Skip to main content
Advanced Pharmaceutical Bulletin logoLink to Advanced Pharmaceutical Bulletin
. 2018 Aug 29;8(3):429–435. doi: 10.15171/apb.2018.050

Effect of Ghrelin on Caspase 3 and Bcl2 Gene Expression in H2O2 Treated Rat’s Bone Marrow Stromal Cells

Alireza Abdanipour 1, Masoud Dadkhah 2, Mohsen Alipour 2, Hadi Feizi 2,*
PMCID: PMC6156489  PMID: 30276139

Abstract

Purpose: The antiapoptotic effect of ghrelin in various cell lines including bone marrow stromal cells (BMSCs) has been proved. However, the real mechanism of this effect is not clear. Caspase3 and Bcl2 are well-known pro- and antiapoptotic regulatory genes in eukaryotes. The aim of the study was to find out the effect of ghrelin on Caspase 3 and Bcl2 change in BMSCs.

Methods: Rat BMSCs were cultivated in DMEM. Passage 3 BMSCs were treated with ghrelin 100 μM for 48 h. Real-time PCR for Caspase 3 and Bcl2 was carried out from B (untreated BMSCs), BH (BMSCs treated with 125 µM H2O2), BGH (BMSCs treated with 100 µM ghrelin then 125 µM H2O2) and BG (BMSCs treated with 100 µM ghrelin) groups. For immunofluorescence, cells were incubated with anti Caspase 3 and Bcl2monoclonal antibodies. Primary antibodies were visualized using the FITC method. All data are presented as means ± SEM. Values of P<0.05 were considered statistically significant.

Results: Ghrelin decreased mRNA expressions of Caspase-3 significantly as compared to the BH group (P<0.05). Also, Bcl-2 gene expression showed an increment in BG group as compare with BH and BGH groups (P<0.05). A high present of Bcl-2 positive cells were observed in the BGH group while Caspase-3 positive cells were significantly decreased in the BGH group compared with the BH group (P<0.05).

Conclusion: Ghrelin probably enhances BMSCs viability through regulation of pro- and antiapoptotic genes Caspase 3 and Bcl2. However the signaling pathway of this effect should be elucidated in the future.

Keywords: Ghrelin, Caspase 3, Bcl2, H2O2, Rat, BMSCs

Introduction

Ghrelin is an endogenous peptide that has some well known physiological functions especially in controlling the metabolism and food intake.1 It acts through a receptor belong to G protein-coupled receptors named GSR1α.2 This receptor has been found in different tissues including kidneys, adrenal glands, thyroid, breast, ovary, placenta, testis, prostate, liver, gallbladder, lung, skeletal muscles, myocardium, skin, and bone.3 Since its discovery, ghrelin has been shown to be involved in many physiological and pathophysiological roles such as regulation of glucose and lipid metabolism, modulation of immunity, stimulation of gastric motility, cardiovascular function, modulation of appetite, stress, anxiety, taste sensation and behavior in nervous system, as well as metabolic complications, chronic inflammation, gastroparesis or cancer-associated anorexia and cachexia.4,5 One of the recently introduced roles of ghrelin is the antiapoptotic and cell injury protection.6

Bone marrow stromal cells (BMSCs) are a population of progenitor cells for skeletal tissue constituents.7 These cells are capable to differentiate into bone, cartilage, and adipocytes.8 BMSCs also support hematopoietic stem cells structurally and physiologically.9 BMSCs have been applied in several cell therapy strategies in order to tissue repair and functional recovery.10,11 Therefore, autologous BMSCs can be isolated from bone marrow and used as a credible source of stem cells for restoring injured tissue function. However, previous studies have shown that transplanted BMSCs do not accommodate well within diseased tissues.12 There is evidence that these cells are suffered due to host immune responses and die because of apoptosis.13

Apoptosis is a programmed cell-suicide in which some gene products are responsible as apoptotic effectors proteins and some of them act as antiapoptosis regulators.14 Caspases are a gene family that acts in a cascade manner and caspase3 is one of the final effectors leading to apoptosis.15 Among the anti‏-apoptotic genes, Bcl2 is considered to be one of the most important and well-known genes.16 Due to the apoptosis inducers, oxidative stress is a common cause and H2O2 is a mediator of this phenomenon.17

Recently we have shown that ghrelin increases the BMSCs viability and protect them against the H2O2 induced damage.18 Consequently, using ghrelin, as an endogenous peptide, that enhances BMSC’s resistance to apoptosis would improve the therapeutic potential of these cells. However, to find out the mechanism of this phenomenon, in the present study we are going to examine the probable effects of this peptide on the Caspase 3 and Bcl2 gene expression in H2O2 treated rat’s BMSCs.

Materials and Methods

BMSCs culture and drug treatments

Male Wistar rat of 4-6 weeks were sacrificed under deep anesthesia using ketamine–xylazine (K, 100 mg/kg; X, 10 mg/kg). The lower limbs were removed with a pair of scissors separating it from the hip joint and put on a sterile gauze. The accompanied soft tissue (muscles, fasciae, and tendons) was removed, and femurs and tibiae were separated and put in a dish containing phosphate buffered saline (PBS, Gibco, Life Technologies, USA) and penicillin/streptomycin (Gibco, Life Technologies, USA). The dish was transferred under a laminar hood. The bones were subsequently washed again with PBS and put on a sterile gauze to dry. Both ends of the bones were cut, then with an insulin syringe containing high glucose Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Life Technologies, USA) and 1% penicillin/streptomycin, all the contents of the bone’s lumen were flushed directly to 25 cm2 culture flask (SPL, life sciences, Korea) without any additional manipulation. The flushing was done several times, so that the lumen became pale. Rat BMSCs were initially cultivated in DMEM (Dulbecco's Modified Eagle Medium), supplemented with 20% FBS (Gibco), 100 U/ml penicillin, and 100 mg/ml streptomycin in 4 experimental groups as B (untreated BMSCs), BH (BMSCs treated with 125 µM H2O2), BG (BMSCs treated with 100 µM ghrelin) and BGH (BMSCs treated with 100 µM ghrelin then 125 µM H2O2). The cells were incubated at 37°C (5% CO2) in 25 cm2 plastic flask. The medium refreshed every 2-3 days until cells became confluent. The cells were harvested with trypsin–EDTA and passaged up to three times. To induce BMSC, ghrelin was freshly prepared. Passage 3 BMSCs were cultured in 96-well plates (5000 cells/well) in DMEM medium supplemented with different concentration of ghrelin (0.1, 1, 10 and 100 μM) for 24 and 48 h.

Real-time PCR

Real-time PCR was carried out with RNA from B (untreated BMSCs), BH (BMSCs treated with 125 µM H2O2), BGH (BMSCs treated with 100 µM ghrelin then 125 µM H2O2) and BG (BMSCs treated with 100 µM ghrelin) groups. In all groups, 1,000 ng purified RNA from cultured cells was used to synthesize 20 μlcDNA, using Revert aid™ first strand cDNA synthesis kit (Fermentas, Germany) according to the manufacturer’s instructions. cDNA (25ng) was used to quantify Caspase3 and Bcl2 mRNA levels. As an internal control, primers for GAPDH were used. All primers have been listed in Table 1. The PCR reaction was synthesized in a 12.5μl volume (sense and anti-sense primers, cDNA, Sybr green,) and carried out for 40 cycles (Applied Biosystems cycler). For analyzing relative changes in mRNA levels, we used the delta CT method (Pfaffl method).

Table 1. Sequences of Oligonucleotide Primers .

Name Sequence (5' → 3')
Caspase3 (Forward) GGTATTGAGACAGACAGTGG
Caspase3 (Reverse) CATGGGATCTGTTTCTTTGC
Bcl2 (Reverse) ATCGCTCTGTGGATGACTGAGTAC
Bcl2 (Reverse) AGAGACAGCCAGGAGAAATCAAAC
GAPDH (Forward) CAAGGTCATCCATGACAACTTTG
GAPDH (Reverse) GTCCACCACCCTGTTGCTGTAG

Immunostaining

BMSCs were cultured on cover slides and fixed in 3% paraformaldehyde for 20 min at RT, followed by a permeabilization step in 100% methanol for 30 min at RT (room temperature). For immunofluorescence, cells were incubated with anti-CD90 (for BMSCs) and Anti-Caspase3 and Bcl2 (for produced erythroid Progenitor Cells) monoclonal antibodies, followed by incubation with a fluorescein isothiocyanate (FITC)–conjugated Rabbit anti-Mouse antibody (millipore). Nuclei were counterstained with DAPI. For indirect immunoperoxidase labeling, 100 µM treated BMSCs (for 48 h) were permeabilized with 0.4% Triton X-100, followed by FCS 10% for 60 minutes to block endogenous peroxidase. Then were incubated with anti-CD90 and Caspase3 and Bcl2 antibodies overnight at 4°C. Primary antibodies were visualized using the FITC method.

Statistics

Statistical analysis was performed using the SPSS15 software. All data are presented as means ± SEM. To compare multiple means in groups, one-way ANOVA followed by Tukey's post hoc comparison was used. Values of P<0.05 were considered statistically significant.

Results

BMSCs expansion and identification

The Ethics Committee for animal studies at the University of Zanjan University (ZUMS) confirmed the experiment conducted in this study. The primary culture of the isolated BMSCs is presented in Figure 1-A-D. The results showed, after 12 hours, the cells were attached to the flask and most of them were rounded (Figure 1-A). Adherent cells were cultured and became heterogeneous after 12 or 16 days (passage 4) (Figure 1-D). Following, the cells were immunostained with anti-CD90 (mesenchymal stem cells markers) antibody and incubated with FITC conjugated secondary antibody. The result showed, 100% of the cells were immunoreactive to CD90 (Figure 1-E, F).

Figure 1.

Figure 1

Micrographs of bone marrow stromal cells (BMSCs).Ain primary culture the BMSCs had round shapes (after 12 hrs). B; The cells are fibroblast-like cells after 48 hours. C; Cells at the stage of the first passage and formation of colonies. D; BMSCs have a more uniform spindle shape after 4 passages. E, D; represents Phase contrast micrographs of BMSCs and immunostaining of CD90 at same field respectively. The cells were immunostained with relevant primary antibodies and labeled with FITC-conjugated secondary antibody (green color shows positive cells) and the red colors are ethidium bromide counterstaining of the nuclei

Bcl-2 and Caspase-3 genes expression rates

Decreasing of both genes expressions in BGH and other groups (BH and BG) at 48 hrs were confirmed by quantitative real-time RT-PCR. The results of the mRNA expression pattern have been shown in the (Figure 2). Our data showed that mRNA expressions of Caspase-3 gene significantly decreasing when Ghrelin was used (BGH;0.83 ± 0.09, BG; 1.04 ± 0.07) as compare to the BH group (1.97 ± 0.14). Also, the result showed, increasing of the Bcl-2 gene in BG group (1.89 ± 0.12) as compare with BH (0.57 ± 0.05) and BGH (0.47 ± 0.06).

Figure 2.

Figure 2

Bcl-2 and Caspase-3 genes expression. Fold change ratio of Bcl-2 and Caspase-3mRNA of BMSCs treated with 100 µM concentrations of Ghrelin for 48 hrs and various experimental groups. Real-time PCR results have been presented as relative expression normalized to GAPDH mRNA amplification. Amplification of the Bcl-2 and Caspase-3 mRNA derived from BH, BG and BGH groups showing increases level of Bcl-2 mRNA and decreasing Caspase-3mRNAin the BG and (BG, BGH) groups respectively. The bars indicate the mean ± SEM. P<0.05 *(compared to BG group), **(compared to BH group). B (untreated BMSCs), BH (BMSCs treated with 125 µM H2O2), BG (BMSCs treated with 100 µM ghrelin) and BGH (BMSCs treated with 100 µM ghrelin then 125 µM H2O2)

Immunostaining of Bcl-2 and Caspase-3

To determine the protective effect of Ghrelin, Bcl-2 and Caspase-3 protein expression were detected using immunocytochemistry technique. The results were shown in the Figures 3 and 4. The percentage of Bcl-2 (Figure 3 left panel) and Caspase-3 (Figure 3 right panel) Positive cells were calculated in 5 samples. A high present of Bcl-2 (9.52 ± 1.31) and Caspase-3 (37.01 ± 2.15) positive cells were observed in the BGH and BH groups respectively. But the low percentage of Bcl-2 (1.46 ± 0.68) positive cells were visible in the B group. The percentage of Caspase-3 positive cells was significantly decreased in the BGH group (26.09 ± 2.8) compared with the BH group (37.02 ± 2.15).

Figure 3.

Figure 3

Bcl-2 and Caspase-3 protein expression. Representative immunostaning-photomicrographs showing Bcl-2 (left panel) and Caspase-3 (right panel) immunoreactivity in the B, BG, BH and BGH experimental groups after 48 hrs of treatments. Red arrows indicate to immunopositive cells and yellow arrows indicate to negative cells. Magnification, 200×. B (untreated BMSCs), BH (BMSCs treated with 125 µM H2O2), BG (BMSCs treated with 100 µM ghrelin) and BGH (BMSCs treated with 100 µM ghrelin then 125 µM H2O2)

Figure 4.

Figure 4

represents the histogram of the mean percentage of the Bcl-2 and Caspase-3 protein positive cells in the B, BG, BH and BGH experimental groups. The bars indicate the mean ± SEM; P<0.05,*(compared to BH group), Ω (compared to BGH group). B (untreated BMSCs), BH (BMSCs treated with 125 µM H2O2), BG (BMSCs treated with 100 µM ghrelin) and BGH (BMSCs treated with 100 µM ghrelin then 125 µM H2O2)

Discussion

According to the results of the current study, ghrelin (100µM) significantly decreased both gene expression and protein production of Caspase-3 in H2O2 suffered BMSCs. Ghrelin treatment also enhanced BCl2 production in these cells. As mentioned previously we have detected an antiapoptotic effect for ghrelin in BMSCs during similar condition.18 Thus the presented results could justify our former finding. It has been proved that H2O2 induces apoptosis in BMSCs and this injury could be restored by melatonin via Bax/Bcl-2 ratio suppression and caspase-3 inactivation.19 Our results are consistent with the following studies in the text however they have been performed in different cells and treatment situations.

It has been demonstrated by Baldanzi et al. that ghrelin inhibits cell death in cardiomyocytes and endothelial cells and they showed that this effect was through ERK1/2 and PI 3-kinase/AKT pathways.20 As reported by Yang et al., ghrelin repressed apoptosis signal-regulating kinase 1 activity in PC12 cells and thus caspase 3 inhibitions through heat-shock protein 70 upregulation.21 It has been shown that ghrelin inhibits apoptosis in pancreatic β cell line HIT-T15. This effect was achieved via activation of MAPK and Akt pathways. Ghrelin also increased Bcl-2, decreased Bax, and suppressed caspase-3 activation in this cell.22 Moreover, it has been revealed that ghrelin (1000 ng/ml) in a dose-dependent manner inhibits TNF-alpha-induced apoptosis of vascular smooth muscle cells.23 Previous studies have shown that ghrelin treatment diminishes diabetes-induced cell death in lactotrophs through caspase-8 inhibition and increasing Bcl-2 levels.24

Bando and coworkers indicated that streptozotocin treated transgenic (RIP-GG Tg) mice, which have elevated pancreatic ghrelin levels, showed a significant elevation in pancreatic insulin mRNA expression. Furthermore, β-cell numbers increased in islets.25 Han and colleagues have shown that ghrelin administration (10−8−8M) combined with intramyocardial injection of adipose-derived mesenchymal stem cells (ADMSCs) inhibited cardiomyocyte apoptosis. Ghrelin increased ADMSCs survival under hypoxia/serum deprivation (H/SD) injury. It also decreased the proapoptotic protein Bax and increased the antiapoptotic protein Bcl-2 in vitro, and these effects were eliminated by PI3K inhibitor LY294002.26 Furthermore, it has been reported that ghrelin could reverse rotenone-induced neurotoxicity in MES23.5 cells through improving the mitochondrial dysfunction and finally inhibition of caspase-3 activation and apoptosis.27 In a study by Zhang and his group, ghrelin (0.1 μM) inhibited dexamethasone-induced apoptosis in INS-1 cells. It upregulated Bcl-2 and downregulated Bax expression, and decreased caspase-3 activity. Moreover, this protective effect of ghrelin was through GHS-R1a and the ERK and p38MAPKsignaling pathways.28 HOXb4 is one of the factors that its upregulation, especially in hematopoietic cells, protects them against apoptosis.29 Recently we have shown that ghrelin upregulates HOXB4 gene expression in the rat BMSCs.30 These mentioned in vitro studies which imply the antiapoptotic effect of ghrelin are matching with some in vivo studies.31-33 It has been identified that ghrelin causes an antiapoptotic effect in the renal tissue of chronic hypoxic rats by increasing the Bcl2/Bax ratio.34

A couple of studies have shown the therapeutic potential of BMSCs.35 For example, BMSCs administration recovers neural tissue injury.36,37 Their involvement in bone regeneration also has been identified.38 Further investigations have shown the BMSCs beneficiary in renal injuries.39,40 Ghrelin has been shown to be protective against multiple complications in various cells.21-28 However, its effect on bone marrow stem cells has not been investigated prior to this study. We demonstrated that BMSCs treated with ghrelin are less vulnerable to oxidative stress.18 The physiological function of endogenous ghrelin in BMSCs is not clear. In the present report, the authors suggest that ghrelin changes the expression of Bcl-2 and Caspase3 under H2O2-induced stress and this may regulate BMSCs survival. Since ghrelin is an endogenous peptide with the fewer side effects, its application as co-treatment in the medium could be valuable in developing the cell therapy strategies.

Conclusion

Ghrelin probably enhances BMSCs viability through regulation of pro- and antiapoptotic genes Caspase 3 and Bcl2. However, the signaling pathway and in vivo application of this effect should be elucidated in future.

Acknowledgments

The results described in this paper were part of student thesis (Masoud Dadkhah) for MSc degree in physiology. The authors would like to thank the Vice-Chancellery for Research affairs of Zanjan University of Medical Sciences for financial support (grant no.A-10-141-7).

Ethical Issues

All the experiments were carried out under the ethical guidelines of Zanjan University of Medical Sciences (ZUMS.REC.1394.147).

Conflict of Interest

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

References

  • 1.Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature. 1999;402(6762):656–60. doi: 10.1038/45230. [DOI] [PubMed] [Google Scholar]
  • 2.Albarran-Zeckler RG, Smith RG. The ghrelin receptors (GHS-R1a and GHS-R1b) Endocr Dev. 2013;25:5–15. doi: 10.1159/000346042. [DOI] [PubMed] [Google Scholar]
  • 3.Gnanapavan S, Kola B, Bustin SA, Morris DG, McGee P, Fairclough P. et al. The tissue distribution of the mRNA of ghrelin and subtypes of its receptor, GHS-R, in humans. J Clin Endocrinol Metab. 2002;87(6):2988. doi: 10.1210/jcem.87.6.8739. [DOI] [PubMed] [Google Scholar]
  • 4. Collden G, Tschop MH, Muller TD. Therapeutic potential of targeting the ghrelin pathway. Int J Mol Sci 2017;18(4). doi: 10.3390/ijms18040798 [DOI] [PMC free article] [PubMed]
  • 5.Omrani H, Alipour MR, Mohaddes G. Ghrelin improves antioxidant defense in blood and brain in normobaric hypoxia in adult male rats. Adv Pharm Bull. 2015;5(2):283–8. doi: 10.15171/apb.2015.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Frago LM, Baquedano E, Argente J, Chowen JA. Neuroprotective actions of ghrelin and growth hormone secretagogues. Front Mol Neurosci. 2011;4:23. doi: 10.3389/fnmol.2011.00023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Krebsbach PH, Kuznetsov SA, Bianco P, Robey PG. Bone marrow stromal cells: Characterization and clinical application. Crit Rev Oral Biol Med. 1999;10(2):165–81. doi: 10.1177/10454411990100020401. [DOI] [PubMed] [Google Scholar]
  • 8.Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromal stem cells: Nature, biology, and potential applications. Stem Cells. 2001;19(3):180–92. doi: 10.1634/stemcells.19-3-180. [DOI] [PubMed] [Google Scholar]
  • 9.Anthony BA, Link DC. Regulation of hematopoietic stem cells by bone marrow stromal cells. Trends Immunol. 2014;35(1):32–7. doi: 10.1016/j.it.2013.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hu X, Yu SP, Fraser JL, Lu Z, Ogle ME, Wang JA. et al. Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis. J Thorac Cardiovasc Surg. 2008;135(4):799–808. doi: 10.1016/j.jtcvs.2007.07.071. [DOI] [PubMed] [Google Scholar]
  • 11.Mahmood A, Lu D, Chopp M. Marrow stromal cell transplantation after traumatic brain injury promotes cellular proliferation within the brain. Neurosurgery. 2004;55(5):1185–93. doi: 10.1227/01.neu.0000141042.14476.3c. [DOI] [PubMed] [Google Scholar]
  • 12.Geng YJ. Molecular mechanisms for cardiovascular stem cell apoptosis and growth in the hearts with atherosclerotic coronary disease and ischemic heart failure. Ann N Y Acad Sci. 2003;1010:687–97. doi: 10.1196/annals.1299.126. [DOI] [PubMed] [Google Scholar]
  • 13.Zeng X, Yu SP, Taylor T, Ogle M, Wei L. Protective effect of apelin on cultured rat bone marrow mesenchymal stem cells against apoptosis. Stem Cell Res. 2012;8(3):357–67. doi: 10.1016/j.scr.2011.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Elmore S. Apoptosis: A review of programmed cell death. Toxicol Pathol. 2007;35(4):495–516. doi: 10.1080/01926230701320337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lee G, Kim J, Kim Y, Yoo S, Park JH. Identifying and monitoring neurons that undergo metamorphosis-regulated cell death (metamorphoptosis) by a neuron-specific caspase sensor (Casor) in drosophila melanogaster. Apoptosis. 2018;23(1):41–53. doi: 10.1007/s10495-017-1435-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Basu A, DuBois G, Haldar S. Posttranslational modifications of bcl2 family members--a potential therapeutic target for human malignancy. Front Biosci. 2006;11:1508–21. doi: 10.2741/1900. [DOI] [PubMed] [Google Scholar]
  • 17.Abdanipour A, Tiraihi T, Noori-Zadeh A, Majdi A, Gosaili R. Evaluation of lovastatin effects on expression of anti-apoptotic Nrf2 and PGC-1α genes in neural stem cells treated with hydrogen peroxide. Mol Neurobiol. 2014;49(3):1364–72. doi: 10.1007/s12035-013-8613-5. [DOI] [PubMed] [Google Scholar]
  • 18.Abdanipour A, Shahsavandi B, Dadkhah M, Alipour M, Feizi H. The antiapoptotic effect of ghrelin in the H2O2 treated Bone Marrow-derived Mesenchymal Stem cells of rat. J Zanjan Univ Med Sci Health Serv. 2017;25(113):58–68. [Google Scholar]
  • 19.Wang FW, Wang Z, Zhang YM, Du ZX, Zhang XL, Liu Q. et al. Protective effect of melatonin on bone marrow mesenchymal stem cells against hydrogen peroxide-induced apoptosis in vitro. J Cell Biochem. 2013;114(10):2346–55. doi: 10.1002/jcb.24582. [DOI] [PubMed] [Google Scholar]
  • 20.Baldanzi G, Filigheddu N, Cutrupi S, Catapano F, Bonissoni S, Fubini A. et al. Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT. J Cell Biol. 2002;159(6):1029–37. doi: 10.1083/jcb.200207165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yang M, Hu S, Wu B, Miao Y, Pan H, Zhu S. Ghrelin inhibits apoptosis signal-regulating kinase 1 activity via upregulating heat-shock protein 70. Biochem Biophys Res Commun. 2007;359(2):373–8. doi: 10.1016/j.bbrc.2007.05.118. [DOI] [PubMed] [Google Scholar]
  • 22.Zhang Y, Ying B, Shi L, Fan H, Yang D, Xu D. et al. Ghrelin inhibit cell apoptosis in pancreatic beta cell line hit-t15 via mitogen-activated protein kinase/phosphoinositide 3-kinase pathways. Toxicology. 2007;237(1-3):194–202. doi: 10.1016/j.tox.2007.05.013. [DOI] [PubMed] [Google Scholar]
  • 23.Zhan M, Yuan F, Liu H, Chen H, Qiu X, Fang W. Inhibition of proliferation and apoptosis of vascular smooth muscle cells by ghrelin. Acta Biochim Biophys Sin (Shanghai) 2008;40(9):769–76. [PubMed] [Google Scholar]
  • 24.Granado M, Chowen JA, Garcia-Caceres C, Delgado-Rubin A, Barrios V, Castillero E. et al. Ghrelin treatment protects lactotrophs from apoptosis in the pituitary of diabetic rats. Mol Cell Endocrinol. 2009;309(1-2):67–75. doi: 10.1016/j.mce.2009.06.006. [DOI] [PubMed] [Google Scholar]
  • 25.Bando M, Iwakura H, Ariyasu H, Koyama H, Hosoda K, Adachi S. et al. Overexpression of intraislet ghrelin enhances β-cell proliferation after streptozotocin-induced β-cell injury in mice. Am J Physiol Endocrinol Metab. 2013;305(1):E140–8. doi: 10.1152/ajpendo.00112.2013. [DOI] [PubMed] [Google Scholar]
  • 26.Han D, Huang W, Ma S, Chen J, Gao L, Liu T. et al. Ghrelin improves functional survival of engrafted adipose-derived mesenchymal stem cells in ischemic heart through PI3K/Akt signaling pathway. Biomed Res Int. 2015;2015:858349. doi: 10.1155/2015/858349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yu J, Xu H, Shen X, Jiang H. Ghrelin protects mes23.5 cells against rotenone via inhibiting mitochondrial dysfunction and apoptosis. Neuropeptides. 2016;56:69–74. doi: 10.1016/j.npep.2015.09.011. [DOI] [PubMed] [Google Scholar]
  • 28.Zhang C, Li L, Zhao B, Jiao A, Li X, Sun N. et al. Ghrelin protects against dexamethasone-induced ins-1 cell apoptosis via erk and p38mapk signaling. Int J Endocrinol. 2016;2016:4513051. doi: 10.1155/2016/4513051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Park SW, Won KJ, Lee YS, Kim HS, Kim YK, Lee HW. et al. Increased hoxb4 inhibits apoptotic cell death in pro-b cells. Korean J Physiol Pharmacol. 2012;16(4):265–71. doi: 10.4196/kjpp.2012.16.4.265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Abdanipour A, Shahsavandi B, Alipour M, Feizi H. Ghrelin upregulates Hoxb4 gene expression in rat bone marrow stromal cells. Cell J. 2018;20(2):183–7. doi: 10.22074/cellj.2018.5164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rak A, Gregoraszczuk EL. Modulatory effect of ghrelin in prepubertal porcine ovarian follicles. J Physiol Pharmacol. 2008;59(4):781–93. [PubMed] [Google Scholar]
  • 32.Park JM, Kakimoto T, Kuroki T, Shiraishi R, Fujise T, Iwakiri R. et al. Suppression of intestinal mucosal apoptosis by ghrelin in fasting rats. Exp Biol Med (Maywood) 2008;233(1):48–56. doi: 10.3181/0706-rm-169. [DOI] [PubMed] [Google Scholar]
  • 33.Koyuturk M, Sacan O, Karabulut S, Turk N, Bolkent S, Yanardag R. et al. The role of ghrelin on apoptosis, cell proliferation and oxidant-antioxidant system in the liver of neonatal diabetic rats. Cell Biol Int. 2015;39(7):834–41. doi: 10.1002/cbin.10464. [DOI] [PubMed] [Google Scholar]
  • 34.Almasi S, Shahsavandi B, Aliparasti MR, Alipour MR, Rahnama B, Feizi H. The antiapoptotic effect of ghrelin in the renal tissue of chronic hypoxic rats. Physiol Pharmacol. 2015;19(2):114–20. [Google Scholar]
  • 35.Brooke G, Cook M, Blair C, Han R, Heazlewood C, Jones B. et al. Therapeutic applications of mesenchymal stromal cells. Semin Cell Dev Biol. 2007;18(6):846–58. doi: 10.1016/j.semcdb.2007.09.012. [DOI] [PubMed] [Google Scholar]
  • 36.Bang OY, Lee JS, Lee PH, Lee G. Autologous mesenchymal stem cell transplantation in stroke patients. Ann Neurol. 2005;57(6):874–82. doi: 10.1002/ana.20501. [DOI] [PubMed] [Google Scholar]
  • 37.Wu J, Sun Z, Sun HS, Wu J, Weisel RD, Keating A. et al. Intravenously administered bone marrow cells migrate to damaged brain tissue and improve neural function in ischemic rats. Cell Transplant. 2008;16(10):993–1005. [PubMed] [Google Scholar]
  • 38.Zhang W, Zhu C, Wu Y, Ye D, Wang S, Zou D. et al. VEGF and BMP-2 promote bone regeneration by facilitating bone marrow stem cell homing and differentiation. Eur Cell Mater. 2014;27:1–11; discussion. doi: 10.22203/ecm.v027a01. [DOI] [PubMed] [Google Scholar]
  • 39.Liu N, Patzak A, Zhang J. Cxcr4-overexpressing bone marrow-derived mesenchymal stem cells improve repair of acute kidney injury. Am J Physiol Renal Physiol. 2013;305(7):F1064–73. doi: 10.1152/ajprenal.00178.2013. [DOI] [PubMed] [Google Scholar]
  • 40.Bi L, Wang G, Yang D, Li S, Liang B, Han Z. Effects of autologous bone marrow-derived stem cell mobilization on acute tubular necrosis and cell apoptosis in rats. Exp Ther Med. 2015;10(3):851–6. doi: 10.3892/etm.2015.2592. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Advanced Pharmaceutical Bulletin are provided here courtesy of Tabriz University of Medical Sciences

RESOURCES