Skip to main content
PMC home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2018 Aug 29;96(10):4339–4347. doi: 10.1093/jas/sky292

Dietary cysteamine hydrochloride protects against oxidation, inflammation, and mucosal barrier disruption of broiler chickens challenged with Clostridium perfringens

Ning Liu 1,✉, Lin Lin 1, Jinquan Wang 2, Feike Zhang 3, Jian-ping Wang 1
PMCID: PMC6162622  PMID: 30169609

Abstract

This study aimed to investigate the effect of dietary cysteamine hydrochloride (CSH) on the growth performance, oxidation, inflammation, and gene expression of cytoskeleton and tight junction in the intestinal mucosa of broiler chickens challenged with Clostridium perfringens (C. perfringens). A total of 360 one-day-old broiler chicks were randomly distributed into 5 groups for a negative control (NC, without C. perfringens challenge), a positive control (PC, with C. perfringens challenge), and PC plus CSH at 100, 150, or 200 mg/kg of diet. The results showed that average daily gain, gain:feed, cecal population and enterotoxin of C. perfringens were negatively affected (P < 0.05) by the C. perfringens challenge, but were conversely affected (P < 0.05) by the CSH supplementation, and G:F reached to the level of NC group. The PC group increased (P < 0.05) serum diamine oxidase, malondialdehyde, protein carbonyl, interleukin-6, interleukin-1β, and tumor necrosis factor-α, whereas the supplementation of CSH decreased (P < 0.05) these parameters. Moreover, the C. perfringens challenge worsened the disruption of intestinal mucosal cytoskeleton and tight junction by downregulating (P < 0.05) the mRNA levels of actin protein of muscle Z-line alpha, syncoilin, synemin, tubulin, claudin-1, and zona occludens protein-2, while these parameters were partially compensated (P < 0.05) by CSH supplementation. For the dose trends of CSH, there were linear and quadratic (P < 0.05) effects on gain:feed, enterotoxins, tumor necrosis factor-α, tubulin alpha 1c, syncoilin, and synemin. In conclusion, the CSH can be an alternative against C. perfringens infection by beneficially regulating gut pathogenic bacteria and enterotoxins, oxidation, inflammation, cytoskeleton, and tight junction in broiler chickens.

Keywords: broiler chickens, Clostridium perfringens, cysteamine hydrochloride, inflammation, mucosal barrier

INTRODUCTION

Enteric diseases induced by Clostridium perfringens (C. perfringens) is one of the leading causes of death and economic losses in animal production with removal of antibiotic growth promoters (Kongsted et al., 2014; Abid et al., 2016). In chickens, the occurrence of necrotic enteritis is a cascading effect of oxidative stress, inflammatory response, cytoskeletal disruption and pore formation induced by the enterotoxins of C. perfringens in the intestinal mucosa (Rood et al., 2016; Awad et al., 2017). The intestinal mucosal barrier is mainly composed of epithelial cells and tight junction. Disruption of intestinal epithelial cytoskeleton by enterotoxins and consequent pore formation of the junction is a primary mechanism for the invasion of pathogens (Fasano and Nataro, 2004; O’Hara and Buret, 2008).

The cytoskeleton consists of 3 major structural elements: cellular microtubules, microfilaments, and intermediate filaments. These elements play an important role in maintaining cellular architecture and function (Alberts et al., 2015). Cytoskeletal protein is rich in cysteine residues, and its polymerization is dependent on tubulin-thiol groups (Kuriyama and Sakai, 1974). Cellular glutathione is important for the regulation of cytoskeletal organization (Leung and Chou, 1989). Perturbing the cellular redox status by depleting intracellular glutathione provoked disruption of microfilaments in human fibroblasts (Kletsas et al., 1998). The cytoskeleton can be regulated by exogenous chemical or bioactive materials (Baumgarten et al., 2017; Imai-Sumida et al., 2017; He et al., 2018), but little is known about the effect of dietary factors or nutraceuticals on the cytoskeleton in farm animals.

Cysteamine or its analogues as exogenous supplements can promote the transport of L-cysteine into cells for the synthesis of glutathione. As a feed additive, cysteamine hydrochloride (CSH) is the simplest and the most stable among aminothiol compounds (Reid, 1958). It is well documented that thiol-containing compounds have a biological role in anti-oxidation and anti-inflammation (Morrison et al., 2005; Zhou et al., 2017; Bai et al., 2018). Recent studies have demonstrated their antimicrobial and antibiofilm activity in cystic fibrosis models (Charrier et al., 2014; Fraser-Pitt et al., 2016, 2018). Furthermore, pretreatment with N-acetylcystein, a glutathione precursor, significantly enhanced the intracellular glutathione level and decreased the cytotoxicity as well as cytoskeletal changes in hepatocytes induced by microcystic cyanobacteria extract (Ding et al., 2000).

Information about the effect of thiol-containing compounds on intestinal mucosal barrier in farm animals challenged with C. perfringens is unclear. Hypothetically, CSH can protect against the disruption of cytoskeleton and pore-forming of tight junction in the intestinal mucosa induced by gut pathogens. The aims of the present study were to investigate the effect of dietary CSH on growth performance, cecal C. perfringens population and enterotoxins, serum oxidative stress and inflammatory factors, and gene expression of intestinal mucosal cytoskeleton and tight junction in broiler chickens challenged with C. perfringens.

MATERIALS AND METHODS

Treatments, Diets, and CSH

Treatments included a negative control (NC) without C. perfringens challenge, a positive control (PC) with C. perfringens challenge, and PC plus CSH at a dose of 100, 150, or 200 mg/kg in the expense of corn in the basal diet. The nutrition levels of basal diet were recommended by China Agricultural Standard (NY/T 33-2004). All diets were isonitrogenous and isocaloric, and fed as mash on air-dried basis. No antibiotics were offered to broilers via either feed or water throughout the trial. The CSH was coated and provided by Hangzhou King Techina Technology Co., Ltd (Hangzhou, China). The compositions of ingredients and nutrients in the basal diet were listed in Table 1.

Table 1.

Ingredients and nutrient levels of basal diet (air-dry basis)

Ingredients Content, g/kg Nutrients1 Content, g/kg
Corn 605.0 Crude protein 219.7
Soybean meal 255.0 Metabolizable energy, MJ/kg 12.53
Corn gluten meal 80.0 Ca 9.6
Soybean oil 29.0 Total P 6.9
Lysine 3.0 Nonphytate P 4.8
Methionine 1.5 Crude fat 32.1
Salt 3.0 Crude fiber 22.8
Dicalcium phosphate 21.5 Methionine 5.2
Limestone 12.0 Methionine + cysteine 8.5
Choline chloride 1.5 Lysine 12.1
Premix2 5.0
Open in a new tab

1Calculated by Chinese Feed Database, version 21, 2010.

2Provided per kg diet: vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; Mn, 120 mg; I, 0.70 mg; Fe, 100 mg; Cu, 8 mg; Zn, 100 mg; and Se, 0.30 mg.

Animals, C. perfringens Challenge, and Samples

All protocols relating to the care and use of live animals were approved by the Institutional Committee for Animal Use and Ethics of Henan University of Science and Technology (Luoyang, China).

A total of 360 one-day-old male Cobb broilers were randomly distributed into 5 groups with 6 replicates (pens) of 12 chicks each. All chicks were reared on floor pens (1.2 m × 1.2 m) in an environmentally controlled facility at the Research Center of the Henan University of Science and Technology and given ad libitum access to diets and water throughout a 28-d experimental period. The room temperature was maintained at 32 °C for the first 5 d and then gradually decreased to 22 °C by 28 d old. Lighting was provided 24 h/d at first 2 d and 18 h/d for the remainder days. All chicks received respective experimental diets from the first day of age. Birds and feed in each pen were weighed at the beginning and end of the trial, and once mortality was occurred, average daily feed intake (ADFI), average daily gain (ADG), and gain:feed (G:F) were adjusted on a pen basis. All birds were monitored for general health twice a day.

At day 8, 9, 12, and 13 of age, each chick in PC and CSH treatments was gavaged with 1 mL of C. perfringens (1.0 × 108 cfu/mL). Chicks in NC group received the same volume of sterile fluid thioglycollate broth.

Six birds per pen were randomly selected at day 28, weighed, euthanized by carbon dioxide, and then dissected. Blood was immediately drawn from the heart with a syringe and aliquoted into sterile vials for the preparation for serum according to the method by Liu et al. (2008). Duodenum was dissected and flushed with phosphate buffer saline (0 to 4 °C) and mucosa was scrapped and stored at −80 °C for the analysis of gene expression. All cecal digesta was collected and pooled for gut microflora and enterotoxin analysis.

Detection of Bacteria, Spores, and Enterotoxin

Cecal digesta (1.000 g) collected above was diluted with ice-cold sterile peptone water (9 mL, 0.1%) and thoroughly mixed. The numbers of C. perfringens were estimated by preparing serial dilutions of the mixture, plating on sulfite polymixin sulphadiazine agar (HB0256; Qingdao Hopebio Co., Ltd, Shandong, China), and counting colonies (Liu et al., 2018). The number of colony-forming units (cfu) was expressed as a logarithmic (log10) transformation per gram of cecal content. For the enumeration of spores, 1-mL sample was heated for 20 min at 75 °C to kill vegetative cells and induce the germination of mature spores. The heat-treated culture was then serially diluted in sterile peptone, plated on sulfite polymixin sulphadiazine agar, and incubated anaerobically at 37 °C. The colonies, representing germinated spores, were counted.

The detection of enterotoxin from C. perfringens was carried out using an ELISA kit (TechLab, Blacksburg, VA) according to its operating manual. Briefly, fresh cecal digesta (5.0 g) was centrifuged at 12,000 × g for 10 min and the supernatant from each sample was diluted 1 to 5 and added to the wells. Buffered protein solution + 0.02% thimerosal was used as the negative control solution. Conjugate contains polyclonal antibody specific for enterotoxin coupled to horseradish peroxidase—in a buffered protein solution + 0.02% thimerosal. Substrate was buffered solution containing tetramethylbenzidine and peroxide. Positive control reagent was enterotoxin in a buffered protein solution containing 0.02% thimerosal. Stop solution was 0.6 mol/liter sulfuric acid. The intra-assay of the kit was CVs < 5%, and inter-assay was CVs < 9%.

Analysis of Oxidation, Inflammation, and mRNA Expression

The mucosal concentrations of oxidative products and inflammatory factors were measured using chicken speciation kits from Nanjing Jiancheng Biological Institute (Nanjing, China) for diamine oxidase (DAO; EC 1.4.3.6; A088), malondialdehyde (MDA; A003), protein carbonyl (PCO; A087), interleukin-6 (IL-6; assay range, 15.0–1000 ng/liter), interleukin-1β (IL-1β; assay range, 20–600 ng/liter), and tumor necrosis factor-α (TNF-α; assay range, 0.30–200 ng/liter). Three parallel tests with aliquots of the same sample were performed for all samples and all chemical and biochemical analyses.

Total mRNA isolation and cDNA synthesis were carried out according to the description by Liu et al. (2008), and the transcriptional profiles of target genes were expressed as the relative expression to glyceraldehyde-3-phosphate dehydrogenase gene. The data of gene expression were expressed as 2−ΔΔCt according to the method by Livak and Schmittgen (2001). Primer information for qPCR was listed in Table 2. Primers and qPCR reagents were provided by Dalian TaKaRa Co., Ltd (Liaoning, China). The qPCR reactions were set at 10 μL with 5 μL of SYBR Green Master Mix, 1 μL of primer, 4 μL of 10× diluted cDNA. The housekeeping gene was included when measured PCR efficiencies for all genes, and the amplification efficiencies between 90% and 100% were acceptable. All qPCRs were run in triplicates on the same thermal cycles (50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min) on the ABI Prism 7900HT Fast Real-Time PCR System. No amplification signal was detected in water or no-RT RNA samples. The PCR products for all genes were confirmed by sequencing at Dalian TaKaRa Co., Ltd.

Table 2.

Information of primers for quantitative real-time PCR

Primers (5′→3′)
Names GenBank Forward Reverse Length (bp)
TUBA1C NM_001305272.1 gctcgtacagggaacaatcc attgagacacacaggagaggac 164
TUBB6 NM_001031012.2 gctactgtcttccgtggtcc ttgccaatgaacgtggaagc 170
CAPZA1 NM_205515.1 aatggccgactttgaggacc caccggagtgaactgatcca 196
CAPZA2 NM_001004380.1 ccgcaccaagattgactgga gcaaaagcccatgctgactg 178
SYNM NM_204809.3 acaagcacgagagtcgtctg ccccactgtggtcactttca 212
SYNC XM_015297851.1 gcacgtaaactggcgacttc ctgggtctattgggctgcat 171
CLDN1 NM_001013611.2 acccacagcctaagtgcttc aggtctcataaggccccact 200
ZO-2 NM_204918.1 agatgcgtttgctgcacctt gacgtatagctgtgctccca 149
GAPDH K01458.1 ggtggccatcaatgatccct gcccatttgatgttgctggg 174
Open in a new tab

CAPZA, actin protein of muscle Z-line alpha; CLDN1, claudin-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SYNC, syncoilin; SYNM, synemin; TUBA1C, tubulin alpha 1c; TUBB6, tubulin beta 6; ZO-2, zona occludens protein-2.

Statistics

Data were analyzed using contrasts of 1-way ANOVA procedure (SAS Inst. Inc., Cary, NC). Linear and quadratic equation of polynomial contrasts were used for the analysis of dose trends of CSH at 100, 150, and 200 mg/kg. Pen was the experimental unit for growth performance. The average of 6 killed birds per pen was the experimental unit for gut bacteria (log10 cfu) and enterotoxins, oxidative and inflammatory parameters, and gene expression. Differences of variables were separated using Tukey’s studentized range test at P < 0.05 level of significance.

RESULTS

Growth Performance and Cecal C. perfringens Status

The C. perfringens challenge in the PC group depressed (P < 0.05) ADFI, ADG, and G:F compared to the NC group (Table 3). The supplementation of CSH at doses of 150 or 200 mg/kg increased (P < 0.05) ADFI. The ADG averagely increased by 13.3% (P < 0.05) in the 3 levels of CSH groups compared to the PC group, but did not reach the levels of NC group, whereas the G:F increased by 9.6% (P < 0.05) and reached the levels of NC group. There were linear (P < 0.001) and quadratic (P = 0.046) effects of CSH doses on ADG, and a linear (P = 0.042) effect on G:F. The mortality of broiler chickens also worsened in the PC group, and attenuated by CSH supplementation, but these influences were not significant due to the greater difference intragroup than intergroup.

Table 3.

Effect of cysteamine hydrochloride on the growth performance and Clostridium perfringens in broiler chickens

PC + CSH, g/kg of diet Dose trends (P-values)
Items NC PC 100 150 200 SEM Linear Quadratic
Growth performance at day 1 to 28
 ADFI, g per bird 47.86a 45.47c 46.38bc 47.06ab 46.97ab 0.278 0.104 0.211
 ADG, g per bird 35.17a 30.10d 33.55c 34.33b 34.40b 0.113 <0.001 0.046
 G:F 0.735a 0.662b 0.723a 0.729a 0.732a 0.003 0.042 0.670
 Mortality, % 2.78 8.33 4.17 4.17 2.78 1.878 0.599 0.761
Cecal status of C. perfringens at day 28
 Numbers, cfu/g 2.64c 5.86a 3.98b 3.90b 3.89b 0.052 0.274 0.594
 Spores, cfu/g 1.14d 3.51a 2.03b 1.94b 1.68c 0.039 <0.001 0.114
 Enterotoxin1, U/mL 0.62d 2.72a 1.80b 1.71b 1.35c 0.032 <0.001 0.012
Open in a new tab

ADG, average daily gain; ADFI, average daily feed intake; G:F, gain:feed; C. perfringens, Clostridium perfringens; CSH, cysteamine hydrochloride; NC, negative control, without C. perfringens challenge; PC, positive control, challenged with C. perfringens.

a–dMeans within a row with no common superscripts are significantly different (P < 0.05).

1Values of optical density.

The cecal C. perfringens, spores, and enterotoxins in the PC group were the greatest (P < 0.05) among treatments, and the supplementation of CSH decreased (P < 0.05) their levels, but did not reach the levels of NC group. Linear decreasing effects (P < 0.001) of CSH on the spores and enterotoxins, and a quadratic decreasing effect (P ≤ 0.012) on enterotoxins were found. The effect of CSH at 200 mg/kg on spores and enterotoxins was more pronounced (P < 0.05) than that of CSH at other 2 doses.

The C. perfringens challenge in PC group increased (P < 0.05) serum DAO, MDA, and PCO, while supplementation of CSH at 100, 150, or 200 mg/kg decreased (P < 0.05) these parameters, but did not reach the levels of NC group (Table 4). These parameters decreased linearly (P ≤ 0.006) with the increasing doses of CSH. Additionally, the levels of DAO and PCO in the treatment of CSH at 200 mg/kg were lower (P < 0.05) than in the dose of 100 mg/kg.

Table 4.

Effect of cysteamine hydrochloride on the serum parameters of oxidation and inflammation of broiler chickens challenged with Clostridium perfringens

PC + CSH, g/kg of diet Dose trends (P-values)
Items NC PC 100 150 200 SEM Linear Quadratic
Oxidative parameters
 DAO, U/liter 0.70d 2.21a 1.08b 0.99bc 0.97c 0.026 0.002 0.226
 MDA, nmol/liter 2.78c 5.02a 4.21b 4.08b 3.98b 0.058 0.006 0.760
 PCO, nmol/g 22.91d 37.57a 31.33b 29.43bc 28.01c 0.560 0.001 0.739
Inflammatory factors
 IL-1β, ng/liter 42.54d 133.6a 98.76b 82.60c 75.46c 2.300 <0.001 0.077
 IL-6, ng/liter 58.68c 154.5a 110.8b 111.7b 103.2b 2.513 0.083 0.204
 TNF-α, ng/liter 34.84d 125.8a 80.10b 80.29b 68.27c 1.647 <0.001 0.001
Open in a new tab

a–d Means within a row with no common superscripts are significantly different (P < 0.05).

CSH, cysteamine hydrochloride; DAO, diamine oxidase; IL-1β, interleukin-1β; IL-6, interleukin-6; MDA, malondialdehyde; NC, negative control, without C. perfringens challenge; PC, positive control, challenged with C. perfringens; PCO, protein carbonyl; TNF-α, tumor necrosis factor-α.

The C. perfringens challenge in the PC group also caused increases (P < 0.05) of serum IL-1β, IL-6, and TNF-α, and the supplementation of CSH decreased (P < 0.05) these parameters. The doses of CSH showed a linear effect on IL-1β (P < 0.001), and both linear and quadratic effect on TNF-α (P ≤ 0.001).

As shown in Table 5, the C. perfringens challenge in the PC group downregulated (P < 0.05) the mRNA expressions of tubulin alpha 1c (TUBA1C), tubulin beta 6 (TUBB6), actin protein of muscle Z-line alpha (CAPZA1), actin protein of muscle Z-line alpha (CAPZA2), syncoilin (SYNC), and synemin (SYNM) in the mucosa of intestine. The supplementation of CSH at 100, 150, or 200 mg/kg upregulated (P < 0.05) these gene expressions, but only the level of SYNC in the group of CSH at 200 mg/kg reached the level of NC group. There were linear effects (P ≤ 0.002) of CSH doses on the mRNA expressions of TUBA1C, CAPZA1, CAPZA2, SYNC, and SYNM, and quadratic effects (P ≤ 0.040) on TUBA1C, SYNC, and SYNM.

Table 5.

Effect of cysteamine hydrochloride on the gene expression of cytoskeleton and tight junction in the intestinal mucosa of broiler chickens challenged with Clostridium perfringens

PC + CSH, g/kg of diet Dose trends (P-values)
Items NC PC 100 150 200 SEM Linear Quadratic
Cytoskeleton (mRNA expression, 2−ΔΔCt)
 TUBA1C 4.08a 2.74d 3.36c 3.56b 3.54bc 0.038 <0.001 0.001
 TUBB6 3.71a 2.47c 3.01b 2.98b 3.04b 0.073 0.699 0.492
 CAPZA1 2.80a 1.13c 2.18b 2.20b 2.28b 0.039 0.095 0.596
 CAPZA2 4.19a 2.90d 3.35c 3.43bc 3.62b 0.047 0.002 0.340
 SYNC 1.51a 0.86c 1.33b 1.34b 1.47a 0.018 <0.001 0.040
 SYNM 1.99a 0.43d 0.74c 1.20b 1.28b 0.071 <0.001 0.022
Tight junction (mRNA expression, 2−ΔΔCt)
 CLDN1 3.76a 0.70d 2.08c 2.52b 2.66b 0.050 <0.001 0.024
 ZO-2 0.65a 0.42d 0.50c 0.56b 0.56b 0.008 <0.001 0.013
Open in a new tab

a–dMeans within a row with no common superscripts are significantly different (P < 0.05).

CAPZA, actin protein of muscle Z-line alpha; CLDN1, claudin-1; CSH, cysteamine hydrochloride; NC, negative control, without C. perfringens challenge; PC, positive control, challenged with C. perfringens; SYNC, syncoilin; SYNM, synemin; TUBA1C, tubulin alpha 1c; TUBB6, tubulin beta 6; ZO-2, zona occludens protein-2.

The mRNA expressions of intestinal mucosal claudin-1 (CLDN1) and zona occludens protein-2 (ZO-2) were also downregulated (P < 0.05) by C. perfringens challenge, while the supplementation of CSH at the 3 doses upregulated (P < 0.05) the mRNA levels of these genes, but they were lower (P < 0.05) than the NC group. Linear (P < 0.001) and quadratic (P ≤ 0.024) upregulating trends of the 2 genes with the increasing doses of CSH were found. Additionally, the doses of CSH at 150 and 200 mg/kg showed a greater effect (P < 0.05) on the 2 genes than CSH at 100 mg/kg.

DISCUSSION

In the present study, C. perfringens challenge depressed the ADG and G:F of broiler chickens, which was consistent with the report by Liu et al. (2018), while these negative effects were attenuated by CSH supplementation, indicating that the CSH can partially protect broiler chickens from C. perfringens infection. It was reported that the CSH added at 70 mg/kg of feed improved the growth of grower or finisher pigs (Dunshea, 2007; Miller et al., 2016). In broiler chickens, cysteamine supplemented at 60 and 80 mg/kg (equal to CSH at 75 and 100 mg/kg) of feed improved feed conversion along the rearing cycle, but did not affect feed intake and weight gain (Nunes et al., 2012). However, this information is unavailable in a scenario of C. perfringens challenge in farm animals.

In the present study, the CSH added at 150 and 200 mg/kg improved ADFI of the broiler chickens challenged with C. perfringens, and supplemented at 100, 150, and 200 mg/kg improved ADG and G:F. The growth-promoting effect of CSH is attributed to its inhibitory action on somatostatin, a hormone which inhibits the GH secretion of the growth hormone (Francis et al., 1990; McLeod et al., 1995). Additionally, cysteamine occurs naturally in animal tissues, and is endogenously synthesized, metabolized, and excreted rapidly by the animal organism (Reid, 1958). Clearly, exogenous supplementation may influence the physiological action of cysteamine, but more studies on this are needed.

The birds in the PC group in the present study had the greatest levels of C. perfringens and its spores and enterotoxin in the cecal contents, whereas CSH supplementation decreased these numbers. Generally, when C. perfringens is out of balance in the gut, sporulation takes place, consequently more enterotoxin is released, and disease follows. In the present study, the CSH decreased the number of spores, in most part, indicating that CSH depressed sporulation and exterotoxin secretion. Fraser-Pitt et al. (2018) reported that cysteamine sensitized Pseudomonas aeruginosa to killing by reactive oxygen and nitrogen species, and potentiated the antimicrobial activity of colistin and macrolide. Similarly, cysteamine showed the activity against cystic fibrosis pathogen Burkholderia cepacia complex (Fraser-Pitt et al., 2016).

Cysteamine is also an endogenous aminothiol produced in cells as consequence of coenzyme A metabolism. In a reducing environment in the absence of transition metals, cysteamine can act as an antioxidant, and readily form mixed disulfides with susceptible cysteine sulfhydryl groups (O’Brian and Chu, 2005), which is key for many reported biological activities. Additionally, cysteamine can be metabolized as hypotaurine and taurine via aminothiol dioxygenase in the cells of animals, but it is considered to be toxic for bacteria, fungi, and parasites because they are lack of the enzyme (Dominy et al., 2007). These reports, coupled with the present study, demonstrated the broad-spectrum antimicrobial activity of cysteamine, but the dependence on the physiological status of transition metals needs further study.

Serum DAO level is employed as a useful marker of intestinal mucosal integrity. The MDA is one of the final products of polyunsaturated fatty acids peroxidation in the cells. An increase in free radicals causes overproduction of MDA. Also, the higher circulatory PCO is related to the oxidative damage of proteins. In the present study, their serum levels were contrarily affected by the C. perfringens challenge and CSH supplementation, indicating that the lipid oxidation and protein carbonylation in the intestinal mucosa or other organs were attenuated by the supplemental CSH. The information about the effect of CSH or its analogues on the DAO and PCO is very limited. Wilmer et al. (2011) argued that cysteamine did not affect protein turnover, total glutathione levels, protein oxidation, and lipid peroxidation, but normalized glutathione redox status in cystinotic cells.

Zhou et al. (2017) reported that cysteamine increased glutathione and its peroxidase, and decreased MDA in pigs. Also, the CSH improved antioxidant status and delayed pig meat discoloration by improving glutathione levels and anti-oxidase activity (Bai et al., 2018). Thus, in the present study, besides the inhibition of C. perfringens by CSH, the enhanced glutathione activity in the CSH treatments also contributed to the lower oxidative stress, because the CSH or derivatives act through sulfhydryl-disulfide exchange reactions in glutathione redox cycle, and the providing of sulfhydryl group can theoretically facilitate the synthesis and turnover of glutathione (Courtney-Martin and Pencharz, 2016).

Thiol-containing compounds also influence inflammation and immunity by intracellular glutathione and cysteine levels. Cysteamine is a U.S. FDA-approved drug with anti-inflammatory and mucolytic properties (Kopp et al., 2017). Indeed, in the present study, the serum TNF-α, IL-1β, and IL-6 were increased by C. perfringens challenge, and were decreased by CSH. In farm animals, cysteamine supplementation increased the concentrations of secretory IgA, IgM, and IgG in the jejunal mucosa of pigs (Zhou et al., 2017), and induced proliferation and differentiation of IgA-positive cells and intraepithelial lymphocytes in the intestinal mucosa of chickens by reducing the number of somatostatin-positive cells (Yang et al., 2007).

In the present study, the supplementation of CSH protected the architecture and function of intestinal mucosal cells by upregulating the mRNA profiles of cytoskeletal protein. The findings indicate that exogenous providing of CSH facilitates the synthesis of cellular glutathione and consequently protects cytoskeleton that is suffering attack from the toxic protein of C. perfringens, as shown in studies that cellular glutathione was important to counteract the reorganization of cytoskeleton (Leung and Chou, 1989; Kletsas et al., 1998).

Moreover, the thiol group contributes not only to the cellular glutathione level but also to the component of microtubules and tubulin polymerization (Kuriyama and Sakai, 1974), and intracellular and extracellular thiol redox status modulates the proliferative potential of epithelial cells (Perez et al., 2017). The information about the effect of CSH on cytoskeleton is unavailable, but the tunability of cytoskeleton by N-acetylcystein or other bioactive materials (Ding et al., 2000; Baumgarten et al., 2017; Imai-Sumida et al., 2017; He et al., 2018) indirectly supported the present study, and its mechanistic signaling pathway will be an interesting topic for the future study.

The disruption of cytoskeleton is usually companied by the dysfunction of tight junction with the invasion of pathogens. In the present study, C. perfringens challenge downregulated CLDN1 and ZO-2, indicating the disruption of tight junction barrier, and this was attenuated by the supplementation of CSH. Similar effects were found in studies that cysteamine supplementation increased the mRNA abundance of tight junction, including occludin, claudin-1, and zonula occludens protein-1, in the jejunum mucosa of finishing pigs (Zhou et al., 2017) and N-acetyl-L-cysteine protected occludin, zona occludens-1, claudin-3, E-cadherin, and beta-catenin, as well as the actin cytoskeleton in mouse colon (Shukla et al., 2016).

CONCLUSIONS

The C. perfringens challenge negatively affected ADG, G:F, enterotoxin, lipid peroxidation, protein carbonylation, and inflammatory factors, but these properties were attenuated by the supplementation of CSH, and G:F reached the level of NC group. Moreover, the C. perfringens challenge disrupted intestinal mucosal barrier by downregulating the mRNA levels of cytoskeleton and tight junction, whereas CSH upregulated these parameters. By contrasts, linear and quadratic dose trends of CSH on G:F, enterotoxins, TNF-α, tubulin alpha 1c, syncoilin, and synemin were found. The results suggest that the CSH can protect against C. perfringens infection by reducing enterotoxins, oxidation, inflammation, and disruption of cytoskeleton and tight junction in broiler chickens.

ACKNOWLEDGMENTS

This research was supported by National Natural Science Foundation of China (31272466) and School-Enterprise Cooperation Program between Henan University and Technology and Luoyang Xintai Agro-pastoral Technology Co., Ltd.

LITERATURE CITED

  1. Abid S. A., Azeem T., Chaudhary Z. I., Rehman Z. U., and Umar S.. 2016. Emerging threat of necrotic enteritis in poultry and its control without use of antibiotics: a review. J. Anim. Plant Sci. 26:1556–1567. doi:10.1080/03079450400013162 [Google Scholar]
  2. Alberts B., Johnson A., Lewis J., Morgan D., Raff M., Roberts K., and Walter P.. 2015. The cytoskeleton. In: Wilson J. H. and Hunt T., editors, Molecular biology of the cell. Garland Press, New York: p 889–962. [Google Scholar]
  3. Awad W. A., Hess C., and Hess M.. 2017. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins 9:60 doi:10.3390/toxins9020060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bai M., Liu H., Xu K., Zou B., Yu R., Liu Y., Xing W., Du H., Li Y., and Yin Y.. 2018. Effects of dietary coated cysteamine hydrochloride on pork color in finishing pigs. J. Sci. Food Agric. 98:1743–1750. doi:10.1002/jsfa.8647 [DOI] [PubMed] [Google Scholar]
  5. Baumgarten S., Hobeika E., Winston N., Fierro M. A., Zamah A. M., Scoccia H., and Stocco C.. 2017. Follicle stimulating hormone (FSH) regulates cytoskeletal protein expression and cell structure during human granulosa cell differentiation. Fertil. Steril. 108:e211 doi:10.1016/j.fertnstert.2017.07.622 [Google Scholar]
  6. Charrier C., Rodger C., Robertson J., Kowalczuk A., Shand N., Fraser-Pitt D., Mercer D., and O’Neil D.. 2014. Cysteamine (Lynovex®), a novel mucoactive antimicrobial & antibiofilm agent for the treatment of cystic fibrosis. Orphanet J. Rare Dis. 9:189 doi:10.1186/s13023-014-0189-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Courtney-Martin G., and Pencharz P. B.. 2016. Sulfur amino acids metabolism from protein synthesis to glutathione in the molecular nutrition of amino acids and proteins. Academic Press, Rochester, NY. [Google Scholar]
  8. Ding W. X., Shen H. M., and Ong C. N.. 2000. Microcystic cyanobacteria extract induces cytoskeletal disruption and intracellular glutathione alteration in hepatocytes. Environ. Health Perspect. 108:605–609. doi:10.2307/3434879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dominy J. E. Jr, Simmons C. R., Hirschberger L. L., Hwang J., Coloso R. M., and Stipanuk M. H.. 2007. Discovery and characterization of a second mammalian thiol dioxygenase, cysteamine dioxygenase. J. Biol. Chem. 282:25189–25198. doi:10.1074/jbc.M703089200 [DOI] [PubMed] [Google Scholar]
  10. Dunshea F. R. 2007. Porcine somatotropin and cysteamine hydrochloride improve growth performance and reduce back fat in finisher gilts. Aust. J. Exp. Agric. 47:796–800. doi:10.1071/EA06243 [Google Scholar]
  11. Fasano A., and Nataro J. P.. 2004. Intestinal epithelial tight junctions as targets for enteric bacteria-derived toxins. Adv. Drug Deliv. Rev. 56:795–807. doi:10.1016/j.addr.2003.10.045 [DOI] [PubMed] [Google Scholar]
  12. Francis B. H., Baskin D. G., Saunders D. R., and Ensinck J. W.. 1990. Distribution of somatostatin-14 and somatostatin-28 gastrointestinal-pancreatic cells of rats and humans. Gastroenterology 99:1283–1291. doi:10.1016/0016-5085(90)91151-U [DOI] [PubMed] [Google Scholar]
  13. Fraser-Pitt D., Mercer D., Lovie E., Robertson J., and O’Neil D.. 2016. Activity of cysteamine against the cystic fibrosis pathogen Burkholderia cepacia complex. Antimicrob. Agents Chemother. 60:6200–6206. doi:10.1128/AAC.01198-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fraser-Pitt D., Mercer D., Smith D., Kowalczuk A., Robertson J., Lovie E., Perenyi P., Cole M., Doumith M., Hill R.,. et al. 2018. Cysteamine, an endogenous aminothiol, and cystamine, the disulfide product of oxidation, increase Pseudomonas aeruginosa sensitivity to reactive oxygen and nitrogen species and potentiate therapeutic antibiotics against bacterial infection. Infect. Immun. 86:e00947-17 doi:10.1128/IAI.00947-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. He F. F., Bao D., Su H., Wang Y. M., Lei C. T., Zhang C. Y., Ye C., Tang H., Wan C., You C. Q.,. et al. 2018. IL‐6 increases podocyte motility via MLC‐mediated focal adhesion impairment and cytoskeleton disassembly. J. Cell. Physiol. 233:7173–7181. doi:10.1002/jcp.26546 [DOI] [PubMed] [Google Scholar]
  16. Imai-Sumida M., Chiyomaru T., Majid S., Saini S., Nip H., Dahiya R., Tanaka Y., and Yamamura S.. 2017. Silibinin suppresses bladder cancer through down-regulation of actin cytoskeleton and PI3K/Akt signaling pathways. Oncotarget 8:92032–92042. doi:10.18632/oncotarget.20734 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kletsas D., Barbieri D., Stathakos D., Botti B., Bergamini S., Tomasi A., Monti D., Malorni W., and Franceschi C.. 1998. The highly reducing sugar 2-deoxy-D-ribose induces apoptosis in human fibroblasts by reduced glutathione depletion and cytoskeletal disruption. Biochem. Biophys. Res. Commun. 243:416–425. doi:10.1006/bbrc.1997.7975 [DOI] [PubMed] [Google Scholar]
  18. Kongsted H., Stege H., Toft N., and Nielsen J. P.. 2014. The effect of new neonatal porcine diarrhoea syndrome (NNPDS) on average daily gain and mortality in 4 Danish pig herds. BMC Vet. Res. 10:90 doi:10.1186/1746-6148-10-90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kopp B. T., Shrestha C., Assani K., and Schlesinger L. S.. 2017. Cysteamine-mediated clearance of multi-drug resistant pathogens from cystic fibrosis macrophages. Am. J. Respir. Crit. Care Med. 195:A4850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kuriyama R., and Sakai H.. 1974. Role of tubulin-SH groups in polymerization to microtubules. Functional-SH groups in tubulin for polymerization. J. Biochem. 76:651–654. doi:10.1093/oxfordjournals.jbchem.a130609 [DOI] [PubMed] [Google Scholar]
  21. Leung M. F., and Chou I. N.. 1989. Relationship between 1-chloro-2,4-dinitrobenzene-induced cytoskeletal perturbations and cellular glutathione. Cell Biol. Toxicol. 5:51–66. doi:10.1007/BF00141064 [DOI] [PubMed] [Google Scholar]
  22. Liu N., Ru Y. J., Li F. D., and Cowieson A. J.. 2008. Effect of diet containing phytate and phytase on the activity and messenger ribonucleic acid expression of carbohydrase and transporter in chickens. J. Anim. Sci. 86:3432–3439. doi:10.2527/jas.2008-1234 [DOI] [PubMed] [Google Scholar]
  23. Liu N., Wang J. Q., Jia S. C., Chen Y. K., and Wang J. P.. 2018. Effect of yeast cell wall on the growth performance and gut health of broilers challenged with aflatoxin B1 and necrotic enteritis. Poult. Sci. 97:477–484. doi:10.3382/ps/pex342 [DOI] [PubMed] [Google Scholar]
  24. Livak K. J., and Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402–408. doi:10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  25. McLeod K. R., Harmon D. L., Schillo K. K., Hileman S. M., and Mitchell G. E. Jr. 1995. Effects of cysteamine on pulsatile growth hormone release and plasma insulin concentrations in sheep. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 112:523–533. doi:10.1016/0305-0491(95)00109-3 [DOI] [PubMed] [Google Scholar]
  26. Miller D. W., Prosser Z., Chee E. Y. W., Hansen C. F., Dunshea F. R., Mullan B. P., and Pluske J. R.. 2016. Dietary stimulation of the endogenous somatotropic axis in weaner and grower-finisher pigs using medium chain triglycerides and cysteamine hydrochloride. J. Anim. Sci. Biotechnol. 7:61 doi:10.1186/s40104-016-0121-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Morrison J. P., Coleman M. C., Aunan E. S., Walsh S. A., Spitz D. R., and Kregel K. C.. 2005. Thiol supplementation in aged animals alters antioxidant enzyme activity after heat stress. J. Appl. Physiol. 99:2271–2277. doi:10.1152/japplphysiol.00412.2005 [DOI] [PubMed] [Google Scholar]
  28. Nunes J. O., Bertechini A. G., Brito J. Á. G. D., Makiyama L., Mesquita F. R., and Nishio C. M.. 2012. Evaluation of cysteamine associated with different energy patterns in diets for broiler chickens. R. Bras. Zootec. 41:1956–1960. doi:10.1590/S1516-35982012000800022 [Google Scholar]
  29. O’Brian C. A., and Chu F.. 2005. Post-translational disulfide modifications in cell signaling--role of inter-protein, intra-protein, S-glutathionyl, and S-cysteaminyl disulfide modifications in signal transmission. Free Radic. Res. 39:471–480. doi:10.1080/10715760500073931 [DOI] [PubMed] [Google Scholar]
  30. O’Hara J. R., and Buret A. G.. 2008. Mechanisms of intestinal tight junctional disruption during infection. Front. Biosci. 13:7008–7021. doi:10.2741/3206 [DOI] [PubMed] [Google Scholar]
  31. Perez S., Taléns-Visconti R., Rius-Pérez S., Finamor I., and Sastre J.. 2017. Redox signaling in the gastrointestinal tract. Free Radic. Biol. Med. 104:75–103. doi:10.1016/j.freeradbiomed.2016.12.048 [DOI] [PubMed] [Google Scholar]
  32. Reid E. E. 1958. Organic chemistry of bivalent sulfur. Chemical Publishing Co, Los Angeles, CA. [Google Scholar]
  33. Rood J. I., Keyburn A. L., and Moore R. J.. 2016. NetB and necrotic enteritis: the hole movable story. Avian Pathol. 45:295–301. doi:10.1080/03079457.2016.1158781 [DOI] [PubMed] [Google Scholar]
  34. Shukla P. K., Gangwar R., Manda B., Meena A. S., Yadav N., Szabo E., Balogh A., Lee S. C., Tigyi G., and Rao R.. 2016. Rapid disruption of intestinal epithelial tight junction and barrier dysfunction by ionizing radiation in mouse colon in vivo: protection by N-acetyl-L-cysteine. Am. J. Physiol. Gastrointest. Liver Physiol. 310:G705–G715. doi:10.1152/ajpgi.00314.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wilmer M. J., Kluijtmans L. A., van der Velden T. J., Willems P. H., Scheffer P. G., Masereeuw R., Monnens L. A., van den Heuvel L. P., and Levtchenko E. N.. 2011. Cysteamine restores glutathione redox status in cultured cystinotic proximal tubular epithelial cells. Biochim. Biophys. Acta 1812:643–651. doi:10.1016/j.bbadis.2011. 02.010 [DOI] [PubMed] [Google Scholar]
  36. Yang Q., Lian G., and Gong X.. 2007. Enhancement of mucosal immune responses in chickens by oral administration of cysteamine. Poult. Sci. 86:1323–1328. doi:10.1093/ps/86.7.1323 [DOI] [PubMed] [Google Scholar]
  37. Zhou P., Luo Y., Zhang L., Li J., Zhang B., Xing S., Zhu Y., Gao F., and Zhou G.. 2017. Effects of cysteamine supplementation on the intestinal expression of amino acid and peptide transporters and intestinal health in finishing pigs. Anim. Sci. J. 88:314–321. doi:10.1111/asj.12626 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES