Abstract
Premise of the Study
Boswellia serrata (Burseraceae) is an economically important aromatic, gum‐resin–yielding, non‐timber forest tree species. Microsatellite markers were developed for B. serrata for the first time to study genetic diversity and population structure.
Methods and Results
A magnetic bead enrichment method was used to develop 16 microsatellite markers, of which 11 were polymorphic. The number of alleles per locus in the 60 individuals studied ranged from three to 10, and the levels of observed and expected heterozygosity ranged from 0.50 to 0.90 and 0.666 to 0.861, respectively. The primers successfully amplified in the congeneric species B. ovalifoliolata.
Conclusions
These microsatellite markers can be used to study the genetic variation and population structure of B. serrata and to provide crucial information on population and ecological issues for management and conservation of the species.
Keywords: aromatic resin, Boswellia serrata, Burseraceae, microsatellites, non‐timber forest product (NTFP) species
Natural gums are one of the important non‐timber forest products (NTFP) in India. India is endowed with highly diverse gum‐yielding tree species and is a leading producer of natural gums (Basch et al., 2004). Olibanum, an oleo‐gum‐resin, is obtained from the bark of Boswellia Roxb. ex Colebr. species (Burseraceae). Boswellia serrata Roxb. ex Colebr. (Leung and Foster, 1996), one of four species in the genus Boswellia, is an endangered species that is found in dry deciduous forests of India, Pakistan, and Arabia (Ghorpade et al., 2010). It is often referred to as Indian frankincense and is locally called dhoopa or salai guggal. Boswellia serrata is a moderate‐ to large‐sized tree found in the deciduous forests of Western Ghats, Eastern Ghats, Rajasthan, Gujarat, Uttar Pradesh, and in other dry and tropical regions of India. Burning B. serrata resin as incense has been part of religious and cultural ceremonies since time immemorial. Boswellia serrata gum‐resin contains essential oils, volatile oils, sugars, and terpenes with β‐boswellic acid (Siddiqui, 2011). In recent years, B. serrata has attracted the attention of pharmacologists for the development of nonsteroidal anti‐inflammatory drugs (NSAIDs) because of its chemical constituents (Singh et al., 1996). Oleo‐gum‐resin of B. serrata is used in the treatment of ulcerative colitis, Crohn's disease, osteoarthritis, rheumatoid arthritis, joint pain (rheumatism), bursitis, abdominal pain, asthma, hay fever, sore throat, syphilis, and liver disorders; it can act as an anti‐inflammatory agent by inhibiting the synthesis of 5‐lipoxygenase (Siddiqui, 2011). Boswellia serrata extract also exhibits antibacterial, antifungal, and antimicrobial activities (Ismail et al., 2014). In recent years, it has also been used in cosmetics and perfumes.
In India, approximately 1500 tons of B. serrata gum is harvested annually (Giri et al., 2008). With increasing demand for resin, unsustainable harvesting practices, anthropogenic threats, and lack of regeneration (Tandon et al., 2010) have resulted in the rapid decline of populations of the species. Extraction of the resin by puncturing or damaging the bark can cause trees to be susceptible to pests or diseases, and indiscriminate extraction could lead to mortality. This adult mortality, in combination with fragmentation and low regeneration, threatens the persistence of the species. Boswellia serrata is now reported as a rare species in the Red Data Book of India (Modi and Mathad, 2016). Despite its economic importance, knowledge of the genetic resources of this species is scarce. Information on the genetic diversity and pattern of genetic differentiation across populations is crucial for designing appropriate conservation strategies. Addisalem et al. (2015) developed microsatellite markers for B. papyrifera. However, when we used these markers in B. serrata, we found their amplification efficiency to be low. In this study, we developed microsatellite markers for B. serrata with high efficiency and tested their applicability in the related species B. ovalifoliolata N. P. Balakr. & A. N. Henry.
Methods and results
Sample collection and DNA extraction
Fresh leaves of B. serrata were collected from three populations, Biligiri Ranganathaswamy Temple Tiger Reserve (BRT‐TR), Male Mahadeshwara Hills Wildlife Sanctuary (MM Hills WLS), and Cauvery Wildlife Sanctuary (Cauvery WLS) of Western Ghats, India, to develop genetic markers and from one population of B. ovalifoliolata, from the Seshachalam foothills of Tirupati, Andhra Pradesh, India, to check cross‐amplification (Appendix 1). Genomic DNA was extracted from leaf material using a cetyltrimethylammonium bromide (CTAB) method (Sambrook et al., 1989).
Microsatellite library construction and primer design
A microsatellite enrichment library was constructed using a magnetic bead hybridization method following Glenn and Schable (2005) with minor modifications. Total genomic DNA of one sample from BRT‐TR was digested with the restriction enzymes RsaI and XmnI (New England Biolabs, Ipswich, Massachusetts, USA). Digested products were ligated to double‐stranded SNX linkers using a rapid DNA ligation kit (Fermentas International, Thermo Fisher Scientific, Bangalore, India) and amplified with SNX primers. The amplified products were hybridized with 3′‐biotinylated microsatellite probes, and hybridized probes were captured by streptavidin‐coupled (M‐280) Dynabeads (Invitrogen, Oslo, Norway). The captured fragments containing microsatellite repeats were enriched by amplification with SNX linker‐specific primers. Enriched fragments were transformed into E. coli strain CB‐5α with the pTZ5RT vector (Thermo Fisher Scientific, Bangalore, India). Recombinant clones were identified by colony PCR using M13 primers. The PCR fragments larger than 300 bp were sequenced using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Waltham, Massachusetts, USA) at Chromous Biotech (Bangalore, India). After trimming vector and linker sequences, 216 nonredundant contig sequences were obtained, of which 68 contained microsatellite repeats. A total of 42 primer pairs were designed using the software Primer3Plus (Untergasser et al., 2007) with the following criteria: amplicon size 100–300 bp, annealing temperature 52–60°C, and GC content 40–60%.
Validation and evaluation of designed markers
Of the 42 primer pairs, 16 successfully amplified (Table 1) and were tested for polymorphism in 60 individuals of B. serrata and for cross‐amplification in 10 individuals of B. ovalifoliolata (Table 2). PCR reactions were performed in a 15‐μL reaction volume containing 10–20 ng of template DNA, 1 mM of dNTP mix, 1× polymerase buffer, 1 unit of Taq polymerase (all reagents from Bangalore Genei, Bangalore, India), and 0.2 μM of each primer. The PCR profile was as follows: an initial denaturation at 95°C for 5 min; followed by 35 cycles of 95°C for 30 s, 50–60°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. Amplicons were analyzed on an ABI 3730 Genetic Analyzer (Applied Biosystems) at Chromous Biotech (Bangalore, India) and scored using GeneMapper version 3.2 (Applied Biosystems) software.
Table 1.
Characteristics of 16 microsatellite markers developed in Boswellia serrata
| Locus | Primer sequences (5′–3′) | Repeat motif | Fluorescent label | T a (°C) | Allele size range (bp) | GenBank accession no. |
|---|---|---|---|---|---|---|
| BS6 | F: CTACGTATTGATGAGGCGGC | (GA)14 | PET | 60 | 172–228 | MG811526 |
| R: GAGATCGATGGAATTGCTGGT | ||||||
| BS8 | F: CGCCTCAGCTCACCAGTAAT | (CAAAA)4…(CAA)4 | PET | 52 | 173–209 | MG811527 |
| R: CTGCCAGAGTATGAGAAGCAA | ||||||
| BS10a | F: ACACGGGTCTGAACTCCAAC | (AAG)20 | NED | 60 | 205 | MG811542 |
| R: GGATGATTCATTCCTGGAAAA | ||||||
| BS11 | F: AACAACCAACCCATCTCACTC | (TC)7 | NED | 54 | 172–206 | MG811528 |
| R: GGTCGGTTGAGGATGGAATA | ||||||
| BS12a | F: ATCGGGTGATTCTGCTATCG | (AG)9 | HEX | 58 | 174 | MG811537 |
| R: GCAGAATCGCTACTCGATGA | ||||||
| BS13 | F: TTCCTTGGACATAGCCAAATCT | (AG)11 | 6‐FAM | 58 | 258–296 | MG811529 |
| R: GTAGACCTAGCATCTTCAGCTG | ||||||
| BS14 | F: CCGGCGCAACTTCAATAATA | (AAC)4 | 6‐FAM | 58 | 183–208 | MG811530 |
| R: ATCAGCAAGTCCGTCTGTCC | ||||||
| BS16 | F: CGCTTTCTATTTTCCTTTTTGG | (CT)15 | HEX | 50 | 118–138 | MG811531 |
| R: GCTAACGATTGACAACTGCTG | ||||||
| BS18a | F: CAACGAGAGGAGGCAGTGAT | (TC)30 | 6‐FAM | 58 | 198 | MG811540 |
| R: TTAAGGCCTGGCTAGCAGAA | ||||||
| BS19a | F: GGATCCAGCCGCAGTATATC | (TG)32 | HEX | 56 | 224 | MG811541 |
| R: TCGACAGCTCAAGGAATGTG | ||||||
| BS21a | F: CAGCCTTCCTCAATCGGATA | (TGT)12 | NED | 52 | 218 | MG811539 |
| R: AAGTCGGTCACCTCATTGGA | ||||||
| BS23 | F: CACGATGACGTGATTCTGCT | (CA)9 | NED | 52 | 188–216 | MG811532 |
| R: CAAGCTTGCACACAGGAAAA | ||||||
| BS25 | F: TCAAGCCGTTGTAGTTGGTG | (TC)15 | 6‐FAM | 52 | 206–252 | MG811533 |
| R: TGGAAGCACAGAAAGAAGCA | ||||||
| BS28 | F: CCAGCATTTTTCCTTTCTTTTT | (AAG)13 | PET | 56 | 156–185 | MG811538 |
| R: TTGCTCACGAAATCCTTCCT | ||||||
| BS29 | F: CACGATGACGTGATTCTGCT | (AG)9 | HEX | 52 | 184–228 | MG811535 |
| R: CTTACACCATCTCCCTCTGC | ||||||
| BS32 | F: CTGCCAGGCCTTAAACAAAA | (TG)17 | NED | 60 | 242–270 | MG811536 |
| R: GCAGTGGATGGGGTAGAATC |
T a = annealing temperature.
Monomorphic locus.
Table 2.
Genetic analysis of 11 polymorphic microsatellite markers developed for Boswellia serrata and cross‐amplification to B. ovalifoliolata.a
| Locus | Boswellia serrata | Boswellia ovalifoliolata | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| BRT‐TR (N = 20) | MM Hills WLS (N = 20) | Cauvery WLS (N = 20) | Seshachalam Hills (N = 10) | |||||||||||||
| A | H o | H e b | PIC | A | H o | H e b | PIC | A | H o | H e b | PIC | A | H o | H e b | PIC | |
| BS6 | 7 | 0.75 | 0.838ns | 0.817 | 8 | 0.75 | 0.851ns | 0.834 | 8 | 0.65 | 0.853ns | 0.836 | 5 | 0.7 | 0.76ns | 0.720 |
| BS8 | 3 | 0.55 | 0.666ns | 0.592 | 3 | 0.55 | 0.666ns | 0.592 | 3 | 0.5 | 0.666ns | 0.592 | 3 | 0.5 | 0.655ns | 0.580 |
| BS11 | 5 | 0.7 | 0.778ns | 0.743 | 5 | 0.7 | 0.79ns | 0.757 | 7 | 0.6 | 0.808* | 0.783 | 6 | 0.8 | 0.725ns | 0.683 |
| BS13 | 9 | 0.75 | 0.851ns | 0.835 | 8 | 0.85 | 0.855ns | 0.838 | 7 | 0.8 | 0.843ns | 0.824 | 9 | 0.8 | 0.75ns | 0.729 |
| BS14 | 5 | 0.7 | 0.795ns | 0.762 | 5 | 0.7 | 0.797ns | 0.765 | 4 | 0.8 | 0.728ns | 0.679 | 5 | 0.6 | 0.77ns | 0.730 |
| BS16 | 7 | 0.75 | 0.838ns | 0.817 | 8 | 0.75 | 0.851ns | 0.834 | 8 | 0.7 | 0.852ns | 0.834 | 5 | 0.7 | 0.76ns | 0.720 |
| BS23 | 10 | 0.75 | 0.857ns | 0.841 | 8 | 0.8 | 0.842ns | 0.823 | 10 | 0.75 | 0.861ns | 0.845 | 6 | 0.8 | 0.755ns | 0.718 |
| BS25 | 6 | 0.75 | 0.801ns | 0.771 | 7 | 0.75 | 0.833* | 0.812 | 7 | 0.75 | 0.837** | 0.817 | 6 | 0.8 | 0.8ns | 0.772 |
| BS28 | 6 | 0.65 | 0.802ns | 0.772 | 6 | 0.9 | 0.81ns | 0.784 | 4 | 0.8 | 0.728ns | 0.679 | 5 | 0.6 | 0.77ns | 0.730 |
| BS29 | 10 | 0.85 | 0.837ns | 0.819 | 6 | 0.75 | 0.831ns | 0.808 | 6 | 0.75 | 0.831ns | 0.808 | 8 | 0.9 | 0.78ns | 0.758 |
| BS32 | 10 | 0.7 | 0.851ns | 0.834 | 6 | 0.55 | 0.797ns | 0.766 | 10 | 0.65 | 0.846ns | 0.828 | 7 | 0.7 | 0.83ns | 0.808 |
| Mean (SD) | 0.718 (±0.075) | 0.81 (±0.054) | 0.782 (±0.071) | 0.731 (±0.107) | 0.811 (±0.053) | 0.783 (±0.07) | 0.704 (±0.096) | 0.805 (±0.066) | 0.775 (±0.084) | 0.718 (±0.116) | 0.759 (±0.044) | 0.722 (±0.057) | ||||
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled; PIC = polymorphism information content.
Locality and voucher information are available in Appendix 1.
Deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ns = not significant.
Population genetic diversity parameters, i.e., observed heterozygosity (H o), expected heterozygosity (H e), number of alleles per locus (A), effective number of alleles (A e), Shannon's information index, and the probability of deviations from Hardy–Weinberg equilibrium were estimated using GenAlEx 6.5 (Peakall and Smouse, 2012). Polymorphism information content (PIC) and probability of identity (PI) were calculated by CERVUS 3.0 (Kalinowski et al., 2007).
Of the 16 successfully amplified primers, 11 were found to be polymorphic, of which eight had dinucleotide, two had trinucleotide, and one had compound repeat motifs (Table 1). Significant differences were found in allele frequencies between the analyzed populations. A ranged from three to 10, and levels of H o and H e of each population ranged from 0.50 to 0.90 and 0.666 to 0.861 (Table 2), respectively. Shannon's information index values ranged from 1.098 to 2.072 and PIC ranged from 0.592 to 0.845 (Table 2), indicating that the markers designed are highly polymorphic (PIC > 0.5) and informative. The PI value is low for many loci, with the combined PI value of 2.081E‐0015 confirming their applicability for population genetic studies. Significant deviations (P < 0.05 and P < 0.01) from Hardy–Weinberg equilibrium were detected for two markers (BS11 and BS25) but were not consistent across the populations. In B. ovalifoliolata, A ranged from three to nine, H o ranged from 0.5 to 0.9, and H e ranged from 0.66 to 0.83 (Table 2). Raw genotyping data for both species are available in Appendix S1.
Conclusions
In this study, 16 microsatellite markers were developed specifically for B. serrata and 11 of these showed considerable polymorphism in all three studied populations. These markers will be useful for studying genetic diversity, gene flow, population structure, and inbreeding. The resulting information will help in developing appropriate strategies for sustainable utilization and conservation of this important resin‐yielding tree. The allelic overlap and intrageneric amplification of these microsatellite markers indicate a close relationship between B. serrata and B. ovalifoliolata, which needs support from further investigation.
Data accessibility
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1. Raw genotyping data for both species are available in Appendix S1.
Supporting information
APPENDIX S1. Genotyping data for Boswellia serrata and B. ovalifoliolata.
Acknowledgments
This work was supported by grants from the United States Agency for International Development (USAID; no. AID‐386‐A‐14‐00011). The contents are the responsibility of the authors and do not necessarily reflect the views of USAID or the United States Government. The authors acknowledge the Council of Scientific and Industrial Research (CSIR) for a financial assistance grant to B.S.M. by CSIR‐SRF. The authors acknowledge permission granted by the Karnataka Forest Department for sampling in the Biligiri Rangaswamy Temple Tiger Reserve (PCCF/[WL]/82/CR/22/2013‐14) and Male Mahadeshwara Hills Wildlife Sanctuary and Cauvery Wildlife Sanctuary (PCCF/[WL]/E2/CR/22/2014‐15).
Voucher information for Boswellia species used in this study.
| Species | Voucher specimen accession no.a | Collection locality (Code) | Geographic coordinates | n |
|---|---|---|---|---|
| Boswellia serrata Roxb. ex Colebr. | ATREEBs5925a | Biligiri Rangaswamy Temple Tiger Reserve (BRT‐TR) | 11°59′38″N, 77°8′26″E | 20 |
| B. serrata | ATREEBs5925b | Male Mahadeshwara Hills Wildlife Sanctuary (MM Hills WLS) | 12°1′50.52″N, 77°35′16.8″E | 20 |
| B. serrata | ATREEBs5925c | Cauvery Wildlife Sanctuary (Cauvery WLS) | 12°10′12″N, 77°32′34.8″E | 20 |
| B. ovalifoliolata N. P. Balakr. & A. N. Henry | ATREEBo5926a | Seshachalam Hills | 14°19′59.99″N, 78°15′0″E | 10 |
n = number of individuals sampled.
One sample per population is deposited at the ATREE Herbarium, Bangalore, India.
Maradani, B. S. , Gudasalamani R., Setty S., and R. Chandrasekaran . 2018. Development of microsatellite markers for the resin‐yielding, non‐timber forest product species Boswellia serrata (Burseraceae). Applications in Plant Sciences 6(9): e1180.
Literature cited
- Addisalem, A. B. , Esselink G. D., Bongers F., and Smulders M. J. M.. 2015. Genomic sequencing and microsatellite marker development for Boswellia papyrifera, an economically important but threatened tree native to dry tropical forests. AoB Plants 7: plu086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Basch, E. , Boon H., Davies‐Heerema T., Foppo I., Hashmi S., Hasskar J., Sollars D., and Ulbricht C.. 2004. Boswellia: An evidence‐based systematic review by the natural standard research collaboration. Journal of Herbal Pharmacotherapy 4(3): 63–83. [PubMed] [Google Scholar]
- Ghorpade, R. P. , Chopra A., and Nikam T. D.. 2010. In vitro zygotic embryo germination and propagation of an endangered Boswellia serrata Roxb., a source of boswellic acid. Physiology and Molecular Biology of Plants 16(2): 159–165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giri, S. K. , Prasad N., Pandey S. K., Prasad M., and Baboo B.. 2008. Natural resins and gums of commercial importance. Indian Institute of Natural Resins and Gums, Ranchi, Jharkhand, India. [Google Scholar]
- Glenn, T. C. , and Schable N. A.. 2005. Isolating microsatellite DNA loci. Methods in Enzymology 395: 202–222. [DOI] [PubMed] [Google Scholar]
- Ismail, S. M. , Aluru S., Sambasivarao K. R. S., and Matcha B.. 2014. Antimicrobial activity of frankincense of Boswellia serrata . International Journal of Current Microbiology and Applied Sciences 3: 1095–1101. [Google Scholar]
- Kalinowski, S. T. , Taper M. L., and Marshall T. C.. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16: 1099–1106. [DOI] [PubMed] [Google Scholar]
- Leung, A.Y. , and Foster S.. 1996. Encyclopedia of common natural ingredients used in food, drugs and cosmetics, 2nd ed., 389–391. John Wiley and Sons, New York, New York, USA. [Google Scholar]
- Modi, R. K. , and Mathad P.. 2016. Floristic diversity with reference to rare and threatened plants from the forest of Yadgir District, Karnataka, India. International Journal of Scientific Research in Science, Engineering and Technology 2(4): 2394–4099. [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–An update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sambrook, J. , Fritsch E. F., and Maniatis T.. 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA. [Google Scholar]
- Siddiqui, M. Z. 2011. Boswellia serrata, a potential anti‐inflammatory agent: An overview. Indian Journal of Pharmaceutical Sciences 73(3): 255–261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh, G. B. , Singh S., and Bani S.. 1996. Alcoholic extract of salai‐guggal ex‐Boswellia serrata, a new natural source NSAID. Drugs of Today 32(2): 109–112. [Google Scholar]
- Tandon, R. , Shivanna K. R., and Mohan Ram H. Y.. 2010. Reproductive biology of some gum producing Indian desert plants In Ramawat K. G. [ed.], Desert plants: Biology and biotechnology, 178–197. Springer‐Verlag, Berlin, Germany. [Google Scholar]
- Untergasser, A. , Nijveen H., Rao X., Bisseling T., Geurts R., and Leunissen J. A. M.. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35: 71–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
APPENDIX S1. Genotyping data for Boswellia serrata and B. ovalifoliolata.
Data Availability Statement
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1. Raw genotyping data for both species are available in Appendix S1.