Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2018 Aug 30;96(10):4471–4480. doi: 10.1093/jas/sky301

Bacillus licheniformis CK1 alleviates the toxic effects of zearalenone in feed on weaned female Tibetan piglets

Guanhua Fu 1, Lihong Wang 1, Long Li 1, Jeruei Liu 2, Suozhu Liu 3, Xin Zhao 1,4,✉
PMCID: PMC6162575  PMID: 30169611

Abstract

Zearalenone (ZEA) is widely present in feedstuffs and raw materials, causing reproductive disorders in animals. In this study, Bacillus licheniformis CK1 was used to detoxify ZEA in feed for alleviating its effect in Tibetan piglets. A total of 18 weaned female Tibetan piglets were randomly divided into 3 groups: control group (Control, ZEA-free basal diet); treatment group 1 (T1, ZEA-contaminated diet); and treatment group 2 (T2, ZEA-contaminated but pre-fermented by CK1 diet). There were no significant differences of average daily feed intake (ADFI), average daily gain (ADG), and feed efficiency (FE) among the 3 groups (P > 0.05). The T1 treatment significantly increased the vulva size and relative weight of the reproductive organ (P < 0.05), compared with the Control. However, the T2 treatment caused a significant reduction (P < 0.05) in vulva size and relative weight of the reproductive organ compared with the T1 group. The levels of luteinizing hormone (LH), follicle-stimulating hormone (FSH), progesterone (P), and estradiol (E2) in the T1 group were significantly lower (P < 0.05) than those in the Control, while the levels of LH, P, and E2 in the T2 group were significantly greater (P < 0.05) than those in the T1 group. Zearalenone significantly increased (P < 0.05) the expression of estrogen receptor α in uterus and ovary and estrogen receptor β in vagina, while these indicators were not significant different (P > 0.05) between the T2 group and the Control group. In comparison with the Control group, ZEA significantly increased (P < 0.05) expression of several ATP-binding cassette (ABC) transporters: ABCB1 and ABCb4 in the vagina, ABCA1 and ABCb4 in the uterus, and ABCB1, ABCb4, ABCD3, and ABCG2 in the ovary, while these transporters in the T2 group were significantly decreased (P < 0.05) compared with the T1 group. In conclusion, the present study demonstrates that B. licheniformis CK1 could alleviate the harmful effect of ZEA in Tibetan piglets.

Keywords: Bacillus licheniformis CK1, estrogen receptors, Tibetan piglets, transporters, zearalenone

INTRODUCTION

Mycotoxins are toxic secondary metabolites produced by filamentous fungi (Savard, 2008). Recently, Taevernier et al. have proposed a more detailed and concrete definition of mycotoxin as “something if and only if it is a secondary metabolite produced by microfungi, posing a health hazard to human and vertebrate animal species by exerting a toxic activity on human or vertebrate animal cells in vitro with 50% effectiveness levels < 1000 μM” (Taevernier et al., 2016). Mycotoxin contamination is regarded as an inevitable and unpredictable problem, even where good agriculture management, storage, and strict processing are implemented, posing a great risk for animal and human safety. Mycotoxins are difficult to be completely eliminated during feed or food processing such as milling, dehulling, cleaning, and cooking because of their stability against heat, physical, and chemical treatments (Marin et al., 2013). Mycotoxins can accumulate in crops during preharvest, transportation, and storage. After ingestion, the residues or metabolites of mycotoxins can also accumulate in animal-derived products, such as meat, milk, or eggs, leading to intake of mycotoxins by humans (Marin et al., 2013). Presently, 6 mycotoxins are regularly found in food and animal feedstuffs, including aflatoxins, ochratoxins, fumonisins, patulin, zearalenone (ZEA), and deoxynivalenol (Pereira et al., 2014). Of these, ZEA is one of the most important mycotoxins for its global incidence and toxicity (Schatzmayr and Streit, 2013).

Zearalenone is present globally in food and feed chain. For example, ZEA was highly prevalent in North Asia with 56% positive samples containing an average of 386 µg/kg of the mycotoxin (Schatzmayr and Streit, 2013). China is one of the most polluted countries of ZEA. Li et al. analyzed 55 feed ingredients and 76 complete swine feeds collected from 15 swine farms located in Beijing region of China and found that 95.42% of the samples were positive for ZEA and in particular 41% of distiller’s dried grains with solubles samples had an average content of 883 μg/kg of ZEA (Li et al., 2014a). Additionally, Li et al. found that the incidence of ZEA was 27.6% in 76 cereal and oil products and the mean level of ZEA in the positive samples was 76.5 μg/kg, exceeding the legislation limit of China in food (≤60 μg/kg) (Li et al., 2014b).

Zearalenone, a macrocyclic acid lactone, has a low molecular weight and a good thermal stability. Due to the similarity of its structure to the naturally occurring estrogens, ZEA and its metabolites can competitively bind to estrogen receptors, thus affecting target gene transcription in many organs (Kowalska et al., 2016). Estrogen receptor α (ERα) and estrogen receptor β (ERβ) are 2 subtypes of estrogen receptors, and the protein localization, and/or mRNA expression, of ERα and ERβ have been studied in porcine reproductive organs (Slomczynska et al., 2001; Knapczyk-Stwora et al., 2011; Norrby et al., 2013). Zearalenone alters functions of reproductive organs, increases the embryo-lethal resorption, and decreases the fertility in laboratory and domestic animals (Zinedine et al., 2007). In addition, ZEA affects ATP-binding cassette (ABC) transporters. It induced mRNA expressions of ABCC1, ABCC2, and ABCG2 in human choriocarcinoma cell lines (Prouillac et al., 2009). Likewise, ZEA could modulate Abcb1, Abcc4, and Abcc5 both in SerW3 Sertoli cells and the rat testis (Koraichi et al., 2013). Xiao et al. demonstrated that ZEA was a substrate of the placental ABCG2 transporter (Xiao et al., 2015).

ATP-binding cassette transporters are a family of membrane proteins that mediate diverse ATP-driven transport processes. They are found in organisms from prokaryotes to eukaryotes and responsible for the active transport of a wide variety of compounds including endogenous molecules, nutrients, drugs, and other xenobiotics across biological membranes (Koraichi et al., 2012). They can be subdivided into 7 subfamily labeled ABCA to ABCG, based on the dissimilarity in gene structure, order of domains, and amino acid sequence homologies in nucleotide-binding domains (NBD) and transmembrane domains (TMD) (Mamo and Pandi, 2017). ATP-binding cassette transporters pump transport substrates against a chemical gradient depending on ATP hydrolysis on the NBD, which drives conformational changes in the TMD, leading to alternating access from the interior and exterior of the cell for unidirectional transport across the lipid bilayer (Wilkens, 2015). Furthermore, several studies have found that gene expression of ABC transporters is regulated by hormones in vitro. Wang et al. reported that progesterone (P) could upregulate the gene expression of human ABCG2 in human choriocarcinoma cells (Wang et al., 2008). Luteinizing hormone (LH) and P could upregulate the gene expression of ABCB1 in granulosa cells isolated from porcine ovarian follicles (Fukuda et al., 2006).

To eliminate the mycotoxins from feed and reduce harmful effects of mycotoxins to animals, numerous physical, chemical, and biological detoxification methods have been tested. Among them, microbes or their enzymes are attracting more and more attention, due to their advantages of high specificity and high efficiency. Many microorganisms have been shown to bio-transform mycotoxins through biological reactions including acetylation, glucosylation, ring cleavage, hydrolysis, deamination, and decarboxylation (Hathout and Aly, 2014). However, the research for feeding animals with ZEA-contaminated diets degraded by microbes is still limited. Pigs are the most sensitive species to the toxicity of ZEA. Our previous study has demonstrated that Bacillus licheniformis CK1 degraded ZEA-contaminated diets, which could alleviate the toxicity of ZEA to commercial piglets (Fu et al., 2016). The toxicity of ZEA could differ for different breeds of piglets, due to genetics and previous exposure to mycotoxins.

Tibetan pigs are a special Chinese indigenous pig breed, which are distributed in high-altitude areas of Qinghai-Tibet Plateau with long-term living in nonpolluting environment and raised mainly free-range. Therefore, there are much less chances for Tibetan pigs to get exposure to mycotoxins in comparison with commercial pigs raised in other parts of China. Thus, the aims of this study were to evaluate whether Tibetan piglets are more sensitive to ZEA and whether ZEA-contaminated diet degraded by B. licheniformis CK1 could alleviate the toxicity of ZEA to Tibetan piglets through determining the growth performance, vulva size, the serum hormone levels, and ZEA-related gene expression of piglets.

MATERIALS AND METHODS

All of the experimental procedures adhered to the Guide for the Care and Use of Laboratory Animals: Eighth Edition, ISBN-10: 0-309-15396-4, and all animal protocol was approved by the guidelines of Animal Use and Care Committee of Northwest Agriculture and Forestry (A&F) University (NWAFAC1220).

Strain and Reagents

The strain, B. licheniformis CK1, was obtained from the National Taiwan University (Yi et al., 2011). Zearalenone and methanol [high-performance liquid chromatography (HPLC) grade] were purchased from Sigma-Aldrich (St. Louis, MO). The purity of ZEA used in the experiment was more than 99.0%. Water was purified by a Milli-Q Academic Water System (Darmstadt, Germany). All other reagents used were of analytical grade.

Diets Preparation

All diets (Table 1) used in the study were isocaloric and isonitrogenous. Nutrient concentrations met or exceeded nutrient requirements of NRC (1998) for swine. The feed for Tibetan piglets was prepared by the Yangling Experimental Farm, as in our previous study (Fu et al., 2016). Before preparing feedstuffs, all feed ingredients were checked for the presence of mycotoxins by the Yangling Experimental Farm. They were not detectable.

Table 1.

Ingredients and compositions of the basic diet

Item Amount
Ingredients, %
 Corn 53.00
 Wheat middling 5.00
 Whey powder 6.50
 Soybean oil 2.50
 Soybean meal 24.76
 Fish meal 5.50
 L-Lysine HCl 0.30
 DL-Methionine 0.10
 L-Threonine 0.04
 Calcium phosphate 0.80
 Limestone, pulverized 0.30
 Sodium chloride 0.20
 Premix1 1.00
 Total 100
Nutrients, analyzed values
 Gross energy, MJ/kg 17.12
 Crude protein, % 19.40
 Calcium, % 0.84
 Total phosphorus, % 0.73
 Lysine, % 1.36
 Methionine, % 0.46
 Sulfur amino acid, % 0.79
 Threonine, % 0.90
 Tryptophan, % 0.25
Open in a new tab

1Supplied per kg of diet: vitamin A, 3,300 IU; vitamin D3, 330 IU; vitamin E, 24 IU; vitamin K3, 0.75 mg; vitamin B1, 1.50 mg; vitamin B2, 5.25 mg; vitamin B6, 2.25 mg; vitamin B12, 0.02625 mg; pantothenic acid, 15.00 mg; niacin, 22.5 mg; biotin, 0.075 mg; folic acid, 0.45 mg; Mn, 6.00 mg; Fe, 150 mg; Zn, 150 mg; Cu, 9.00 mg; I, 0.21 mg; Se, 0.45 mg.

Zearalenone (90 mg) was dissolved in acetonitrile thoroughly and then mixed with an appropriate amount of talcum powder. The ZEA-containing talcum powder was blended with 6 kg of the basic diet (Table 1) and the mix was divided into 2 equal parts. One part was mixed with 42 kg of the basic diet as treatment 1 (T1), while the other part was fermented by B. licheniformis CK1 to degrade ZEA before mixing with 42 kg of the basic diet as treatment 2 (T2).

For the fermentation, batches of 300 g of autoclaved ZEA-containing diet were mixed with sterilized water in a 5-liter fermenter. The mixture was inoculated with an overnight bacterial culture of B. licheniformis CK1 and incubated for 36 h at 37 °C, 300 rpm. Bacillus licheniformis CK1 (1.2 × 1011 CFU/kg) was added to ferment ZEA-contaminated diet. The mixture was poured into a washbasin after the fermentation, and then the basic diet was slowly added in order to absorb the water. At the end, the mixture was naturally dried at room temperature. A total of 3 kg ZEA-containing diet was fermented by B. licheniformis CK1. The amount of B. licheniformis CK1 in the diet of T2 group was 7.95 × 107 CFU/kg. All diets were prepared at the same time and stored in the covered containers before feeding.

Method of ZEA Analysis

Analysis of ZEA concentrations in feed was determined by HPLC. The HPLC system consists of a SIL-20A autosampler, a LC-20AT pump, a CBM-20A system controller, and a RF-20A fluorescence detector (Shimadzu, Kyoto, Japan). Zearalenone was separated by an Ascentis C18 HPLC column (5 μm particle size, L × I.D. 250 mm × 4.6 mm; Sigma-Aldrich, Bellefonte, PA) at room temperature. Zearalenone was detected at excitation and emission wavelengths of 225 and 465 nm, respectively. The mobile phase was a mixture of methanol:water (80:20, v/v) and was delivered at a flow rate of 0.5 mL/min. Before the HPLC analysis, ZEA in the feed was extracted and cleaned up using the Romer Mycosep 226 column (Romer Labs Inc., Union, MO) according to the manufacturer’s instructions, and 20 μL was injected for HPLC analysis after filtration by 0.45 μm syringe filter. Zearalenone was identified by retention time and quantified from peak area. Identified ZEA was quantified using the external standard. The standard curve was obtained by analyzing 6 standard solutions in different concentration for ZEA (0.1, 0.25, 0.5, 1.25, 2.5, and 5 μg/mL) and each concentration was analyzed in triplicate. The regression equation for quantification of ZEA was y = 734937x + 45373 (R2 = 0.9995).

Animals and Experimental Design

A total of 18 healthy female Tibetan piglets weaned at day 36 with an average body weight (BW) of 6.48 ± 0.74 (mean ± SE) kg were obtained from the farm of Tibet Agriculture and Animal Husbandry College, where all animals were fed the basic diet during a 10-d adaptation period after weaning. Piglets were randomly allocated to 3 treatments, with 6 piglets in each group according to BW. The diets and water were provided ad libitum throughout the study. Piglets were fed the basic diet (Control), treatment 1 (T1) or treatment 2 (T2) during a 21-d test period. Forty-five milligrams of ZEA were added to the diet for T1 group or T2 group before the fermentation. The actual levels of ZEA (analyzed) in feed were 0, 1.13 ± 0.03, and 0.44 ± 0.02 mg/kg for the Control, T1, and T2, respectively. During the test period, all piglets were housed individually in metal pens at the room temperature. Body weights were measured weekly and feed intake of each treatment was recorded daily. Vulva length and width were measured on day 1, day 8, day 15, and day 22. The vulva area was calculated as (vulva length × vulva width)/2 according to Jiang et al. (2010).

Sample Collection

On the morning following a 12-h fasting at the end of experiment, approximately 10 mL blood sample was collected from anterior vena cava of each piglet. After centrifugation of blood at 1,500 × g for 10 min at room temperature, the serum was separated and stored at −80 °C until being analyzed for hormones as described below. All piglets were euthanized. Heart, liver, kidney, spleen, lung, and reproductive organs (vagina + uteri + ovary) were isolated and weighed. The organ relative weight equals the organ weight/the piglet’s body weight (g:kg). Samples of vagina, uterus, and ovary tissue were kept at −80 °C until extraction of total RNA for measuring gene expression.

Serum Hormone Determination

The concentrations of LH, follicle-stimulating hormone (FSH), P, estradiol (E2), and testosterone (T) were evaluated with radioimmunoassay (RIA) using commercial iodine [125I] RIA kits (China Diagnostics Medical Corporations, Beijing, China) according to the manufacture’s protocols as reported previously (Niswender, 1973; Van de Wiel et al., 1981; Diekman and Hoagland, 1983; Langhout et al., 1991; Biswas et al., 2001). Hormone concentration was tested according to each sample’s level of radioactivity.

Total RNA Extraction and Real-Time PCR Analysis

Total RNA was extracted from frozen tissues using a total RNA kit (Omega Bio-Tek, Norcross, GA) according to the manufacture’s instructions. For reverse transcription, 800 ng of RNA per sample was converted into cDNA using PrimeScript 1st Strand cDNA Synthesis kit (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. Real-time PCR amplification was performed using the TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) with Bio-Rad CFX96 qPCR system (Bio-Rad, CA). According to the GenBank, oligonucleotide primers were designed and shown in Table 2. Target genes expressions were normalized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the method of 2−ΔΔCt was used to analyze the real-time PCR data expressed as the fold change relative to the average value of the Control group.

Table 2.

Primers for quantitative PCR1

Genes Source Primers sequence (5′→3′) Accession no.
GAPDH Pig F: CCTGGCCAAGGTCATCCATG
R: CCACCACCCTGTTGCTGTAG		 NM_214220.1
ERα Pig F: TTGCTTAATTCTGGAGGGTAC
R: AGGTGGATCAAGGTGTCTGTG		 EF195769.1
ERβ Pig F: GCTCAGCCTGTACGACCAAGTGC
R: CCTTCATCCCTGTCCAGAACGAG		 NM_001001533.1
ABCA1 Pig F: CTCGTGCAGAAATAGCAGTAGC
R: TCCTGATGAGGTTGGAGATAGCG		 NM_001317080.1
ABCB1 Pig F: CATTCATCTATGGCTGGCAAC
R: TCCTCCCGAGTCAAAGAAACAAC		 NM_001308246
ABCb4 Pig F: ACAACCTTTGATTGACAGCCACA
R: CCACTGGACATTGAGTTTCTTTGC		 EF067318
ABCD3 Pig F: AAAGTGGTATCATTGGTCGTAGC
R: GTCTGGATTAGCGATTCTGTTG		 NM_001244133
ABCG2 Pig F: AGAGTTGGGTCTGGATAAAGTGG
R: AAAGATGGAGTAACGAGGCTG		 NM_214010
Open in a new tab

1 GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse; ERα, estrogen receptor α; ERβ, estrogen receptor β; ABC (A1, B1, b4, D3, G2), ATP-binding cassette transporters.

Statistical Analysis

Statistical significance of differences between the treatment groups was analyzed through 1-way analysis of variance (ANOVA) and Duncan’s multiple range tests using the SPSS 16.0 statistical software (SPSS 16.0 Inc., Chicago, IL). Data were expressed as treatment means with their pooled SEM and differences were considered significant at P-value < 0.05.

RESULTS

Growth Performance

During the 21-d feeding experiment, all the piglets appeared healthy without mortality. As shown in Table 3, no significant effect (P > 0.05) was noted on average daily feed intake (ADFI), average daily gain (ADG), and feed efficiency (FE) among 3 groups.

Table 3.

Growth performance of piglets fed different treatment diets for 3 wk1

Item Control T1 T2 SEM P-value
ADG, kg/d 0.09 0.07 0.08 0.006 0.267
ADFI, kg/d 0.27 0.25 0.27 0.004 0.422
FE2 0.36 0.26 0.31 0.02 0.177
Open in a new tab

1 n = 6 per group; Control group, basal diets without addition of zearalenone or B. licheniformis CK1; T1 group, zearalenone-contaminated diets; T2 group, zearalenone-contaminated diets treated by B. licheniformis CK1.

2FE = feed efficiency is kilograms of gain/kilograms of feed intake.

The Vulva Size

The vulva size of piglets at 4 points (day 1, day 8, day 15, and day 22) fed diets with different treatments was summarized in Fig. 1. There was no significant difference (P > 0.05) in vulva size of piglets among the 3 groups at day 1. T1 group had a significantly greater (P < 0.05) vulva size than the Control and T2 groups at day 8, day 15, and day 22. In addition, significant difference (P < 0.05) was observed between the vulva sizes of the Control and those of the T2 group on day 22.

Figure 1.

Figure 1.

Open in a new tab

Effect of the vulva size of piglets fed different treatment at 4 points (day 1, day 8, day 15, and day 22). Control group: basal diets without addition of ZEA or B. licheniformis CK1; T1 group: ZEA-contaminated diets; T2 group: ZEA-contaminated diets treated by B. licheniformis CK1. a–cDifferent letters at the same time point indicate significant differences (P < 0.05).

The Relative Weight of Organs

As summarized in Table 4, the relative weight of reproductive organs was significantly affected by the treatments. The relative weight of reproductive organs of piglets in T1 group and T2 group increased by 163.25% and 61.54%, respectively, compared with the Control group. Compared with the T1 group, the relative weight of reproductive organs of piglets was significantly decreased (P < 0.05) in the T2 group. On the other hand, there were no significant differences (P > 0.05) of relative weight of heart, liver, spleen, lung, and kidney among the 3 groups.

Table 4.

The relative weight (g/kg of BW) of organs in piglets fed different treatment diets for 3 wk1

Item Control T1 T2 SEM P-value
Heart 4.23 4.96 5.47 0.29 0.250
Liver 28.24 27.52 30.29 0.59 0.119
Spleen 1.63 2.03 1.90 0.1 0.253
Lung 20.76 22.18 21.13 0.32 0.183
Kidney 4.64 5.18 5.14 0.21 0.568
Reproductive organs 1.17a 3.08b 1.89c 0.22 <0.01
Open in a new tab

a–cWithin a row, means without a common superscript differ (P < 0.05).

1 n = 6 per group; Control group, basal diets without addition of zearalenone or B. licheniformis CK1; T1 group, zearalenone-contaminated diets; T2 group, zearalenone-contaminated diets treated by B. licheniformis CK1.

Changes of the Serum Hormones

The effects of different diets on the level of LH, FSH, P, E2, and T were shown in Table 5. The levels of LH and E2 were significantly lower (P < 0.05) in the T1 and T2 groups. The LH concentrations in the T1 and T2 groups decreased by 79.02% and 18.88%, respectively, compared with the Control. Similarly, the E2 concentrations in the T1 and T2 groups decreased by 21.78% and 14.84%, respectively, compared with the Control. The levels of FSH and P in the T1 group were lower (P < 0.05) than those in the Control, while no significant differences (P > 0.05) were observed for FSH and P concentrations between the Control and the T2 groups. The T concentrations were not significantly different (P > 0.05) among the 3 groups.

Table 5.

The hormone levels in serum of piglets fed different treatment diets for 3 wk1

Item2 Control T1 T2 SEM P-value
LH, IU/liter 1.43c 0.30a 1.16b 0.13 <0.001
FSH, IU/liter 0.71b 0.54a 0.63ab 0.02 0.006
P, ng/mL 1.70b 1.40a 1.59b 0.04 0.001
E2, pg/mL 22.64c 17.71a 19.28b 0.60 <0.001
T, ng/dL 31.11 31.00 31.38 0.50 0.957
Open in a new tab

a–cWithin a row, means without a common superscript differ (P < 0.05).

1 n = 6 per group; Control group, basal diets without addition of zearalenone or B. licheniformis CK1; T1 group, zearalenone-contaminated diets; T2 group, zearalenone-contaminated diets treated by B. licheniformis CK1.

2LH, luteinizing hormone; FSH, follicle-stimulating hormone; P, progesterone; E2, estradiol; T, testosterone.

The Expression Level of ERα and ERβ in Different Tissues of Tibetan Piglets

The relative gene expression levels were determined using the 2−ΔΔCt method. As shown in Fig. 2, the T1 group significantly increased (P < 0.05) the mRNA expression of ERα in the uterus and ovary and ERβ expression in vagina, in comparison with the Control. On the other hand, there were no significant differences (P > 0.05) of ERα and ERβ mRNA expression in different tissues between the Control and the T2 groups.

Figure 2.

Figure 2.

Open in a new tab

Effects of B. licheniformis CK1 to detoxify ZEA on the mRNA expression of ERα (A) and ERβ (B) in the reproductive organs of the female weaned piglets. Control group: basal diets without addition of ZEA or B. licheniformis CK1; T1 group: ZEA-contaminated diets; T2 group: ZEA-contaminated diets treated by B. licheniformis CK1. a,bDifferent letters for each organ in each panel indicate significant differences (P < 0.05).

The Expression Level of ABC Transporters in Different Tissue of Tibetan Piglets

In comparison with the Control group, T1 treatment significantly increased (P < 0.05) expression of quite a few ABC transporters: ABCB1 and ABCb4 in the vagina, ABCA1 and ABCb4 in the uterus, and ABCB1, ABCb4, ABCD3, and ABCG2 in the ovary (Fig. 3). Significant downregulation (P < 0.05) was observed for ABCG2 mRNA in T1 and T2 group in vagina. Other than ABCG2 in the vagina, there was no significant (P > 0.05) difference in terms of expression of the ABC transporters in the 3 tissues between the Control and T2 groups.

Figure 3.

Figure 3.

Open in a new tab

Effects of B. licheniformis CK1 to detoxify ZEA on the mRNA expression of ABC transporters in the different tissues [(A) vagina, (B) uterus, (C) ovary] of the female weaned piglets. Control group: basal diets without addition of ZEA or B. licheniformis CK1; T1 group: ZEA-contaminated diets; T2 group: ZEA-contaminated diets treated by B. licheniformis CK1. a,bDifferent letters for each ABC transporter in each panel indicate significant differences (P < 0.05).

DISCUSSION

In this study, there was no significant difference in ADFI, ADG, and FE among the 3 groups similar to our previous study (Fu et al. 2016). Other studies also support our results. For example, Zhao et al. reported that there were no negative effects on the growth performance of gilts fed diet with final concentrations of 238.57 μg/kg of ZEA (Zhao et al., 2015). Diet with or without ZEA (0.8 mg ZEA per kg diet) had no effect on growth performance of piglets (Denli et al., 2015).

The toxicity of ZEA is best reflected by swollen vulva (Alexopoulos, 2001). Our results showed that ZEA-contaminated diet significantly increased the vulva size of piglets similar to previous studies (Jiang et al., 2011; Oliver et al., 2012; Fu et al, 2016). However, Tibetan piglets seem more sensitive to ZEA than commercial piglets. The vulva size of Tibetan piglets in T1 group increased by 34.92% and 42.22% at the time of the day 8 and day 15, respectively, compared with the Control group. However, in our previous study, ZEA (1 mg ZEA per kg diet) increased the vulva size of commercial piglets by 19.07% and 32.26% at the time of day 8 and day 15, respectively (Fu et al., 2016). The toxicity of ZEA can also be observed by increase in the weight of reproductive organs. Denli et al. found that feeding ZEA-contaminated diets (0.8 ZEA per kg diet) significantly increased the weight of uterus and ovary in piglets (Denli et al., 2015). In our study, piglets fed ZEA-contaminated diets significantly increased the relative weight of reproductive organs, but had no effect on the relative weight of other organs (heart, liver, spleen, lung, and kidney). The reproductive organs index of Tibetan piglets in T1 group was 3 folds that of the Control group. However, the relative weight of reproductive organs in commercial piglets fed ZEA-contaminated diet (1 mg ZEA per kg diet) was only 1.4 folds that of the Control group (Fu et al., 2016). This again supports the notion that Tibetan piglets are more sensitive to ZEA. When piglets were fed the T2 diet, the vulva size and the relative weight of reproductive organs had significant decrease compared with those in T1 group, indicating that CK1 detoxified ZEA in the diet and consequently reduced its estrogenic effect on the piglets.

Tibetan piglets fed with the T1 diet decreased the levels of serum hormone except testosterone in the present study. In our precious study, we only found that ZEA (1 mg ZEA per kg diet) significantly decreased the level of LH in commercial piglets (Fu et al., 2016). An earlier study demonstrated that ZEA at 4 and 8 mg/kg decreased the level of FSH and P in rats (Collins et al., 2006). Similarly, exposure to high dose ZEA (0.1 to 150 nM) in H295R cells decreased the levels of E2 and P (Frizzell et al., 2011). Arispe et al. reported FSH secretion was reduced in sheep pituitary cells cultured with ZEA (1 to 1,000 nM) (Arispe et al., 2013). These in vitro and in vivo results support the notion that ZEA led to downregulating the secretion of serum sex hormones. We hypothesize that ZEA, like estrogens, inhibits FSH and LH secretion through negative feedback. In our study, decreased secretion of LH, P, and E2 was ameliorated in T2 group compared with T1 group, probably due to reduced amounts of ZEA. Our results were in agreement with a study which reported that addition of 4 g/kg modified calcium montmorillonite clay to ZEA-contaminated diets (1 mg ZEA per kg diet) increased serum P and E2 concentrations in female piglets (Jiang et al., 2012).

Tibetan piglets fed with the T1 diet had greater mRNA expression of ERα in uterus and ovary and ERβ in vagina. In our previous study with commercial piglets, the same T1 treatment upregulated the mRNA expression of ERβ in vagina, uterus, and ovary, but had no effect on mRNA expression of ERα (Fu et al., 2016). The differential effects of ZEA on ERα and ERβ expression between these 2 studies were interesting and need to be further studied. Zearalenone and its metabolites compete with 17β-estradiol for the specific binding sites of estrogen receptors which are the ligand-activated nuclear receptor and include 2 forms as ERα and ERβ, then binding the estrogen response element and eventually regulating the transcription of downstream genes (Adibnia et al., 2016).

ATP-binding cassette transporters exist widely in various tissues and utilize ATP to translocate very broad substrates such as endogenous molecules, nutrients, mycotoxins, and other xenobiotics. In our current study, ZEA significantly upregulated the mRNA expression of ABC transporters in piglets, and the transcription levels of ABC transporters were different in vagina, uterus, and ovary. Furthermore, T2 group adding B. licheniformis CK1 significantly decreased the mRNA expression of ABC transporters in piglets compared with T1 group. These results suggest that the piglets can use increased ABC transporters for removing ZEA from certain organs and tissues. Thus, increased ABC transporters could be a protective measure. Increased ABC transporters in the presence of ZEA were also observed by others. Zhang et al. reported that the pregnant rats fed ZEA-contaminated diet (100 mg ZEA per kg diet) improved the mRNA expression of ABCB1 and ABCG2 (Zhang et al., 2014). Koraichi et al. found that ZEA (1 mg/kg) significantly increased the expression of ABCB1 and ABCG2 in uterus of the pregnant rats (Koraichi et al., 2012). Some studies also reported that ZEA (10 μM or 0.1 to 10 nM) could regulate mRNA expression of ABC transporter (Prouillac et al., 2009; Koraichi et al., 2013). In intestinal Caco2 cell line, ABCC1–3 could directly transport ZEA (10 μM) and its metabolites, suggesting that ABC transporters could regulate the biomass of ZEA (Videmann et al., 2009). Xiao et al. demonstrated that the environmental chemical ZEA could serve as a substrate for ABCG2 in the placenta (Xiao et al., 2015). These results indicated that the increase of the expression of ABC transporters in the presence of ZEA could be a protective of organism.

Zearalenone contamination in foodstuffs and animal feeds is a global issue and could cause reproductive disorders and hyper-estrogenic syndromes in farm animals and humans due to its estrogenic effects (Zinedine et al., 2007). Results from our current study and the previous one demonstrate the efficacy of using microorganisms to detoxify ZEA (Fu et al., 2016). Among farm animals, pigs are the most sensitive species to ZEA, especially for pre-pubertal females. The main reason for ZEA sensitivity is that pigs convert ZEA to the more estrogenically active α-zearalenol (α-ZEL) (Minervini and Dell’Aquila, 2008). Compared with the previous study (Fu et al., 2016), Tibetan pigs are more sensitive to ZEA, probably due to lack of or less previous exposure to ZEA and different genetic background. The climate in Tibet is not favorable for growth of fungi-producing ZEA. In addition, Tibetan piglets are mainly raised free-range, so they are not affected by ZEA-contaminated feed from other places.

In conclusion, Tibetan pigs were more sensitive to ZEA and more suitable as an animal model for studying the toxicity of ZEA to pigs. Moreover, B. licheniformis CK1 could degrade ZEA in feed and alleviate the adverse effect of ZEA on piglets.

ACKNOWLEDGMENTS

This work was supported by funding from an innovation project of science and technology plan project of Shaanxi Province, China (2014KTCL02-21) and from a project from the Ministry of Agriculture (No. 2013-S16).

Conflict of interest statement. None declared.

LITERATURE CITED

  1. Adibnia E., M. Razi, and Malekinejad H.. 2016. Zearalenone and 17β-estradiol induced damages in male rats reproduction potential; evidence for ERα and ERβ receptors expression and steroidogenesis. Toxicon 120:133–146. doi: 10.1016/j.toxicon.2016.08.009 [DOI] [PubMed] [Google Scholar]
  2. Alexopoulos C. 2001. Association of fusarium mycotoxicosis with failure in applying an induction of parturition program with PGF2alpha and oxytocin in sows. Theriogenology 55:1745–1757. doi: 10.1016/S0093-691X(01)00517-9 [DOI] [PubMed] [Google Scholar]
  3. Arispe S. A., B. Adams, and Adams T. E.. 2013. Effect of phytoestrogens on basal and GnRH-induced gonadotropin secretion. J. Endocrinol. 219:243–250. doi: 10.1530/JOE-13-0158 [DOI] [PubMed] [Google Scholar]
  4. Biswas N. M., R. Sen Gupta A. Chattopadhyay G. R. Choudhury, and Sarkar M.. 2001. Effect of atenolol on cadmium-induced testicular toxicity in male rats. Reprod. Toxicol. 15:699–704. doi: 10.1016/S0890-6238(01)00184-8 [DOI] [PubMed] [Google Scholar]
  5. Collins T. F., R. L. Sprando T. N. Black N. Olejnik R. M. Eppley H. Z. Alam J. Rorie, and Ruggles D. I.. 2006. Effects of zearalenone on in utero development in rats. Food Chem. Toxicol. 44:1455–1465. doi: 10.1016/j.fct.2006.04.015 [DOI] [PubMed] [Google Scholar]
  6. Denli M., J. C. Blandon M. E. Guynot S. Salado, and Pérez J. F.. 2015. Efficacy of activated diatomaceous clay in reducing the toxicity of zearalenone in rats and piglets. J. Anim. Sci. 93:637–645. doi: 10.2527/jas.2014-7356 [DOI] [PubMed] [Google Scholar]
  7. Diekman M. A. and Hoagland T. A.. 1983. Influence of supplemental lighting during periods of increasing or decreasing daylength on the onset of puberty in gilts. J. Anim. Sci. 57:1235–1242. doi: 10.2527/jas1983.5751235x [DOI] [PubMed] [Google Scholar]
  8. Frizzell C., D. Ndossi S. Verhaegen E. Dahl G. Eriksen M. Sørlie E. Ropstad M. Muller C. T. Elliott, and Connolly L.. 2011. Endocrine disrupting effects of zearalenone, alpha- and beta-zearalenol at the level of nuclear receptor binding and steroidogenesis. Toxicol. Lett. 206:210–217. doi: 10.1016/j.toxlet.2011.07.015 [DOI] [PubMed] [Google Scholar]
  9. Fu G. H., Ma J. F., Wang L. H., Yang X., Liu J., and Zhao X.. 2016. Effect of degradation of zearalenone-contaminated feed by Bacillus licheniformis CK1 on postweaning female piglets. Toxins (Basel) 8:300. doi: 10.3390/toxins8100300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fukuda H., M. Arai T. Soh N. Yamauchi, and Hattori M. A.. 2006. Progesterone regulation of the expression and function of multidrug resistance type I in porcine granulosa cells. Reprod. Toxicol. 22:62–68. doi: 10.1016/j.reprotox.2005.11.003 [DOI] [PubMed] [Google Scholar]
  11. Hathout A. S., and Aly S. E.. 2014. Biological detoxification of mycotoxins: a review. Ann. Microbiol. 64:905–919. doi: 10.1007/s13213-014-0899-7 [DOI] [Google Scholar]
  12. Jiang S. Z., Z. B. Yang W. R. Yang J. Gao F. X. Liu J. Broomhead, and Chi F.. 2011. Effects of purified zearalenone on growth performance, organ size, serum metabolites, and oxidative stress in postweaning gilts. J. Anim. Sci. 89:3008–3015. doi: 10.2527/jas.2010-3658 [DOI] [PubMed] [Google Scholar]
  13. Jiang S. Z., Yang Z. B., Yang W. R., Wang S. J., Liu F. X., Johnston L. A., Chi F., and Wang Y.. 2012. Effect of purified zearalenone with or without modified montmorillonite on nutrient availability, genital organs and serum hormones in post-weaning piglets. Livest. Sci. 144:110–118. doi: 10.1016/j.livsci.2011.11.004 [DOI] [Google Scholar]
  14. Jiang S. Z., Yang Z. B., Yang W. R., Yao B. Q., Zhao H., Liu F. X., Chen C. C., and Chi F.. 2010. Effects of feeding purified zearalenone contaminated diets with or without clay enterosorbent on growth, nutrient availability, and genital organs in post-weaning female pigs. Asian-Australas. J. Anim. Sci. 23:74–81. doi: 10.5713/ajas.2010.90242 [DOI] [Google Scholar]
  15. Knapczyk-Stwora K., M. Durlej M. Duda K. Czernichowska-Ferreira A. Tabecka-Lonczynska, and Slomczynska M.. 2011. Expression of oestrogen receptor α and oestrogen receptor β in the uterus of the pregnant swine. Reprod. Domest. Anim. 46:1–7. doi: 10.1111/j.1439-0531.2009.01505.x [DOI] [PubMed] [Google Scholar]
  16. Koraichi F., L. Inoubli N. Lakhdari L. Meunier A. Vega C. Mauduit M. Benahmed C. Prouillac, and Lecoeur S.. 2013. Neonatal exposure to zearalenone induces long term modulation of ABC transporter expression in testis. Toxicology 310:29–38. doi: 10.1016/j.tox.2013.05.002 [DOI] [PubMed] [Google Scholar]
  17. Koraichi F., B. Videmann M. Mazallon M. Benahmed C. Prouillac, and Lecoeur S.. 2012. Zearalenone exposure modulates the expression of ABC transporters and nuclear receptors in pregnant rats and fetal liver. Toxicol. Lett. 211:246–256. doi: 10.1016/j.toxlet.2012.04.001 [DOI] [PubMed] [Google Scholar]
  18. Kowalska K., D. E. Habrowska-Górczyńska, and Piastowska-Ciesielska A. W.. 2016. Zearalenone as an endocrine disruptor in humans. Environ. Toxicol. Pharmacol. 48:141–149. doi: 10.1016/j.etap.2016.10.015 [DOI] [PubMed] [Google Scholar]
  19. Langhout D. J., L. J. Spicer, and Geisert R. D.. 1991. Development of a culture system for bovine granulosa cells: effects of growth hormone, estradiol, and gonadotropins on cell proliferation, steroidogenesis, and protein synthesis. J. Anim. Sci. 69:3321–3334. doi: 10.2527/1991.6983321x [DOI] [PubMed] [Google Scholar]
  20. Li R., Wang X., Zhou T., Yang D., Wang Q., and Zhou Y.. 2014a. Occurrence of four mycotoxins in cereal and oil products in Yangtze Delta region of China and their food safety risks. Food Control 35:117–122. doi: 10.1016/j.foodcont.2013.06.042 [DOI] [Google Scholar]
  21. Li X., Zhao L., Yu F., Jia Y., Lei S., Ma S., Ji C., Ma Q., and Zhang J.. 2014b. Occurrence of mycotoxins in feed ingredients and complete feeds obtained from the Beijing region of China. J. Anim. Sci. Biotechn. 5:31. doi: 10.1186/2049-1891-5-37 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mamo G., and Pandi A.. 2017. A review on ATP binding cassette (ABC) transporters. Int. J. Pharma. Res. Health Sci. 5:1607–1615. doi: 10.21276/ijprhs.2017.02.01 [DOI] [Google Scholar]
  23. Marin S., A. J. Ramos G. Cano-Sancho, and Sanchis V.. 2013. Mycotoxins: occurrence, toxicology, and exposure assessment. Food Chem. Toxicol. 60:218–237. doi: 10.1016/j.fct.2013.07.047 [DOI] [PubMed] [Google Scholar]
  24. Minervini F. and Dell’Aquila M. E.. 2008. Zearalenone and reproductive function in farm animals. Int. J. Mol. Sci. 9:2570–2584. doi: 10.3390/ijms9122570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Niswender G. D. 1973. Influence of the site of conjugation on the specificity of antibodies to progesterone. Steroids 22:413–424. doi: 10.1016/0039-128X(73)90104-9 [DOI] [PubMed] [Google Scholar]
  26. Norrby M., A. Madej E. Ekstedt, and Holm L.. 2013. Effects of genistein on oestrogen and progesterone receptor, proliferative marker Ki-67 and carbonic anhydrase localisation in the uterus and cervix of gilts after insemination. Anim. Reprod. Sci. 138:90–101. doi: 10.1016/j.anireprosci.2013.01.011 [DOI] [PubMed] [Google Scholar]
  27. NRC 1998. Nutrient requirements of swine. 10th ed. Natl. Acad. Press, Washington, DC. [Google Scholar]
  28. Oliver W. T., Miles J. R., Diaz D. E., Dibner J. J., Rottinghaus G. E., and Harrell R. J.. 2012. Zearalenone enhances reproductive tract development, but does not alter skeletal muscle signaling in prepubertal gilts. Anim. Feed Sci. Tech. 174:79–85. doi: 10.1016/j.anifeedsci.2012.02.012 [DOI] [Google Scholar]
  29. Pereira V. L., Fernandes J. O., and Cunha S. C.. 2014. Mycotoxins in cereals and related foodstuffs: a review on occurrence and recent methods of analysis. Trends Food Sci. Tech. 36:96–136. doi: 10.1016/j.tifs.2014.01.005 [DOI] [Google Scholar]
  30. Prouillac C., B. Videmann M. Mazallon, and Lecoeur S.. 2009. Induction of cells differentiation and ABC transporters expression by a myco-estrogen, zearalenone, in human choriocarcinoma cell line (BeWO). Toxicology 263:100–107. doi: 10.1016/j.tox.2009.06.023 [DOI] [PubMed] [Google Scholar]
  31. Savard M. E. 2008. Mycotoxins – an introduction. Stewart Postharvest Rev. 4:1–6. doi: 10.2212/spr.2008.6.1 [DOI] [Google Scholar]
  32. Schatzmayr G., and Streit E.. 2013. Global occurrence of mycotoxins in the food and feed chain: facts and figures. World Mycotoxin J. 6:213–222. doi: 10.3920/WMJ2013.1572 [DOI] [Google Scholar]
  33. Slomczynska M., M. Duda, and Galas J.. 2001. Estrogen receptor alpha and beta expression in the porcine ovary. Folia Histochem. Cytobiol. 39:137–138. [PubMed] [Google Scholar]
  34. Taevernier L., E. Wynendaele L. De Vreese C. Burvenich, and De Spiegeleer B.. 2016. The mycotoxin definition reconsidered towards fungal cyclic depsipeptides. J. Environ. Sci. Health C 34:114–135. doi: 10.1080/10590501.2016.1164561 [DOI] [PubMed] [Google Scholar]
  35. Van de Wiel D. F., Erkens J., Koops W., Vos E., and Van Landeghern A. A.. 1981. Periestrous and midluteal time courses of circulating LH, FSH, prolactin, estradiol-17β and progesterone in the domestic pig. Biol. Reprod. 24:223–233. doi: 10.1095/biolreprod24.2.223 [DOI] [PubMed] [Google Scholar]
  36. Videmann B., M. Mazallon C. Prouillac M. Delaforge, and Lecoeur S.. 2009. ABCC1, ABCC2 and ABCC3 are implicated in the transepithelial transport of the myco-estrogen zearalenone and its major metabolites. Toxicol. Lett. 190:215–223. doi: 10.1016/j.toxlet.2009.07.021 [DOI] [PubMed] [Google Scholar]
  37. Wang H., E. W. Lee L. Zhou P. C. Leung D. D. Ross J. D. Unadkat, and Mao Q.. 2008. Progesterone receptor (PR) isoforms PRA and PRB differentially regulate expression of the breast cancer resistance protein in human placental choriocarcinoma bewo cells. Mol. Pharmacol. 73:845–854. doi: 10.1124/mol.107.041087 [DOI] [PubMed] [Google Scholar]
  38. Wilkens S. 2015. Structure and mechanism of ABC transporters. F1000 Prime Rep. 7:14. doi: 10.12703/P7-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Xiao J., Q. Wang K. M. Bircsak X. Wen, and Aleksunes L. M.. 2015. In vitro screening of environmental chemicals identifies zearalenone as a novel substrate of the placental BCRP/ABCG2 transporter. Toxicol. Res. 4:695–706. doi: 10.1039/C4TX00147H [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yi P., Pai C., and Liu J.. 2011. Isolation and characterization of a Bacillus licheniformis strain capable of degrading zearalenone. World J. Microb. Biot. 27:1035–1043. doi: 10.1007/s11274-010-0548-7 [DOI] [Google Scholar]
  41. Zhang Y., Z. Jia S. Yin A. Shan R. Gao Z. Qu M. Liu, and Nie S.. 2014. Toxic effects of maternal zearalenone exposure on uterine capacity and fetal development in gestation rats. Reprod. Sci. 21:743–753. doi: 10.1177/1933719113512533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhao L., Y. Lei Y. Bao R. Jia Q. Ma J. Zhang J. Chen, and Ji C.. 2015. Ameliorative effects of Bacillus subtilis ANSB01G on zearalenone toxicosis in pre-pubertal female gilts. Food Addit. Contam. 32:617–625. doi: 10.1080/19440049.2014.976845 [DOI] [PubMed] [Google Scholar]
  43. Zinedine A., J. M. Soriano J. C. Moltó, and Mañes J.. 2007. Review on the toxicity, occurrence, metabolism, detoxification, regulations and intake of zearalenone: an oestrogenic mycotoxin. Food Chem. Toxicol. 45:1–18. doi: 10.1016/j.fct.2006.07.030 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES