaded from GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE52819 GSE29190) were analyzed to screen differentially expressed miRNAs and a significant up-regulated miRNA – miR-125a were chosen for further investigation. Then, we found that up-regulation of miR-125a in macrophages was dependent on TLR4 signaling during M.tb-infection. Through further exploration, it was found that miR-125a, through targeting the 3ʹUTR of TRAF6, modulating NF-kB and inflammatory cytokines expression, leading to the attenuation of immune response, could enhance mycobacterial survival in Macrophages. As NF-kB path way is frequently involved in bacteria-host interactions, the functions and mechanisms revealed in this study may be also applied in infections of other bacteria. Together, miR-125a could represent a novel potential anti-M.tb therapeutic target and would be helpful for antibacterial development.

Material and methods

Cells and transfection

Human THP-1 macrophages and murine RAW264.7 macrophages were obtained from ATCC and grown in RPMI-1640 media (Hyclone/Thermo Fisher) supplemented with 10% fetal bovine serum (FBS, Gibco/Life Technology) and penicillin-streptomycin (100 g/ml) at 37°C in a humidified atmosphere with 5% CO2. The cell concentration was adjusted to 1.0 × 10 [6]/mL for further study. Transfected reaction is incubated in antibiotic-free Opti-MEM medium (Invitrogen) with lipofectamine 2000 reagent (Invitrogen).

Mycobacterial and infection

M. tuberculosis strain H37Rv (ATCC) was grown in Middlebrook 7H9 broth medium supplemented with 10% OADC (Becton, Dickinson and Company, Franklin Lakes, NJ). Cells were infected at a multiplicity of infection of 10 bacteria per cell (MOI 10) or indicated MOIs. After 6 h of incubation, the infected cells were washed 6 times with RPMI1640 to remove any extracellular bacteria, and then incubated in fresh medium to different timepoints.

MiR-125a mimics and inhibitor

MiR-125a mimics, mimics NC, miR-125a inhibitor and inhibitor NC were purchased from the Shanghai GenePharma Company (Shanghai, China). RAW264.7 cells and THP-1 cells were transfected with miR-125a mimics or miR-125a inhibitor using lipofectamine 2000 (Invitrogen, USA) according to manufacturer’s instruction.

ELISA assay

IFN-γ, IL-1β, IL-6 and TNF-α in supernatant were measured by ELISA kit (all from R&D Systems) according to manufacture. RAW264.7 cells and THP-1 cells were transfected with miR-125a mimics or miR-125a inhibitor or control NC, then, cells were infected with H37Rv at MOI 10 at 24hr after transfection. Supernatant were harvest at 24hr post-infection to perform ELISA assay.

Real-time PCR

To quantify the level of gene expression, total RNAs were extracted using TRIzol (Invitrogen), according to the manufacturer’s instruction. cDNA was reversely transcribed from 1 ug total RNA by SuperScript III Reverse Transcriptase (Invitrogen). Realtime PCR was carried out with PrimeScript RT reagent kit (Takara) on ABI 7900HT Fast Real-Time PCR System. Relative expression of miRNA and mRNA were quantitatively normalized against the expression of U6 and GAPDH, respectively, using △△Ct method. Primer sequences were designed as follows:

MiR-125a RT: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCTCC-3′

miR-125a forward: 5′-CGTAGACAGGTGAGGTTCTTC −3′

miR-125a reverse: 5′-GCAGGGTCCGAGGTATTC −3′

TLR4 forward: 5ʹ- CCGCTTTCACTTCCTCTCAC −3ʹ

TLR4 reverse: 5ʹ- CATCCTGGCATCATCCTCAC-3ʹ

TLR2 forward: 5ʹ- TGTCTTGTGACCGCAATGGT-3ʹ

TLR2 reverse: 5ʹ- TGTTGGACAGGTCAAGGCTTT-3ʹ

TRAF6 forward:5ʹ- GCTTGATGGCATTACGAGAAG-3ʹ

TRAF6 reverse:5ʹ- GCAGTATTTCATTGTCAACTGG −3ʹ

U6 forward:5ʹ- CTCGCTTCGGCAGCACA-3ʹ

U6 reverse:5ʹ- AACGCTTCACGAATTTGCGT-3ʹ

GAPDH forward:5ʹ-AAGGTCATCCCAGAGCTGAA −3ʹ

GAPDH reverse:5ʹ-GCCATGAGGTCCACCACCCT −3ʹ

Cell viability assay

Cells at 24 h post-infection were seeded in 96-well plates at 2500 cells/well. After that, cell viability was evaluated using the CCK8 (C0038, Beyotime Inst Biotech, China) according to manufacturer’s instructions. Briefly, 10 μl of CCK8 solution was added to the culture medium and incubated for additional 4 h. The absorbance was determined at 450 nm wavelength.

Luciferase assay

Luciferase activity of promoter was evaluated by Dual-Luciferase Reporter Assay System (Promega). To measure luciferase activity of TRAF6, RAW264.7 cells and THP-1 cells were transfected with TRAF6 WT or TRAF6 mutant luciferase reporter vector (100 ng), miR-125a mimics or NC mimics, miR-125a inhibitor or NC inhibitor. Total protein was preparaed after 36 hr post-transfection. The 50μl of each sample extract was used to detect luciferase activity. To quantitatively examine NF-κB activity, RAW264.7 cells and THP-1 cells were first transfected with mimics NC or miR-125a mimics or miR-125a along with pcDNA-TRAF6 in a 24-well plate for 24 hours, followed by co-transfection with 10 ng pRL-TK (Promega, USA) and 50 ng pNF-κB-Luc (Clontech, USA) for 24 hours, then remained uninfected or infected with H37Rv for 24 hours before luciferase activity analysis. Cell were harvest for protein and the 50μl of each sample extract was used to detect luciferase activity.

Western blot analysis

Cell lysates were obtained with RIPA lysis buffer, and proteins were analyzed by western blot. β-actin serves as a control. The following antibodies were used: anti-p-IκBα (Ser32,cat.#2859,CST), anti-IκBα (cat. #4814, CST), anti-p-p65 (cat. #3033,CST), anti-p65(cat. #4814, CST), anti-TAK1 (cat. #5206, CST), anti-β-actin (cat. BM0627, Boster, Wuhan, China), anti-TLR2(cat.#9100,Abcam), anti-TLR4 (cat.#sc-293072, Santa Cruz Biotechnology), anti-TRAF6(cat. #8028,CST)and goat anti-rabbit, goat anti-mouse (Tianjin Saier Biotech, China).

Colony-forming unit (CFU) assay

To assay bacterial viability, cells were infected with M.tb at an MOI of 10 for 6 h at 37°C, then washed 6 times with RPMI1640 to remove any extracellular bacteria, and incubate in fresh medium for 18hr . 24hr post-infection, the infected cells were lysed with sterile distilled water containing 0.06%SDS. Homogenates underwent 10-fold-serial dilution and each dilution was inoculated on 7H11 agar plates supplemented with 10% OADC and incubated at 37C for 3–4 weeks. CFUs were calculated in triplicate using standard procedures.

Human peripheral blood specimens

Peripheral blood specimens from 25 TB patients and 25 age-matched healthy volunteers collected at the Department of Tuberculosis, the First Affiliated Hospital of Xinxiang Medical University. Leukocyte isolation was conducted using fresh samples and substantial purification of small RNA using an RNAiso kit according to manufacturer’s recommendations (Takara). This study was approved by the Ethics Committee of the First Affiliated Hospital of Xinxiang Medical University, and written informed consent was obtained from all participants.

Identification of differentially expressed mirna

The gene expression profiles of M.tb patients with normal controls were downloaded from Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) with accession number of GSE29190 and GSE52819. The original datasets included 40 genechips, and we extracted 22 of them for further analysis. During the processing, the probe-level data was transferred into expression measures. Then, the background was corrected and quartile data was subsequently normalized. Finally, we choose the file in the platform annotation files resulting from the Affymetrix Company to map the relationship between the probes and gene symbols. To identify differentially expressed miRNA, the threshold of false discovery rate (FDR) 0.05 was applied.

Statistical analysis

All experiments were repeated at least three times with similar results. Statistical significance analysis was performed using Student’s T test between two groups and one-way ANOVA among multiple groups, followed by Tukey’s post hoc test. (**p < 0.01, *p < 0.05)

Result

MiR-125a is markedly up-regulated after M.tb infection

To identify miRNAs that may be involved in the regulation of immune response of M.tb infection, miRNA data was downloaded from GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE52819 GSE29190) to screen differentially expressed miRNAs. As shown in Figure 1(a), a great number of miRNAs were down-regulated or up-regulated after M.tb infection. A significant increase of miR-125a was observed in the miRNA array. Interestingly, by a miRNA stem-loop qRT-PCR assay we found that miR-125a transcript was more abundant in peripheral leukocytes of TB patients (3.0 folds over U6 promoter) than those in healthy subjects (1.7 folds over U6 promoter) (Figure 1(b)). Previous paper reported that miR-125a negatively regulates antimicrobial responses by blocking M. tb–induced activation of autophagy and phagosomal maturation in macrophages [27]. In addition, it is also reported that miR-125a played an important role in regulating macrophage activation [28]. Since macrophage served as the front-lines of host immune defense against M.tb, we suspected that miR-125a may be utilized by M.tb to suppress immune response,leading to M.tb-immune envision. Thus, we performed further investigation on miR-125a in both mouse and human macrophage cell lines (RAW264.7 and THP-1). In RAW264.7 cells, the expression level of miR-125a was markedly enhanced since 6hr post-infection and continued to increase until 48 hr post-infection (Figure 1(c)). Moreover, miR-125a expression in RAW264.7 cells was induced by M.tb in a dose-dependent manner (Figure 1(e)). Notably, similar expression pattern for miR-125a were observed in human macrophage cell lines THP-1cells infected with M.tb (Figure 1(d,f)). Taken together, these results suggested that M.tb infection robustly enhanced the expression of miR-125a in both cell lines and patients’ samples, indicating a potential role of miR-125a in M.tb infection.

Figure 1.

Figure 1.

MiR-125a was markedly up-regulated after M.tb infection. (a) Heat-map of microRNA array. (b) Peripheral leukocytes were isolated from peripheral blood of 25 TB patients and 25 healthy donors and used for RNA purification. The expression level of miR-125a transcript was determined by Real-time PCR assay. (C-F) real-time PCR data to compare miR-125a expression levels. (C-D) RAW264.7 cells (c) and THP-1 cells (d) were infected with H37Rv at MOI 10 for indicated hours. *p < 0.05, **p < 0.01 vs 0hr groups. (E-F) RAW264.7 cells (e) and THP-1 cells (f) were infected with H37Rv for 24 hours at indicated MOI. *p < 0.05, **p < 0.01 vs 0 MOI groups. All data represents of three independent experiments (mean± SD).

Upregulation of mir-125a in macrophages was dependent on TLR4 signaling during M.tb-infection

TLRs are known to play a pivotal role in host immune response upon M.tb-infection, especially for TLR2 and TLR4, which lead to the activation of NF-κB signaling [29,30]. Accumulating evidence indicates that through targeting TLRs, miRNAs can modulate innate immune response against M.tb [31–33]. Therefore, we next interrogated whether TLR2 or TLR4 was involved in the induction of miR-125a in macrophages after M.tb infection. We used RNAi technique to specifically knock down the expression of TLR4 or TLR2 in RAW264.7 and THP-1 cells. Upon siRNA transfection, the mRNA level of TLR4 or TLR2 was efficiently knocked down by 3 different siRNAs respectively, especially by si-TLR4-1 and si-TLR2-2 (Figure 2(a,d)). Consistently, through Western blot analysis, the protein level of TLR4 and TLR2 in both THP1 and RAW264.7 cells was remarkably downregulated by si-TLR4-1 or si-TLR2-2 transfection respectively (Figure 2(b,e)). Further, we investigated the impact of TLRs depletion on the expression of miR-125a following M.tb-challenged. Interestingly, we found that compared with si-scramble group, the levels of miR-125a were dramatically declined by ablation of TLR4 in both RAW264.7 and THP-1 cells upon M.tb infection (Figure 2(c)). However, knockdown of TLR2 had little effect on the expression of miR-125a (Figure 2(f)). Collectively, these data indicated that induction of miR-125a is mainly dependent on TLR4 signaling rather than TLR2 signaling in macrophages in response to M.tb infection.

Figure 2.

Figure 2.

The induction of miR-125a in M.tb-infected macrophages was dependent on TLR4 signaling. (a) RAW264.7 and THP-1 cells were transfected with 3 different siRNAs targeting TLR4. 24hr after transfection, cells were harvested for mRNA extraction and the efficiency of siRNAs were determined by real-time PCR analysis. **p < 0.01 vs si-scrambled groups. (b) RAW264.7 and THP-1 cells were transfected with si-TLR4-1 respectively. 24hr after transfection, cells were harvested and TLR4 expressions were analyzed through Western blot assay. **p < 0.01 vs si-scrambled groups. (c) Cells were treated as in B. 24hr after siRNA transfection, cells were infected with H37Rv for 24 hours at MOI 10. Cells were harvested for mRNA extraction and the expression level of miR-125a was determined by real-time PCR analysis. **p < 0.01 vs si-scrambled groups. (d) RAW264.7 and THP-1 cells were transfected with 3 different siRNAs targeting TLR2. 24hr after transfection, cells were harvested for mRNA extraction and the efficiency of siRNAs were determined by real-time PCR analysis. *p < 0.05, **p < 0.01 vs si-scrambled groups. (e) RAW264.7 and THP-1 cells were transfected with si-TLR2-2 respectively. 24hr after transfection, cells were harvested and TLR2 expressions were analyzed through Western blot assay. **p < 0.01 vs si-scrambled groups. (f) Cells were treated as in E. 24hr after siRNA transfection, cells were infected with H37Rv for 24 hours at MOI 10. Cells were harvested for mRNA extraction and the expression level of miR-125a was determined by real-time PCR analysis. All data represents of three independent experiments (mean± SD).

Mir-125a enhances mycobacterial survival in macrophages

In order to elucidate the role of miR-125a in immune response during M.tb infection, we scored for bacterial CFUs in M.tb infected RAW264.7 and THP-1 cells after transfection with either miR-125a mimic or miR-125a inhibitor. To confirm the efficacy of miRNA mimics and inhibitor, we utilized real-time PCR assay to evaluate the expression of miR-125a and found that the level of miR-125a was remarkably increased after miR-125a mimic transfection, whereas decreased after miR-125a inhibitor transfection in both RAW264.7 and THP-1 cells (Figure 3(a,b)). The effect of miR-125a mimics/inhibitor in cell viability was then evaluated. As shown in Figure 3(c, d), miR-125a mimics/inhibitor had no effect in cell viability. Next, we valued bacterial CFUs in M.tb infected RAW264.7 and THP-1cells. The viability of M.tb was dramatically augmented in the presence of miR-125 mimic (Figure 3(e)). Conversely, downregulation of miR-125a with miR-125a inhibitor suppressed intracellular growth of bacterial in both cells (Figure 3(f)). Taken together, these results indicated that miR-125a promotes bacterial survival in macrophages during M.tb infection.

Figure 3.

Figure 3.

MiR-125a promotes bacterial survival in macrophages during M.tb infection. RAW264.7 and THP-1 cells were transfected with miR-125a mimics, mimics NC (A, C and E) or miR-125a inhibitor, inhibitor NC (B, D and F). 24hr post-transfection, cells were infected with M.tb H37Rv strain at MOI of 10. (A, B) The miR-125a expression levels at 48hr post-transfection were quantified by qRT-PCR. (C, D) 24hr post-infection, cells were harvested for cell viability evaluation. (E, F) 24hr post-infection, cells were harvested for CFU assay. All data represents of three independent experiments (mean± SD). **p < 0.01 vs mimics NC group or inhibitor NC group.

Mir-125a decreases cytokine production upon m.tb infection

As described above, we demonstrated that miR-125a enhanced bacterial survival during M.tb infection. Next, we examined its effect on the production of proinflammation cytokines, which plays an important role in host immune response against bacterial infection. Consistent with previous data, we found that M.tb infection led to robust secretion of TNF-α, IL-6, IFN-γ and IL-1β in RAW264.7 cells (Figure 4(a-d)). However, ectopic expression of miR-125a greatly attenuated this effect upon H37Rv infection. Conversely, the induction of proinflammation cytokines was considerably upregulated in miR-125a knockdown cells (Figure 4(a-d)). Similarly, in THP-1 cells, the secretion of cytokines was reduced in miR-125a over-expression groups whereas miR-125a knockdown led to enhanced secretion of cytokine upon M.tb infection in THP-1 cells (Figure 4(e-h)). Therefore, we conclude that miR-125a serve as a negative regulator in cytokine production of macrophages during M.tb infection.

Figure 4.

Figure 4.

MiR-125a suppress cytokine secretion upon M.tb infection. RAW264.7 cells(A-D) and THP-1 cells (E-H) were transfected with miR-125a mimics, mimics NC or miR-125a inhibitor, inhibitor NC. 24 h post-transfection, cells were infected with M.tb H37Rv strain at MOI of 10. 24hr post infection, supernatant was harvest. ELISA assay was performed to measure TNF-α (A and E), IL-6 (B and F), IFN-γ (C and G), and IL-1β (D and H) secretion. Results represent of three independent experiments (mean± SD). *p < 0.05, **p < 0.01 vs non-treated groups; ##p < 0.01 vs mimics NC or inhibitor NC groups.

TRAF6 is directly targeted by Mir-125a

To further illustrate the possible mechanism of miR-125a in regulation of immune response upon M.tb infection, it is necessary to identify the target genes of miR-125a. TargetScan Release 6.0 was subsequently used for prediction of miR-125a cellular targets. TNF receptor associated factor 6 (TRAF6), an upstream key regulator of NF-κB and MAP kinase pathway [34], was found to have a putative miR-125a binding site within its 3ʹ UTR (Figure 5(a)). Notably, this putative binding site is highly conserved among different species, including Human, Chimp, Rhesus, Mouse, Rat and so on (Figure 5(a)). To investigate whether miR-125a directly binds to the 3ʹUTR of TRAF6, we cloned the predicted target site into a vector containing firefly luciferase reporter gene. Meanwhile, a mutant vector was constructed to eliminate the possible recognition by replacing seven seed nucleotides (CUCAGGG to UAGCAAU) (Figure 4(b)). In the presence of miR-125a mimics, the luciferase activity of TRAF6 3ʹ-UTR resulted in intensive reduction (~ 80%) compared to that of mimic NC, whereas blockage of endogenous miR-125a led to a 3.7-fold increase in luciferase activity compared to that of inhibitory NC (Figure 5(c)). However, all these effects disappeared in cells transfected with the vector bearing the mutant TRAF6 3ʹ-UTR (Figure 5(c)). These results confirmed that the miR-125a target site is harbored in the 3ʹUTR of TRAF6. To further validate TRAF6 as a target of miR-125a, the expression of TRAF6 was examined in RAW264.7 and THP-1 cells transfected with miR-125a mimics or inhibitor. As expected, the protein expressions of TRAF6 expression were increased significantly when miR-125a inhibitor was applied, while which were decreased when the miR-125a was over-expressed (Figure 5(d)). Moreover, a significant reduction of TRAF6 mRNA was observed in TB patients compared with that of healthy subjects (Figure 5(e)). Pearson’s correlation analysis of TRAF6 expression against miR-125a expression showed strong negative correlation with miR-125a expression among TB patients (Figure 5(f)). Taken together, these results indicate that TRAF6 is a direct target of miR-125a in macrophages.

Figure 5.

Figure 5.

TRAF6 is directly targeted by miR-125a. (a) Prediction of TRAF6 as a target of miR-125a in different species. (b) Schematic view of miR-125a putative targeting site in the wild type (WT) and mutant (Mut) 3′-UTR of TRAF6. (c) 293T cells were co-transfected with TRAF6 WT or TRAF6 mutant luciferase reporter vector (100 ng), and miR-125a mimics or NC, miR-125a inhibitor or NC inhibitor for 36 h and then harvested for luciferase assay. All data represent the mean value ± SD of at least three independent experiments. **p < 0.01; ##p < 0.01 vs mimics NC group or inhibitor NC group. (d) RAW264.7 and THP-1 cells were transfected with miR-125a mimics or NC mimics, miR-125a inhibitor or NC inhibitor for 36 h and harvested for Western blot analysis of TRAF6 expression. (E-F) Peripheral leukocytes were isolated from peripheral blood of 25 TB patients and 25 healthy donors and used for RNA purification. The mRNA level of TRAF6 was determined by Real-time PCR analysis (e). The correlation of TRAF6 expression against miR-125a was analyzed by Pearson analysis. All data represent the mean value ± SD of at least three independent experiments.

MiR-125a regulates mycobacterial survival and inflammatory cytokine secretion directly through targeting TRAF6

As described above, miR-125a regulates the expression of TRAF6, which is essential for NF-κB activation and inflammatory response. Therefore, we wonder whether the effect of miR-125a on mycobacterial survival and cytokine secretion during M.tb infection is through targeting TRAF6. We co-transfected miR-125a-mimics and an expressing vector containing TRAF6 into RAW264.7 and THP-1 cells. TRAF6 expression level was confirmed by Western Blot analysis. Upon co-transfection with pcDNA-TRAF6, the suppressive effect of miR-125a on TRAF6 was abolished (Figure 6(a)). As expected, over-expression of miR-125a promotes mycobacterial survival during M.tb infection. However, this effect was restrained by co-transfecting pcDNA-TRAF6 and miR-125a mimics (Figure 6(b)). In addition, the inhibitory effect on cytokine secretion of miR-125a was completely rescued by re-expression of TRAF6, indicating that miR-125a exerts its effect primarily through its ability to inhibit TRAF6 expression. (Figure 6(c-f)). Overall, these data revealed that miR-125a enhances mycobacterial survival and suppress cytokine secretion directly through targeting TRAF6.

Figure 6.

Figure 6.

TRAF6 abrogated the effects of miR-125a on mycobacterial survival and inflammatory response. RAW264.7 and THP-1 cells were co-transfected with miR-125a mimics, pcDNA-TRAF6, or pcDNA-vector. 24hr after transfection, cells were infected with H37v at MOI of 10. (a) Western blot analysis for TRAF6 expression. **p < 0.01 vs blank group; ##p < 0.01 vs miR-125a mimics group. 24hr post-infection, cells were harvested for CFU assay (b). Supernatant was collected to measure TNF-α(C), IL-6 (D), IFN-γ(E) and IL-1β(F) secretion. *p < 0.05, **p < 0.01 vs blank group; ##p < 0.01 vs miR-125a mimics group. All data represent the mean value± SD of at least three independent experiments.

MiR-125a suppresses the M.tb-induced NF-κB signaling in macrophages through targeting TRAF6

Finally, we tried to determine the influence of miR-125a on NF-κB signaling. We co-transfected miR-125a mimics or its negative control (NC) with the luciferase reporter that contained NF-κB binding sites in its promoter. Compared with the mimics NC, miR-125a mimics-transfected RAW264.7 and THP-1 cells displayed a significantly lower NF-κB reporter activity in response to M.tb infection (Figure 7(a,b)). In contrast, when we co-transfected miR-125a with TRAF6 over-expression vector, the suppressive effect of miR-125a on NF-κB reporter activity was completely abolished (Figure 7(a,b)). Further, the impact of miR-125a on the signaling molecules of NF-κB pathway was investigated. As reported, M.tb infection led to a significant increase in the phosphorylation level of IκBα and p65 in control cells (Figure 6(c,d)), indicating the activation of NF-κB signaling. Notably, the phosphorylation of IκBα and p65 was much less evident in miR-125a overexpressed-cells, compared with the control cells. Further, ectopic expression of TRAF6 totally rescued the inhibitory effect on signaling molecules of miR-125a (Figure 6(c,d)). Collectively, these data indicate that miR-125a negatively regulates NF-κB signaling through targeting TRAF6. Together with our results before, it is reasonable for us to present a novel mechanism for M.tb survival in which miR-125a inhibits inflammatory response by suppressing the expression of TRAF6, a key molecule in NF-κB signaling, thus promotes the survival of M.tb (Figure 8).

Figure 7.

Figure 7.

MiR-125a suppresses the M.tb-induced NF-κB signaling in Macrophages. (A-B) Raw264.7 cells and THP-1 cells were first transfected with miR-125a mimics alone or along with pcDNA-TRAF6, followed by co-transfection of pRL-TK and pNF-κB-Luc, H37Rv infection, and analysis for luciferase activity. *p < 0.05, **p < 0.01vs mimics NC group, ##p < 0.01 vs miR-125a mimics group. (C-D) Raw264.7 cells and THP-1 cells transfected with mimics NC or miR-125a mimics or miR-125a along with pcDNA-TRAF6 were infected with H37Rv at MOI of 10 for 24 h. Cells were harvested for immunoblotting analysis. All data represent the mean value ± SD of at least three independent experiments.

Figure 8.

Figure 8.

Schemic model of how miR-125a promotes M.tb survival in macrophages. Upon M.tb infection, the expression of miR-125a was induced by TLR4. Through binding to the 3ʹ-UTR of TRAF6, it downregulates the expression level of TRAF6, leading to the suppression of NF-κB activation and host immune response to M.tb, thus enhances the survival of bacterial.

Discussion

Accumulating evidence showed that miRNAs function as considerable regulators of immune responses and participate extensively in the complicated regulations of host-pathogen interactions [35–37]. Recently, many studies have demonstrated that the expression profile of bacterial or host cell miRNAs could be modulated by a number of bacteria to favor their survival and replication [38–40]. In the current study, we found that M.tb infection robustly enhanced the expression of miR-125a in both cell lines (RAW264.7 and THP-1) and patients’ samples (Figure 1). As shown in Figure 1(a), there are still a number of other miRNAs were up-regulated. More efforts are needed in the future study to reveal their functions during M.tb infection. Notably, overexpression of miR-125a, mainly dependent on TLR4 signaling rather than TLR2 signaling in macrophages in response to M.tb infection (Figure 2), significantly enhances mycobacterial survival in Macrophages (Figure 3) as well as markedly reduced the expression of kinds of inflammatory cytokines (TNF-α, IL-6, IFN-γ and IL-1β) in both cell lines (Figure 4). However, the up-regulation mechanism of miR-125a by TLR4 remains unknown. It is possible that TLR4 alone or together with some other factors would promote the expression of miR-125a or facilitate the stability of miR-125a.MiR-125a has been characterized as a tumor suppressor in kinds of human malignances, such as ovarian cancer, hepatocellular carcinoma and gastric cancer [41–43]. However, the role of miR-125a in host-bacteria interactions remains largely unknown. Recently, miR-125 was reported to inhibit autophagy activation and antimicrobial responses during mycobacterial infection through targeting UV radiation resistance-associated gene (UVRAG) [27]. Although autophagy plays an important role in activating the antimicrobial host defense against Mycobacterium tuberculosis, the inflammation and other kinds of immune process still make a major contribution against M.tb. Hence, it is reasonable for us to confer that miR-125a could regulate the innate immune response by some undefined method. Indeed, here, we firstly found that miR-125a could target TRAF6 to attenuate the NF-kB and consequent immune response (Figure 5–7), which is in consistent with the previous finding that miR-125a-5p regulates differential activation of macrophages and inflammation [28].Though it is possible that miR-125a may have more targets during M.tb infection, our finding presents a new mechanism of miR-125a during M.tb infection to favor the survival of M.tb. In addition, we performed study in both human THP-1 cells and mouse RAW264.7 cells, and obtained similar phenomenon from these two cell lines, indicating that the function of miR-125a during M.tb infection may be highly conserved among different mammalians.

Accumulating evidences have demonstrated that several miRNAs play important roles during M.tb infection mainly via tuning the output of immune signaling pathways. Among these pathways, NF-kB Pathway is very impotant and frequently involved. For example, it has been reported that Mycobacterium tuberculosis can control miR-99b expression in infected murine dendritic cells to modulate host immunity by targeting TNF-alpha and TNFRSF-4 receptor genes [44], which were important upstream molecules of NF-kB Pathway. It is also shown that MicroRNA let-7 could modulate the immune response to Mycobacterium tuberculosis infection via regulation of A20, which is an inhibitor of the NF-kB Pathway [40]. Notably, our work revealed that miR-125a regulate the immune response by targeting TRAF6 (Figure 5–6), a pivotal regulator of NF-κB and MAP kinase pathway. Whether these different miRNAs could induce or were involved in a connected network should be further investigated.

In addition, as TRAF6 serve as a link between different pathways [34], the modulation of TRAF6 by miR-125a should affect the other cellular networks, which may feedback and make an extra contribution against M.tb. Hence, miR-125a may possess more functions during M.tb infection, and it should be investigated in future. Based on these information, it is reasonable that M.tb may utilize other miRNAs to target other members belongs or related to NF-κB pathway to evade the host immune elimination. Together, our study revealed a new mechanism for M.tb survival in which miR-125a inhibits inflammatory response by suppressing the expression of TRAF6.

Biography

Wenyi Niu and Bing Sun are responsible for the main conceive of the study and the draft of the manuscript. Mingying Li, Junwei Cui, Jian Huang and Ligong Zhang helped to design the study and performed the statistical analysis. Wenyi Niu and Bing Sun helped to revise the manuscript and participated in its design. All authors have read and approved the final manuscript

Disclosure statement

No potential conflict of interest was reported by the authors.

References

  • [1].Wilson M, Seymour R, Henderson B.. Bacterial perturbation of cytokine networks. Infect Immun. 1998;66:2401–2409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Barnes PF, Cave MD.. Molecular epidemiology of tuberculosis. N Engl J Med. 2003;349:1149–1156. [DOI] [PubMed] [Google Scholar]
  • [3].Kaufmann SH. Recent findings in immunology give tuberculosis vaccines a new boost. Trends Immunol. 2005;26:660–667. [DOI] [PubMed] [Google Scholar]
  • [4].Behar SM, Martin CJ, Nunes-Alves C, et al. Lipids, apoptosis, and cross-presentation: links in the chain of host defense against Mycobacterium tuberculosis. Microbes and Infection. 2011;13:749–756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Rohde K, Yates RM, Purdy GE, et al. Mycobacterium tuberculosis and the environment within the phagosome. Immunol Rev. 2007;219:37–54. [DOI] [PubMed] [Google Scholar]
  • [6].Wu X, Deng G, Hao X, et al. A caspase-dependent pathway is involved in Wnt/beta-catenin signaling promoted apoptosis in Bacillus calmette-guerin infected RAW264.7 macrophages. International Journal of Molecular Sciences. 2014;15:5045–5062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Lee J, Remold HG, Ieong MH, et al. Macrophage apoptosis in response to high intracellular burden of Mycobacterium tuberculosis is mediated by a novel caspase-independent pathway. J Immunol. 2006;176:4267–4274. [DOI] [PubMed] [Google Scholar]
  • [8].Fremond CM, Togbe D, Doz E, et al. IL-1 receptor-mediated signal is an essential component of MyD88-dependent innate response to Mycobacterium tuberculosis infection. J Immunol. 2007;179:1178–1189. [DOI] [PubMed] [Google Scholar]
  • [9].Dr R, Ag B, Demangel C, et al. TNF regulates chemokine induction essential for cell recruitment, granuloma formation, and clearance of mycobacterial infection. J Immunol. 2002;168:4620–4627. [DOI] [PubMed] [Google Scholar]
  • [10].Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Chen K, Rajewsky N. The evolution of gene regulation by transcription factors and microRNAs. Nat Reviews Genet. 2007;8:93–103. [DOI] [PubMed] [Google Scholar]
  • [12].He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene regulation. Nat Reviews Genet. 2004;5:522–531. [DOI] [PubMed] [Google Scholar]
  • [13].O’Connell RM, Rao DS, Baltimore D. microRNA regulation of inflammatory responses. Annu Rev Immunol. 2012;30:295–312. [DOI] [PubMed] [Google Scholar]
  • [14].Jin T, Lu Y, He QX, et al. The role of MicroRNA, miR-24, and its target CHI3L1 in Osteomyelitis caused by Staphylococcus aureus. J Cell Biochem. 2015;116:2804–2813. [DOI] [PubMed] [Google Scholar]
  • [15].Zhou X, Li X, Ye Y, et al. MicroRNA-302b augments host defense to bacteria by regulating inflammatory responses via feedback to TLR/IRAK4 circuits. Nat Commun. 2014;5:3619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Ouimet M, Koster S, Sakowski E, et al. Mycobacterium tuberculosis induces the miR-33 locus to reprogram autophagy and host lipid metabolism. Nat Immunol. 2016;17:677–686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Ni B, Rajaram MV, Lafuse WP, et al. Mycobacterium tuberculosis decreases human macrophage IFN-gamma responsiveness through miR-132 and miR-26a. J Immunology. 2014;193:4537–4547. [DOI] [PubMed] [Google Scholar]
  • [18].Iwai H, Funatogawa K, Matsumura K, et al. MicroRNA-155 knockout mice are susceptible to Mycobacterium tuberculosis infection. Tuberculosis. 2015;95:246–250. [DOI] [PubMed] [Google Scholar]
  • [19].Liu YH, Wang R, Jiang J, et al. miR-223 is upregulated in monocytes from patients with tuberculosis and regulates function of monocyte-derived macrophages. Mol Immunol. 2015;67:475–481. [DOI] [PubMed] [Google Scholar]
  • [20].Wajant H, Henkler F, Scheurich P. The TNF-receptor-associated factor family: scaffold molecules for cytokine receptors, kinases and their regulators. Cell Signal. 2001;13:389–400. [DOI] [PubMed] [Google Scholar]
  • [21].Wu Y, Liu J, Zhang Z, et al. HSP27 regulates IL-1 stimulated IKK activation through interacting with TRAF6 and affecting its ubiquitination. Cell Signal. 2009;21:143–150. [DOI] [PubMed] [Google Scholar]
  • [22].Qian Y, Commane M, Ninomiya-Tsuji J, et al. IRAK-mediated translocation of TRAF6 and TAB2 in the interleukin-1-induced activation of NFkappa B. J Biol Chem. 2001;276:41661–41667. [DOI] [PubMed] [Google Scholar]
  • [23].Sorrentino A, Thakur N, Grimsby S, et al. The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nat Cell Biol. 2008;10:1199–1207. [DOI] [PubMed] [Google Scholar]
  • [24].Darnay BG, Ni J, Moore PA, et al. Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 1999;274:7724–7731. [DOI] [PubMed] [Google Scholar]
  • [25].Nelson DE, Ihekwaba AE, Elliott M, et al. Oscillations in NF-kappaB signaling control the dynamics of gene expression. Science. 2004;306:704–708. [DOI] [PubMed] [Google Scholar]
  • [26].Li Q, Verma IM. NF-kappaB regulation in the immune system. Nat Reviews Immunol. 2002;2:725–734. [DOI] [PubMed] [Google Scholar]
  • [27].Kim JK, Yuk JM, Kim SY, et al. MicroRNA-125a inhibits autophagy activation and antimicrobial responses during Mycobacterial infection. J Immunol. 2015;194:5355–5365. [DOI] [PubMed] [Google Scholar]
  • [28].Banerjee S, Cui H, Xie N, et al. miR-125a-5p regulates differential activation of macrophages and inflammation. J Biol Chem. 2013;288:35428–35436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Means TK, Jones BW, Schromm AB, et al. Differential effects of a Toll-like receptor antagonist on Mycobacterium tuberculosis-induced macrophage responses. J Immunol. 2001;166:4074–4082. [DOI] [PubMed] [Google Scholar]
  • [30].Sanchez D, Rojas M, Hernandez I, et al. Role of TLR2- and TLR4-mediated signaling in Mycobacterium tuberculosis-induced macrophage death. Cell Immunol. 2010;260:128–136. [DOI] [PubMed] [Google Scholar]
  • [31].Zhang ZM, Zhang AR, Xu M, et al. TLR-4/miRNA-32-5p/FSTL1 signaling regulates mycobacterial survival and inflammatory responses in Mycobacterium tuberculosis-infected macrophages. Exp Cell Res. 2017;352:313–321. [DOI] [PubMed] [Google Scholar]
  • [32].O’Neill LA, Sheedy FJ, McCoy CE. MicroRNAs: the fine-tuners of Toll-like receptor signalling. Nat Reviews Immunol. 2011;11:163–175. [DOI] [PubMed] [Google Scholar]
  • [33].Liu Z, Zhou G, Deng X, et al. Analysis of miRNA expression profiling in human macrophages responding to Mycobacterium infection: induction of the immune regulator miR-146a. J Infect. 2014;68:553–561. [DOI] [PubMed] [Google Scholar]
  • [34].Walsh MC, Lee J, Choi Y. Tumor necrosis factor receptor- associated factor 6 (TRAF6) regulation of development, function, and homeostasis of the immune system. Immunol Rev. 2015;266:72–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Guo XK, Zhang Q, Gao L, et al. Increasing expression of MicroRNA 181 inhibits porcine reproductive and respiratory syndrome virus replication and has implications for controlling virus infection. J Virol. 2013;87:1159–1171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Zhang GL, Li YX, Zheng SQ, et al. Suppression of hepatitis B virus replication by microRNA-199a-3p and microRNA-210. Antiviral Res. 2010;88:169–175. [DOI] [PubMed] [Google Scholar]
  • [37].Wang SF, Qiu LP, Yan XL, et al. Loss of microRNA 122 expression in patients with hepatitis B enhances hepatitis B virus replication through cyclin G1-modulated P53 activity. Hepatology. 2012;55:730–741. [DOI] [PubMed] [Google Scholar]
  • [38].Maudet C, Mano M, Sunkavalli U, et al. Functional high-throughput screening identifies the miR-15 microRNA family as cellular restriction factors for Salmonella infection. Nat Commun. 2014;5:4718. [DOI] [PubMed] [Google Scholar]
  • [39].Chen Z, Wang T, Liu Z, et al. Inhibition of autophagy by MiR-30A induced by Mycobacteria tuberculosis as a possible mechanism of immune escape in human macrophages. Jpn J Infect Dis. 2015;68:420–424. [DOI] [PubMed] [Google Scholar]
  • [40].Kumar M, Sahu SK, Kumar R, et al. MicroRNA let-7 modulates the immune response to Mycobacterium tuberculosis infection via control of A20, an inhibitor of the NF-kappaB pathway. Cell Host Microbe. 2015;17:345–356. [DOI] [PubMed] [Google Scholar]
  • [41].Bi Q, Tang S, Xia L, et al. Ectopic expression of MiR-125a inhibits the proliferation and metastasis of hepatocellular carcinoma by targeting MMP11 and VEGF. PloS One. 2012;7:e40169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Cowden Dahl KD, Dahl R, Kruichak JN, et al. The epidermal growth factor receptor responsive miR-125a represses mesenchymal morphology in ovarian cancer cells. Neoplasia. 2009;11:1208–1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Shang H, Wang T, Shang F, et al. A germline mutation in the miR125a coding region reduces miR125a expression and is associated with human gastric cancer. Mol Med Rep. 2014;10:1839–1844. [DOI] [PubMed] [Google Scholar]
  • [44].Singh Y, Kaul V, Mehra A, et al. Mycobacterium tuberculosis controls microRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity. J Biol Chem. 2013;288:5056–5061. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cell Cycle are provided here courtesy of Taylor & Francis

RESOURCES