Skip to main content
Antimicrobial Resistance and Infection Control logoLink to Antimicrobial Resistance and Infection Control
. 2018 Sep 29;7:115. doi: 10.1186/s13756-018-0409-y

Phenotypic analysis of antibiotic resistance and genotypic study of the vacA, cagA, iceA, oipA and babA genotypes of the Helicobacter pylori strains isolated from raw milk

Reza Ranjbar 1,, Farid Yadollahi Farsani 2, Farhad Safarpoor Dehkordi 3
PMCID: PMC6162967  PMID: 30288255

Abstract

Background

Foods with animal origins and particularly milk play a considerable role in transmission of Helicobacter pylori. The current study was performed to assess phenotypic characters of antibiotic resistance and genotyping pattern of vacA, cagA, iceA, oipA and babA2 alleles amongst the H. pylori strains isolated from raw milk.

Methods

Six-hundred and thirty raw milk samples were collected and cultured on Wilkins Chalgren anaerobe media. Antibiotic resistance and genotyping patterns were studied using disk diffusion and PCR, respectively.

Results

Sixty-seven out of 630 (10.63%) raw milk samples were positive for H. pylori. Ovine raw milk (17.27%) samples had the highest prevalence of H. pylori, while camel (5.00%) had the lowest. H. pylori strains harbored the highest prevalence of resistance against ampicillin (82.08%), tetracycline (76.11%), amoxicillin (74.62%), metronidazole (65.67%) and erythromycin (53.73%). Prevalence of resistance against more than 10 types of antibiotics was 17.91%. VacA s1a (83.58%), m1a (80.59%), s2 (77.61%) and m2 (68.65%), cagA (73.13%) and babA2 (44.77%) were the most commonly detected genotypes. We found that S1am1a (56.71%), s2m1a (56.71%), s1 am2 (43.28%) and s2 m2 (43.28%) were the most commonly detected genotyping pattern. Frequency of cagA-, oipA- and babA2- genotypes were 26.86%, 62.68% and 55.22%, respectively. We found that S1a/cagA+/iceA1/oipA−/babA2- (28.35%), m1a/cagA+/iceA1/oipA−/babA2- (28.35%) and s2/cagA+/iceA1/oipA−/babA2- (26.86%) were the most commonly detected combined genotyping pattern.

Conclusions

Simultaneous presence of vacA, cagA, iceA, oipA and babA2 genotypes in antibiotic resistant H. pylori strains indicates important public health issue regarding the consumption of raw milk. However, additional researches are required to find molecular genetic homology and other epidemiological aspects of H. pylori in milk.

Keywords: Helicobacter pylori, Raw milk, Antibiotic resistance, Genotyping

Background

Milk of animals provide a package of key nutrients that are difficult to obtain in diets with limited or no dairy products [1]. Dissimilarly, raw milk is not necessarily safe, as evidenced by higher rates of foodborne illnesses associated with its consumption [26]. Likewise, there were so many investigations about the considerable prevalence of some specific foodborne pathogens in raw milk [26].

Helicobacter pylori (H. pylori) is a microaerophilic and Gram-negative spiral coccoid flagellated bacterium with 2 to 4 μm in length and 0.5 to 1 μm in width. It is known as one of the main causative agents of duodenal ulcer, peptic ulcer disease, gastric adenocarcinoma, type B gastritis and gastric B-cell lymphoma [79]. Human stomach is considered as a main reservoir of H. pylori strains [79]. In keeping with this, foods with animal origins may play an imperative role in transmission of H. pylori infections to human [79]. Suitable conditions including pH, activated water (AW), moisture and temperature cause H. pylori to easily survive in milk [10]. Raw milk [10], pasteurized milk [79] and even sterilized food samples [10] have been introduced as possible emerging sources of H. pylori infections. Vacuolating Cytotoxin A (vacA) and Cytotoxin Associated Gene A (cagA) are two important virulence genes with high importance in the pathogenicity of H. pylori infections [710]. The vacA gene is polymorphic, comprising variable signal regions (type s1 or s2) and mid-regions (type m1 or m2). The s1 type is additionally divided into s1a, s1b and s1c and the m1 into m1a and m1b subtypes. The cagA gene has been detected in the severe cases of gastrointestinal disorders and peptic ulcers [710]. Induced by contact with the epithelium antigen (iceA), outer inflammatory protein (oip) and blood group antigen-binding adhesin gene (babA) are other important pathogenic genotypes of the H. pylori strains [711]. Genotyping using these virulence markers is considered as one of the best approaches to study the correlations between H. pylori isolates from different samples [11].

Antibiotic therapy is one of the best aspects of treatments for H. pylori infections. However, therapeutic options have become somewhat restricted because of the presence of severe resistance in some strains of this bacterium [12]. Documented data disclosed that H. pylori strains harbored the high prevalence of resistance against different types of antibiotics [12].

Data on the epidemiology and transmission of H. pylori is extremely significant in order to prevent its distribution and to identify high-risk populations, especially in areas that have high rates of infections such as Iran [710, 13, 14]. Considering the indistinct epidemiological aspects of H. pylori in milk and due to the high prevalence of H. pylori all-around the world [714], the present investigation was performed in order to study the prevalence rate, genotyping patterns and phenotypic evaluation of antibiotic resistance of the H. pylori strains isolated from raw milk samples of bovine, ovine, caprine, buffalo and camel.

Methods

Samples

From January to March 2018, total 630 raw milk samples of bovine (n = 120), ovine (n = 110), caprine (n = 130), buffalo (n = 130) and camel (n = 140) were arbitrarily collected from the supermarkets of diverse areas of Isfahan province, Iran. All milk samples were collected from traditional dairy farms. Milk samples were kept at refrigerator. Throughout milk collection, the first few squirts were overlooked. The animals which their milk samples collected for this research were clinically healthy, and the milk samples displayed natural physical (color, odor, pH, and density) constancy. Samples (50 ml, in sterile glass bottles) were transported in ice-cooled flasks (at 4 °C) to the laboratory within two hours after collection.

Isolation of helicobacter pylori

Isolation of H. pylori bacteria was performed using the culture technique [710, 13, 14]. Twenty-five milliliters of milk sample were used for this purpose. Wilkins Chalgren anaerobe broth (Oxoid Ltd., Basingstoke, UK) was used for this purpose. Microaerophilic conditions (5% oxygen, 85% nitrogen and 10% CO2) was prepared using the MART system (MART system, Lichtenvoorde, The Netherland).

DNA extraction and 16S rRNA-based PCR confirmation

Distinctive colonies of H. pylori were additionally approved using the 16S rRNA-based PCR method. Typical colonies were sub-cultured on Wilkins Chalgren anaerobe broth supplemented with same materials mentioned above [15]. Genomic DNA was then extracted from colonies using a DNA extraction kit (Thermo Fisher Scientific, St. Leon-Rot, Germany). Procedure was performed rendering to the manufacturer’s guidelines. Purity (A260/A280) and concentration of extracted DNA were then checked (NanoDrop, Thermo Scientific, Waltham, MA, USA). The truth of the DNA was assessed on a 2% agarose gel stained with ethidium bromide (0.5 μg/mL) (Thermo Fisher Scientific, St. Leon-Rot, Germany). Polymerase Chain Reaction (PCR) was performed using a PCR thermal cycler (Eppendorf Co., Hamburg, Germany) according to reported procedure [15].

Study the antibiotic resistance pattern

There are no accepted standardized methods for testing H. pylori antimicrobial susceptibilities and the protocols used in this study were based on recently published guidelines [16] and also those of Performance Standards for Antimicrobial Susceptibility Testing- Clinical and Laboratory Standards Institute - NCCLS, 2007 [17]. Briefly, bacterial suspensions were adjusted to the 0.5 McFarland standard (equivalent to 1–2 × 108 cfu/ml) and were used to inoculate Muller Hinton agar plates (Merck, Germany). Antimicrobial disks (ampicillin (10 μg), levofloxacin (5 μg), metronidazole (5 μg), clarithromycin (2 μg), amoxicillin (10 μg), streptomycin (10 μg), cefsulodin (30 μg), erythromycin (5 μg), tetracycline (30 μg), trimethoprim (25 μg), furazolidone (1 μg), rifampin (30 μg), and spiramycin (100 μg) (Oxoid, UK)) were applied and the plates were incubated under microaerophilic conditions at 35 °C for 16–18 h. The zones of growth inhibition produced by each antibiotic were measured and interpreted by standard procedure. Reference strains NCTC 13206 (CCUG 38770) and NCTC 13207 (CCUG 38772) were included as quality controls [18].

Genotyping analysis

Frequency of vacA, cagA, iceA, oipA and babA alleles were assessed using PCR [1922]. Table 1 characterizes the set of primers and PCR circumstances applied for genotyping of vacA, cagA, iceA, oipA and babA alleles. Initially, all samples were subjected to pre-tests to found suitable time, temperature and volume of reaction. A programmable DNA thermo-cycler (Eppendorf Mastercycler 5330, Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany) was used in all PCR reactions. PCR grade water and H. pylori standard strains (SS1, 26,695, Tx30, J99, 88–23 and 84–183) were used as negative and positive controls, respectively. Ten microliters of PCR product were exposed to electrophoresis in a 2% agarose gel in 1X TBE buffer at 80 V for 30 min, stained with SYBR Green. The UVI doc gel documentation systems (Grade GB004, Jencons PLC, London, UK) was applied for analysis of images.

Table 1.

Set of primers and PCR circumstances applied for genotyping of vacA, cagA, iceA, oipA and babA alleles

Genes Primer Sequence (5′-3′) Size of product (bp) Volume of PCR reaction (50 μl) PCR programs
VacA s 1 a F: CTCTCGCTTTAGTAGGAGC
R: CTGCTTGAATGCGCCAAAC
213 5 μL PCR buffer 10 x 1.5 mM Mgcl2
200 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.5 μM of each primers F & R
1.25 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
2.5 μL DNA template
1 cycle:
95 °C ------------ 1 min.
32 cycle:
95 °C ------------ 45 s
64 °C ------------ 50 s
72 °C ------------ 70 s
1 cycle:
72 °C ------------ 5 min
VacA s 1 b F: AGCGCCATACCGCAAGAG
CTGCTTGAATGCGCCAAAC
187
VacA s 1 c F: CTCTCGCTTTAGTGGGGYT
R: CTGCTTGAATGCGCCAAAC
213
VacA s 2 F: GCTAACACGCCAAATGATCC
R: CTGCTTGAATGCGCCAAAC
199
VacA m 1 a F: GGTCAAAATGCGGTCATGG
R: CCATTGGTACCTGTAGAAAC
290
VacA m 1 b F: GGCCCCAATGCAGTCATGGA
R: GCTGTTAGTGCCTAAAGAAGCAT
291
VacA m 2 F: GGAGCCCCAGGAAACATTG
R: CATAACTAGCGCCTTGCA
352
Cag A F: GATAACAGCCAAGCTTTTGAGG
R: CTGCAAAAGATTGTTTGGCAGA
300 5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
32 cycle:
95 °C ------------ 60 s
56 °C ------------ 60 s
72 °C ------------ 60 s
1 cycle:
72 °C ------------ 10 min
IceA IceA1 F: GTGTTTTTAACCAAAGTATC
R: CTATAGCCASTYTCTTTGCA
247 5 μL PCR buffer 10 x 2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
32 cycle:
94 °C ------------ 60 s
56 °C ------------ 60 s
72 °C ------------ 60 s
1 cycle:
72 °C ------------ 10 min
IceA2 F: GTTGGGTATATCACAATTTAT
R: TTRCCCTATTTTCTAGTAGGT
229/334
OipA F: GTTTTTGATGCATGGGATTT
R: GTGCATCTCTTATGGCTTT
401 5 μL PCR buffer 10 x 2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
32 cycle:
94 °C ------------ 60 s
56 °C ------------ 60 s
72 °C ------------ 60 s
1 cycle:
72 °C ------------ 10 min
BabA F: CCAAACGAAACAAAAAGCGT
R: GCTTGTGTAAAAGCCGTCGT
105–124 5 μL PCR buffer 10 x 2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
35 cycle:
94 °C ------------ 60 s
57 °C ------------ 45 s
72 °C ------------ 30 s
1 cycle:
72 °C ------------ 10 min

Statistical analysis

Data were subjected to Microsoft office Excel (version 15; Microsoft Corp., Redmond, WA, USA). Statistical analysis was performed by means of the SPSS 21.0 statistical software (SPSS Inc., Chicago, IL, USA). Chi-square test and Fisher’s exact two-tailed test were applied to measure any significant relationship. P value < 0.05 was considered as statistical significant level.

Results

Table 2 represents the prevalence of H. pylori in different types of raw milk samples. Sixty-seven out of 630 (10.63%) raw milk samples were positive for H. pylori strains. All isolates were also approved by the 16SrRNA gene PCR amplification. Ovine (17.27%) and caprine (13.84%) raw milk samples had the highest prevalence of H. pylori strains, while camel (5.00%) had the lowest. Statistically significant difference was seen between type of samples and prevalence of H. pylori strains (P < 0.05).

Table 2.

Prevalence of H. pylori in different types of raw milk samples

Raw milk samples No samples collected N (%) of H. pylori positive samples H. pylori 16SrRNA PCR confirmation (%)
Bovine 120 9 (7.50) 9 (7.50)
Ovine 110 19 (17.27) 19 (17.27)
Caprine 130 18 (13.84) 18 (13.84)
Buffalo 130 14 (10.76) 14 (10.76)
Camel 140 7 (5.00) 7 (5.00)
Total 630 67 (10.63) 67 (10.63)

Table 3 represents the antibiotic resistance pattern of H. pylori strains isolated from different types of raw milk samples. H. pylori strains harbored the highest prevalence of resistance against ampicillin (82.08%), tetracycline (76.11%), amoxicillin (74.62%), metronidazole (65.67%) and erythromycin (53.73%) antibiotic agents. Furthermore, H. pylori strains harbored the lowest prevalence of resistance against cefsulodin (13.43%), furazolidone (13.43%), spiramycin (16.41%) and streptomycin (23.88%). Moreover, prevalence of resistance against clarithromycin, levofloxacin, rifampin and trimethoprim antibiotic agents were 47.76%, 38.80%, 32.83% and 34.32%, respectively. Statistically significant difference was seen between type of samples and prevalence of antibiotic resistance (P < 0.05). Figure 1 represents the distribution of multi-drug resistant H. pylori strains isolated from different types of raw milk samples. We found that all of the H. pylori strains isolated from raw milk samples at least had resistance against 3 different types of antibiotics, while prevalence of resistance against more than 3 types of antibiotics (etc) was 94.02%.

Table 3.

Antibiotic resistance pattern of H. pylori strains isolated from different types of raw milk samples

Type of raw milk samples (N of H. pylori strains) N (%) isolates resistant to each antibiotic
AM10a Met5 ER5 CLR2 AMX 10 Tet30 Lev5 S10 RIF30 Cef30 TRP25 FZL1 Spi100
Bovine (9) 8 (88.88) 6 (66.66) 4 (44.44) 4 (44.44) 7 (77.77) 7 (77.77) 3 (33.33) 2 (22.22) 3 (33.33) 2 (22.22) 3 (33.33) 2 (22.22) 3 (33.33)
Ovine (19) 18 (94.73) 16 (84.21) 14 (73.68) 13 (68.42) 17 (89.47) 18 (94.73) 12 (63.15) 7 (36.84) 10 (52.63) 4 (21.05) 10 (52.63) 3 (15.78) 3 (15.78)
Caprine (18) 14 (77.77) 12 (66.66) 9 (50) 8 (44.44) 13 (72.22) 13 (72.22) 6 (33.33) 4 (22.22) 5 (27.77) 2 (11.11) 5 (27.77) 3 (16.66) 3 (16.66)
Buffalo (14) 11 (78.57) 8 (57.14) 8 (57.14) 6 (42.85) 10 (71.42) 10 (71.42) 4 (28.57) 2 (14.28) 3 (21.42) 1 (7.14) 4 (28.57) 1 (7.14) 2 (14.28)
Camel (7) 4 (57.14) 2 (28.57) 1 (7.14) 1 (7.14) 3 (42.85) 3 (42.85) 1 (7.14) 1 (7.14) 1 (7.14) 1 (7.14)
Total (67) 55 (82.08) 44 (65.67) 36 (53.73) 32 (47.76) 50 (74.62) 51 (76.11) 26 (38.80) 16 (23.88) 22 (32.83) 9 (13.43) 23 (34.32) 9 (13.43) 11 (16.41)

aAM10: ampicillin (10 μg), Met5: metronidazole (5 μg), ER5: erythromycin (5 μg), CLR2: clarithromycin (2 μg), AMX10: amoxicillin (10 μg), Tet30: tetracycline (30 μg), Lev5: levofloxacin (5 μg), S10: streptomycin (10 μg), RIF30: rifampin (30 μg), Cef30: cefsulodin (30 μg), TRP25: trimethoprim (25 μg), FZL1: furazolidone (1 μg) and Spi100: spiramycin (100 μg)

Fig. 1.

Fig. 1

Distribution of multidrug resistant H. pylori strains isolated from different types of raw milk. Multidrug resistant H. pylori strains were determined as those who had at least simultaneous resistance against 3 or more than 3 types of antibiotics

Table 4 represents the distribution of genotypes amongst the H. pylori strains isolated from different types of raw milk samples. VacA s1a (83.58%), m1a (80.59%), s2 (77.61%) and m2 (68.65%), cagA (73.13%) and babA2 (44.77%) were the most commonly detected genotypes amongst the H. pylori strains isolated from different types of raw milk samples. VacA s1c (10.44%), m1b (28.35%) and s1b (32.83%), iceA2 (19.40%) and oipA (37.31%) had the lowest prevalence amongst the H. pylori strains isolated from different types of raw milk samples. Statistically significant difference was seen between type of samples and prevalence of genotypes (P < 0.05). Additionally, statistically significant difference was seen between the prevalence of iceA1 and iceA2 genotypes (P < 0.05).

Table 4.

Distribution of genotypes amongst the H. pylori strains isolated from different types of raw milk samples

Type of raw milk samples (N of H. pylori strains) N (%) isolates harbor each genotype
VacA CagA IceA OipA BabA2
s1a s1b s1c s2 m1a m1b m2 IceA1 IceA2
Bovine (9) 7 (77.77) 3 (33.33) 1 (11.11) 6 (66.66) 7 (77.77) 3 (33.33) 6 (66.66) 6 (66.66) 4 (44.44) 2 (22.22) 3 (33.33) 4 (44.44)
Ovine (19) 17 (89.47) 8 (42.10) 2 (10.52) 17 (89.47) 17 (89.47) 7 (36.84) 15 (78.94) 16 (84.21) 10 (52.63) 5 (26.31) 9 (50) 10 (52.63)
Caprine (18) 15 (83.33) 6 (33.33) 2 (11.11) 13 (72.22) 14 (77.77) 5 (27.77) 12 (66.66) 13 (72.22) 8 (44.44) 3 (16.66) 7 (38.88) 8 (44.44)
Buffalo (14) 12 (85.71) 4 (28.57) 1 (7.14) 12 (85.71) 12 (85.71) 3 (21.42) 10 (71.42) 11 (78.57) 6 (42.85) 2 (14.28) 5 (35.71) 6 (42.85)
Camel (7) 5 (71.42) 1 (14.28) 1 (14.28) 4 (57.14) 4 (57.14) 1 (14.28) 3 (42.85) 3 (42.85) 3 (42.85) 1 (14.28) 1 (14.28) 2 (28.57)
Total (67) 56 (83.58) 22 (32.83) 7 (10.44) 52 (77.61) 54 (80.59) 19 (28.35) 46 (68.65) 49 (73.13) 31 (46.26) 13 (19.40) 25 (37.31) 30 (44.77)

Table 5 represents the genotyping pattern of H. pylori strains isolated from different types of raw milk samples. S1am1a (56.71%), s2m1a (56.71%), s1 am2 (43.28%) and s2 m2 (43.28%) were the most commonly detected genotyping pattern of the vacA alleles of H. pylori strains isolated from different types of raw milk samples. Distribution of cagA-, oipA- and babA2- genotypes were 26.86%, 62.68% and 55.22%, respectively. We found that 10.44% of H. pylori strains harbored iceA1/iceA2 genotyping pattern. S1cm1b (1.49%), s1 cm2 (4.47%), s1bm1b (7.46%), s1cm1a (7.46%), s1bm2 (11.94%), s2m1b (16.41%) and s1bm1a (16.41%) had the lowest prevalence amongst different genotyping patterns of H. pylori strains.

Table 5.

Genotyping pattern of H. pylori strains isolated from different types of raw milk samples

Type of raw milk samples (N of H. pylori strains) Genotyping pattern (%)
s1am1a s1am1b s1 am2 s1bm1a s1bm1b s1bm2 s1cm1a s1cm1b s1 cm2 s2m1a s2m1b s2 m2 CagA+ CagA- IceA1/IceA2 OipA+ OipA- BabA2+ BabA2-
Bovine (9) 5 (55.55) 2 (22.22) 4 (44.44) 2 (22.22) 1 (11.11) 2 (22.22) 1 (11.11) 1 (11.11) 4 (44.44) 2 (22.22) 3 (33.33) 6 (66.66) 3 (33.33) 1 (11.11) 3 (33.33) 6 (66.66) 4 (44.44) 5 (55.55)
Ovine (19) 13 (68.42) 4 (21.05) 11 (57.89) 4 (21.05) 2 (10.52) 3 (15.78) 1 (5.26) 1 (5.26) 1 (5.26) 15 (78.94) 5 (26.31) 12 (63.15) 16 (84.21) 3 (15.78) 3 (15.78) 9 (47.36) 10 (52.63) 10 (52.63) 9 (47.36)
Caprine (18) 11 (61.11) 3 (16.66) 10 (55.55) 2 (11.11) 1 (5.55) 2 (11.11) 1 (5.55) 1 (5.55) 10 (55.55) 3 (16.66) 8 (44.44) 13 (72.22) 5 (27.77) 2 (11.11) 7 (38.88) 11 (61.11) 8 (44.44) 10 (55.55)
Buffalo (14) 7 (50) 1 (7.14) 3 (21.42) 2 (14.28) 1 (7.14) 1 (7.14) 1 (7.14) 7 (50) 1 (7.14) 5 (35.71) 11 (78.57) 3 (21.42) 1 (7.14) 5 (35.71) 9 (64.28) 6 (42.85) 8 (57.14)
Camel (7) 2 (28.57) 1 (14.28) 1 (14.28) 1 (14.28) 2 (28.57) 1 (14.28) 3 (42.85) 4 (57.14) 1 (14.28) 6 (85.71) 2 (28.57) 5 (71.42)
Total (67) 38 (56.71) 10 (14.92) 29 (43.28) 11 (16.41) 5 (7.46) 8 (11.94) 5 (7.46) 1 (1.49) 3 (4.47) 38 (56.71) 11 (16.41) 29 (43.28) 49 (73.13) 18 (26.86) 7 (10.44) 25 (37.31) 42 (62.68) 30 (44.77) 37 (55.22)

Table 6 represents the combined genotyping pattern of H. pylori strains isolated from different types of raw milk samples. We found that s1a/cagA+/iceA1/oipA−/babA2- (28.35%), m1a/cagA+/iceA1/oipA−/babA2- (28.35%), s2/cagA+/iceA1/oipA−/babA2- (26.86%), s1a/cagA+/iceA1/oipA−/babA2+ (25.37%), m1a/cagA+/iceA1/oipA−/babA2+ (25.37%), s2/cagA+/iceA1/oipA−/babA2+ (23.88%), s1a/cagA+/iceA1/oipA+/babA2- (22.38%) and m2/cagA+/iceA1/oipA−/babA2+ (22.38%) were the most commonly detected combined genotyping pattern of H. pylori strains isolated from different types of raw milk samples. There were no detected H. pylori strains positive for s1b/cagA−/iceA2/oipA+/babA2+, s1c/cagA+/iceA1/oipA+/babA2+, s1c/cagA+/iceA1/oipA+/babA2-, s1c/cagA+/iceA2/oipA+/babA2+, s1c/cagA+/iceA2/oipA+/babA2-, s1c/cagA+/iceA2/oipA−/babA2+, s1c/cagA−/iceA1/oipA+/babA2+, s1c/cagA−/iceA1/oipA+/babA2-, s1c/cagA−/iceA1/oipA−/babA2+, s1c/cagA−/iceA2/oipA+/babA2+, s1c/cagA−/iceA2/oipA+/babA2-, s1c/cagA−/iceA2/oipA−/babA2+, s1c/cagA−/iceA2/oipA−/babA2-, m1b/cagA−/iceA1/oipA+/babA2+ and s1b/cagA−/iceA2/oipA+/babA2+ combined genotyping patterns. Prevalence of s1b/cagA−/iceA1/oipA+/babA2+, s1b/cagA−/iceA1/oipA+/babA2-, s1b/cagA−/iceA2/oipA+/babA2-, s1c/cagA+/iceA1/oipA−/babA2+, s1c/cagA+/iceA2/oipA−/babA2-, s1c/cagA−/iceA1/oipA−/babA2-, s2/cagA−/iceA2/oipA+/babA2+, m1b/cagA−/iceA1/oipA+/babA2-, m1b/cagA−/iceA1/oipA−/babA2+, m1b/cagA−/iceA2/oipA+/babA2- and m2/cagA−/iceA2/oipA+/babA2+ (1.49%) were lower than other detected combined genotyping patterns.

Table 6.

Combined genotyping pattern of H. pylori strains isolated from different types of raw milk samples

Combined genotyping patterns Distributiona (%)
s1a/cagA+/iceA1/oipA+/babA2+ 13 (19.40)
s1a/cagA+/iceA1/oipA+/babA2- 15 (22.38)
s1a/cagA+/iceA1/oipA−/babA2+ 17 (25.37)
s1a/cagA+/iceA1/oipA−/babA2- 19 (28.35)
s1a/cagA+/iceA2/oipA+/babA2+ 4 (5.97)
s1a/cagA+/iceA2/oipA+/babA2- 5 (7.46)
s1a/cagA+/iceA2/oipA−/babA2+ 6 (8.95)
s1a/cagA+/iceA2/oipA−/babA2- 7 (10.44)
s1a/cagA−/iceA1/oipA+/babA2+ 6 (8.95)
s1a/cagA−/iceA1/oipA+/babA2- 8 (11.94)
s1a/cagA−/iceA1/oipA−/babA2+ 8 (11.94)
s1a/cagA−/iceA1/oipA−/babA2- 10 (14.92)
s1a/cagA−/iceA2/oipA+/babA2+ 2 (2.98)
s1a/cagA−/iceA2/oipA+/babA2- 4 (5.97)
s1a/cagA−/iceA2/oipA−/babA2+ 5 (7.46)
s1a/cagA−/iceA2/oipA−/babA2- 5 (7.46)
s1b/cagA+/iceA1/oipA+/babA2+ 9 (13.43)
s1b/cagA+/iceA1/oipA+/babA2- 11 (16.41)
s1b/cagA+/iceA1/oipA−/babA2+ 12 (17.91)
s1b/cagA+/iceA1/oipA−/babA2- 14 (20.89)
s1b/cagA+/iceA2/oipA+/babA2+ 2 (2.98)
s1b/cagA+/iceA2/oipA+/babA2- 3 (4.47)
s1b/cagA+/iceA2/oipA−/babA2+ 4 (5.97)
s1b/cagA+/iceA2/oipA−/babA2- 5 (7.46)
s1b/cagA−/iceA1/oipA+/babA2+ 1 (1.49)
s1b/cagA−/iceA1/oipA+/babA2- 1 (1.49)
s1b/cagA−/iceA1/oipA−/babA2+ 2 (2.98)
s1b/cagA−/iceA1/oipA−/babA2- 2 (2.98)
s1b/cagA−/iceA2/oipA+/babA2+
s1b/cagA−/iceA2/oipA+/babA2- 1 (1.49)
s1b/cagA−/iceA2/oipA−/babA2+ 2 (2.98)
s1b/cagA−/iceA2/oipA−/babA2- 2 (2.98)
s1c/cagA+/iceA1/oipA+/babA2+
s1c/cagA+/iceA1/oipA+/babA2-
s1c/cagA+/iceA1/oipA−/babA2+ 1 (1.49)
s1c/cagA+/iceA1/oipA−/babA2- 2 (2.98)
s1c/cagA+/iceA2/oipA+/babA2+
s1c/cagA+/iceA2/oipA+/babA2-
s1c/cagA+/iceA2/oipA−/babA2+
s1c/cagA+/iceA2/oipA−/babA2- 1 (1.49)
s1c/cagA−/iceA1/oipA+/babA2+
s1c/cagA−/iceA1/oipA+/babA2-
s1c/cagA−/iceA1/oipA−/babA2+
s1c/cagA−/iceA1/oipA−/babA2- 1 (1.49)
s1c/cagA−/iceA2/oipA+/babA2+
s1c/cagA−/iceA2/oipA+/babA2-
s1c/cagA−/iceA2/oipA−/babA2+
s1c/cagA−/iceA2/oipA−/babA2-
s2/cagA+/iceA1/oipA+/babA2+ 12 (17.91)
s2/cagA+/iceA1/oipA+/babA2- 13 (19.40)
s2/cagA+/iceA1/oipA−/babA2+ 16 (23.88)
s2/cagA+/iceA1/oipA−/babA2- 18 (26.86)
s2/cagA+/iceA2/oipA+/babA2+ 3 (4.47)
s2/cagA+/iceA2/oipA+/babA2- 4 (5.97)
s2/cagA+/iceA2/oipA−/babA2+ 6 (8.95)
s2/cagA+/iceA2/oipA−/babA2- 6 (8.95)
s2/cagA−/iceA1/oipA+/babA2+ 5 (7.46)
s2/cagA−/iceA1/oipA+/babA2- 7 (10.44)
s2/cagA−/iceA1/oipA−/babA2+ 9 (13.43)
s2/cagA−/iceA1/oipA−/babA2- 10 (14.92)
s2/cagA−/iceA2/oipA+/babA2+ 1 (1.49)
s2/cagA−/iceA2/oipA+/babA2- 3 (4.47)
s2/cagA−/iceA2/oipA−/babA2+ 4 (5.97)
s2/cagA−/iceA2/oipA−/babA2- 5 (7.46)
m1a/cagA+/iceA1/oipA+/babA2+ 12 (17.91)
m1a/cagA+/iceA1/oipA+/babA2- 14 (20.89)
m1a/cagA+/iceA1/oipA−/babA2+ 17 (25.37)
m1a/cagA+/iceA1/oipA−/babA2- 19 (28.35)
m1a/cagA+/iceA2/oipA+/babA2+ 4 (5.97)
m1a/cagA+/iceA2/oipA+/babA2- 5 (7.46)
m1a/cagA+/iceA2/oipA−/babA2+ 6 (8.95)
m1a/cagA+/iceA2/oipA−/babA2- 6 (8.95)
m1a/cagA−/iceA1/oipA+/babA2+ 6 (8.95)
m1a/cagA−/iceA1/oipA+/babA2- 7 (10.44)
m1a/cagA−/iceA1/oipA−/babA2+ 8 (11.94)
m1a/cagA−/iceA1/oipA−/babA2- 10 (14.92)
m1a/cagA−/iceA2/oipA+/babA2+ 2 (2.98)
m1a/cagA−/iceA2/oipA+/babA2- 3 (4.47)
m1a/cagA−/iceA2/oipA−/babA2+ 5 (7.46)
m1a/cagA−/iceA2/oipA−/babA2- 5 (7.46)
m1b/cagA+/iceA1/oipA+/babA2+ 8 (11.94)
m1b/cagA+/iceA1/oipA+/babA2- 10 (14.92)
m1b/cagA+/iceA1/oipA−/babA2+ 10 (14.92)
m1b/cagA+/iceA1/oipA−/babA2- 13 (19.40)
m1b/cagA+/iceA2/oipA+/babA2+ 2 (2.98)
m1b/cagA+/iceA2/oipA+/babA2- 3 (4.47)
m1b/cagA+/iceA2/oipA−/babA2+ 4 (5.97)
m1b/cagA+/iceA2/oipA−/babA2- 4 (5.97)
m1b/cagA−/iceA1/oipA+/babA2+
m1b/cagA−/iceA1/oipA+/babA2- 1 (1.49)
m1b/cagA−/iceA1/oipA−/babA2+ 1 (1.49)
m1b/cagA−/iceA1/oipA−/babA2- 2 (2.98)
s1b/cagA−/iceA2/oipA+/babA2+
m1b/cagA−/iceA2/oipA+/babA2- 1 (1.49)
m1b/cagA−/iceA2/oipA−/babA2+ 2 (2.98)
m1b/cagA−/iceA2/oipA−/babA2- 2 (2.98)
m2/cagA+/iceA1/oipA+/babA2+ 11 (16.41)
m2/cagA+/iceA1/oipA+/babA2- 13 (19.40)
m2/cagA+/iceA1/oipA−/babA2+ 15 (22.38)
m2/cagA+/iceA1/oipA−/babA2- 18 (26.86)
m2/cagA+/iceA2/oipA+/babA2+ 2 (2.98)
m2/cagA+/iceA2/oipA+/babA2- 4 (5.97)
m2/cagA+/iceA2/oipA−/babA2+ 5 (7.46)
m2/cagA+/iceA2/oipA−/babA2- 6 (8.95)
m2/cagA−/iceA1/oipA+/babA2+ 3 (4.47)
m2/cagA−/iceA1/oipA+/babA2- 6 (8.95)
m2/cagA−/iceA1/oipA−/babA2+ 8 (11.94)
m2/cagA−/iceA1/oipA−/babA2- 10 (14.92)
m2/cagA−/iceA2/oipA+/babA2+ 1 (1.49)
m2/cagA−/iceA2/oipA+/babA2- 3 (4.47)
m2/cagA−/iceA2/oipA−/babA2+ 3 (4.47)
m2/cagA−/iceA2/oipA−/babA2- 5 (7.46)

aDistribution was achieved based on the total numbers of 67 H. pylori isolates

Discussion

H. pylori is a common bacterium with high microbiological and clinical importance and about 50% of the world’s population, depending to the geographic location considered, has been estimated to have been infected with this organism. Despite the high incidence of the infection, the reservoir for H. pylori and the routes of infection are still indeterminate and various routes of transmission have been recommended [23]. Moreover, epidemiological investigations suggest that transmission of H. pylori between individuals happens both via the oral–oral and fecal–oral routes [23]. In keeping with this, fecal–oral transmission has more significant implications than since H. pylori may occur in food and water supplies subsequent to fecal contamination [24]. Besides, the isolation of H. pylori in drinking water [13, 14], raw vegetables [7, 9], salads [7, 9], meat [25, 26], ready to eat foods [27, 28], sterilized foods [29, 30] and foods with animal origin such as milk [3135], suggests that these foods may act as vehicles for transmission of H. pylori to human population.

The present study was performed to assess the prevalence rate, genotyping patterns and antibiotic resistance properties of H. pylori strains isolated from different types of raw milk samples. Totally, 10.63% of raw milk samples were positive for H. pylori strains. Prevalence of H. pylori strains in raw milk samples of bovine, ovine, caprine, buffalo and camel were 7.50, 17.27, 13.84, 10.76 and 5.00%, respectively. Several studies have been conducted in this field. Talaei et al. (2015) [36] reported that the total prevalence of H. pylori strains amongst the cow, sheep, goat and buffalo milk samples were 16.00, 13.79, 4.76, 13.33 and 20.00%, respectively. Quaglia et al. (2008) [35] determined that the prevalence of H. pylori strains in sheep, cow and goat milk samples were 33.00%, 50.00% and 25.60%, respectively. Mousavi et al. (2014) [10] described that the prevalence of H. pylori strains in bovine, ovine, caprine, buffalo and camel milk samples were 16.66, 35.00, 28.00, 15.00 and 13.30%, respectively. Rahimi and Kheirabadi (2012) [37] noted that the prevalence of H. pylori strains in raw bovine, ovine, caprine, buffalo and camel milk samples were 1.41, 12.20, 8.70, 23.40 and 3.60%, respectively. Osman et al. (2015) [38] revealed that the prevalence of H. pylori in raw milk samples of different parts of Sudan had a range of 7 to 38%. Similar results have been reported for the high prevalence of H. pylori in milk samples from Japan (72.20%) [32], Greece (20.00%) [34], Italy 1.80%) [39] and Iran (16.00%) [40].

Foods presenting intrinsic factors, including water activity higher than 0.97 and pH ranging from 4.9 to 6.0 such as raw milk, theoretically could provide conditions for survival of H. pylori [79]. Therefore, it is not surprising that the H. pylori strains has the high prevalence in raw milk samples of our investigation. High prevalence rate of H. pylori in milk samples of our research is may be due to the low levels of hygienic conditions of milking procedure. Furthermore, considering the boost prevalence of H. pylori in healthy human carrier, contamination due to poor hygiene management of open package of milk, has more important implications for the transmission of the infection through foods. Milk, that could become contaminated during production or because of low hygiene after the open of package, is considered to be one of the most likely vehicles for infection [31, 32]. Insufficient post-processing hygienic management of the milk, can carry the contamination of the matrix by humans. Despite of the low prevalence of H. pylori strains in some kinds of studied milk samples, the infectious dose of H. pylori is presumably low [31, 32]. Therefore, it is an important public health threat regarding the consumption of raw milk. The urea-dependent acid resistance of H. pylori may account for the long-term survival of H. pylori in an acidic environment including raw milk [29]. Higher prevalence of H. pylori in raw ovine milk samples is may be due to the more suitable conditions present in ovine milk such as higher fat, protein and water activity and also optimum pH. Furthermore, ovine milk may have a higher qualification for growth and survival of H. pylori strains. Moreover, differences in the feed of ovine with bovine, buffalo, camel and even caprine species may affect the prevalence rate of bacteria presented in their milk. Higher prevalence of H. pylori in raw ovine milk was also reported by previous investigations [10, 31, 32, 3443]. Using thorns and thistles in deserts and living away from humans and the polluted environment of cities are the most important probable reasons for the lower prevalence of H. pylori in camel milk. Lower prevalence of H. pylori in raw camel milk was also reported by previous investigations [10, 37, 44, 45].

We described that H. pylori bacteria exhibited the maximum prevalence of resistance against ampicillin, tetracycline, amoxicillin, metronidazole and erythromycin antibiotics. Boost prevalence of resistance against human-based antibiotics such as metronidazole, erythromycin, clarithromycin, levofloxacin, amoxicillin, streptomycin, rifampin, cefsulodin, trimethoprim, furazolidone and spiramycin in H. pylori bacteria isolated from raw milk samples characterized their anthropogenic origin. Reversely, boost prevalence of resistance against animal-based antibiotics such as ampicillin and tetracycline in H. pylori bacteria isolated from raw milk samples characterized their animal origin. As it displayed, majority of H. pylori bacteria exhibited resistance against human-based antibiotics. Extreme, illegal and prohibited prescription of antibiotics in medicine and also veterinary caused momentous surge in antibiotic resistance. Frequent researches have been accomplished, globally. Among plentiful examines performed on the antibiotic resistance of H. pylori bacteria, discoveries of Hemmatinezhad et al. (2016) [46] (amoxicillin (94.59%), ampicillin (93.24%), metronidazole (89.18%), tetracycline (72.97%) and erythromycin (58.10%)), Yahaghi et al. (2014) [9] (metronidazole (77.96%), amoxicillin (67.79%), ampicillin (61.01%), and erythromycin (23.72%)) and Mousavi et al. (2014) [10] (ampicillin (84.4%), tetracycline (76.6%), erythromycin (70.5%), metronidazole (70%), and clarithromycin (17.70%)) were similar to our findings. Clinical investigations conducted in Iran, China, India, Nigeria, Taiwan, Senegal, Thailand, Saudi Arabia, Brazil, Egypt, Argentina and Colombia disclosed that H. pylori bacteria of human clinical specimens displayed boost prevalence of resistance against aminoglycosides, tetracyclines, penicillins, macrolides and metronidazole [47] which was parallel to our results.

We also found that vacA s1a, s2, m1a and m2, cagA, iceA1, oipA and babA2 genotypes, s1am1a, s2m1a, s1 am2, s2 m2, cagA-, oipA- and babA2- patterns and s1a/cagA+/iceA1/oipA−/babA2-, m1a/cagA+/iceA1/oipA−/babA2-, s2/cagA+/iceA1/oipA−/babA2-, s1a/cagA+/iceA1/oipA−/babA2+, m1a/cagA+/iceA1/oipA−/babA2+, s2/cagA+/iceA1/oipA−/babA2+, s1a/cagA+/iceA1/oipA+/babA2- and m2/cagA+/iceA1/oipA−/babA2+ combined genotyping patterns were the most commonly detected virulence characters of H. pylori strains isolated from raw milk samples. High prevalence of vacA, cagA, iceA1, oipA and babA2 genotypes was also reported in the H. pylori strains isolated from clinical samples of human and animal species [4851]. Furthermore, high prevalence of these genotypes has been reported in the H. pylori strains isolated from different types of food samples [810, 14, 36, 4245, 52]. Adjacent association of vacA, cagA, iceA, oipA and babA2 genotypes of H. pylori bacteria with secretion of interleukin-8 and cytotoxin, adhesion to gastric epithelial cells, occurrence of inflammatory effect, vacuolization, apoptosis procedure in gastric epithelial cells, peptic ulceration, increase acute neutrophilic infiltration, interleukin-10 secretion and inflammation, has been presented previously [4850]. Since H. pylori isolates in our investigation harbored vacA, cagA, iceA, oipA and babA2 genotypes, therefore consumption of raw milk contaminated with virulent strains of H. pylori may aggravate duodenal ulceration, gastric mucosal atrophy and gastric cancer. Additionally, some of H. pylori isolates were simultaneously positive for more than one detected genotypes which poses their higher pathogenicity. Similar genotyping patterns of H. pylori strains recovered from human clinical samples were also reported previously [5356].

A possible relationship between virulence factors and antimicrobial resistance has been suggested. A study conducted in 2009 in Ireland reported that the absence of cagA may be a risk factor for developing metronidazole resistance [57]. Other studies have found an association between clarithromycin resistance mutations and the less virulent vacA genotypes [58]. Another report revealed that cagE and vacA S1 correlated with clarithromycin and metronidazole resistance [59], while others found that neither cagA nor vacA was associated with resistance [60, 61]. Therefore, it is important to found any significant relationship between the presence of virulence markers and antibiotic resistance amongst the H. pylori strains.

Triple therapy, including two antibiotics, amoxicillin and clarithromycin, and a proton pump inhibitor given for a week has been recommended as the treatment of choice at several consensus conferences [62]. However, this treatment may fail for several reasons, as reported elsewhere [63]. In fact, the main reason for failure was found to be H pylori resistance to one of the antibiotics used (that is, clarithromycin). Other treatments have also been proposed, including metronidazole, a drug for which resistance is also a problem although to a lesser extent, as well as tetracycline, fluoroquinolones, and rifamycins for which resistance has become an emerging issue [64]. Results of the present investigation showed that application of furazolidone, streptomycin and cefsulodin may be effective for treatment of the cases of H. pylori infections. Reduction in the antibiotic prescription and also prescription of antibiotics according to the results of the disk diffusion can reduce the risk of antibiotic resistance. Using medicinal plants and especially those with high antimicrobial effects is a practical alternative way for treatment of H. pylori infection.

Conclusions

To put it in a nutshell, we recognized a great numbers of virulent and resistant H. pylori bacteria in raw milk samples of bovine, ovine, caprine, buffalo and camel species. Boost incidence of H. pylori bacteria in raw milk characterizes that these samples may be the natural reservoirs of the bacteria and can spread H. pylori to human. Moreover, some of the H. pylori bacteria of our research harbored vacA, cagA, iceA, oipA and babA2 genotypes together which represents the high pathogenicity. Furthermore, higher prevalence of iceA1+ strains than iceA2+, oipA- than oipA+ and finally babA2- than babA2+ is another important finding of our study. Additionally, presence of 97 diverse combined genotyping patterns with high distribution of s1a/cagA+/iceA1/oipA−/babA2-, m1a/cagA+/iceA1/oipA−/babA2-, s2/cagA+/iceA1/oipA−/babA2-, s1a/cagA+/iceA1/oipA−/babA2+, m1a/cagA+/iceA1/oipA−/babA2+, s2/cagA+/iceA1/oipA−/babA2+, s1a/cagA+/iceA1/oipA+/babA2- and m2/cagA+/iceA1/oipA−/babA2+ is another interesting finding of our research. Similarities in the genotyping pattern of H. pylori strains between various milk sources represent their same route of infection. High prevalence of multi-drug resistant H. pylori strains shows that raw milk of bovine, ovine, caprine, buffalo and camel species may be reservoir of antibiotic resistant H. pylori. Prescription of cefsulodin, furazolidone, spiramycin and streptomycin may be effectual for treatment of cases of H. pylori infections due to the consumption of raw milk. Additional researches are essential to recognize the rates of the molecular genetic homology of H. pylori bacteria isolated from milk and dairy samples and those of human clinical specimens to confirm the zoonotic aspects of H. pylori.

Acknowledgements

The authors would like to thank Prof. Ebrahim Rahimi and Dr. Manouchehr Momeni Shahraki for their assistance in laboratory-based examinations. Authors would also thank from Dr. Mojtaba Masoudimanesh, Dr. Amirthossein Sheikhshahrokh and Dr. Mohammad Hossein Sakhaei Shahreza for their important assistance in the samples collection and statistical analysis. We would also like to thank from the “Clinical Research Development Center of Baqiyatallah hospital” for their kindly cooperation. This study was supported in part by a grant from “Clinical Research Development Center of Baqiyatallah hospital”.

Funding

This work was supported by a grant provided from "Clinical Research Development Center of Baqiyatallah hospital" and the Molecular Biology Research Center, Systems Biology and Poisonings Institute, Baqiyatallah University of Medical Sciences, Tehran, Iran (grant no. 97/23).

Availability of data and materials

All data generated or analyzed throughout this research are included in this published article.

Abbreviations

BabA

Blood group Antigen-Binding Adhesin gene

CagA

Cytotoxin Associated Gene A

IceA

Induced by Contact with the Epithelium Antigen

H. pylori

Helicobacter pylori

Oip

Outer Inflammatory Protein

PCR

Polymerase Chain Reaction

SPSS

Statistical Package for the Social Sciences

VacA

Vacuolating Cytotoxin A

Authors’ contributions

FSD designed the study and carried out the PCR genetic alignment. RR supported the study and carried out the culture-based identification, disk diffusion and statistical analysis. FYF carried out the sample collection and preparation and writing of the manuscript. RR carried out the drafting of the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethical Council of Research of the Molecular Biology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran (Consent Ref Number 97–23). Verification of this research project and the licenses related to sampling process were approved by the Prof. Reza Ranjbar (Approval Ref Number FHQC 2017/23).

Consent for publication

There was no consent for publication.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Reza Ranjbar, Phone: +98-21-88039883, Email: ranjbar@bmsu.ac.ir.

Farid Yadollahi Farsani, Email: Gereghe@yahoo.com.

Farhad Safarpoor Dehkordi, Email: F.safarpoor@ut.ac.ir.

References

  • 1.Thorning TK, Raben A, Tholstrup T, Soedamah-Muthu SS, Givens I, Astrup A. Milk and dairy products: good or bad for human health? An assessment of the totality of scientific evidence. Food Nutr Res. 2016;60:32527. doi: 10.3402/fnr.v60.32527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Safarpoor Dehkordi F, Valizadeh Y, Birgani T, Dehkordi K. Prevalence study of Brucella melitensis and Brucella abortus in cow's milk using dot enzyme linked immuno sorbent assay and duplex polymerase chain reaction. J Pure Appl Microbiol. 2014;8:1065–1069. [Google Scholar]
  • 3.Momtaz Hassan, Safarpoor Dehkordi Farhad, Taktaz Taghi, Rezvani Amir, Yarali Sajad. Shiga Toxin-ProducingEscherichia coliIsolated from Bovine Mastitic Milk: Serogroups, Virulence Factors, and Antibiotic Resistance Properties. The Scientific World Journal. 2012;2012:1–9. doi: 10.1100/2012/618709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Rahimi E, Sepehri S, Dehkordi FS, Shaygan S, Momtaz H. Prevalence of Yersinia species in traditional and commercial dairy products in Isfahan Province, Iran. Jundishapur J Microbiol. 2014;7. [DOI] [PMC free article] [PubMed]
  • 5.Ranjbar R, Dehkordi FS, Shahreza MHS, Rahimi E. Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products. Antimicrob Resist Infect Control. 2018;7:53. doi: 10.1186/s13756-018-0345-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Safarpoor Dehkordi F, Barati S, Momtaz H, Hosseini Ahari SN, Nejat Dehkordi S. Comparison of shedding, and antibiotic resistance properties of listeria monocytogenes isolated from milk, feces, urine, and vaginal secretion of bovine, ovine, caprine, buffalo, and camel species in Iran. Jundishapur J Microbiol. 2013;6:284–294. [Google Scholar]
  • 7.Atapoor S, Dehkordi FS, Rahimi E. Detection of helicobacter pylori in various types of vegetables and salads. Jundishapur J Microbiol. 2014;7:e10013. doi: 10.5812/jjm.10013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ghorbani F, Gheisari E, Dehkordi FS. Genotyping of vacA alleles of helicobacter pylori strains recovered from some Iranian food items. Trop J Pharm Res. 2016;15:1631–1636. doi: 10.4314/tjpr.v15i8.5. [DOI] [Google Scholar]
  • 9.Yahaghi E, Khamesipour F, Mashayekhi F, Safarpoor Dehkordi F, Sakhaei MH, Masoudimanesh M, et al. Helicobacter pylori in vegetables and salads: genotyping and antimicrobial resistance properties. Biomed Res Int. 2014;2014:1–11. doi: 10.1155/2014/757941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mousavi S, Dehkordi FS, Rahimi E. Virulence factors and antibiotic resistance of helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran. J Venom Anim Toxins Incl Trop Dis. 2014;20:51. doi: 10.1186/1678-9199-20-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Biernat MM, Gościniak G, Iwańczak B. Prevalence of helicobacter pylori cagA, vacA, iceA, babA2 genotypes in polish children and adolescents with gastroduodenal disease. Adv Hyg Experiment Med. 2014;68:1015–1021. doi: 10.5604/17322693.1118211. [DOI] [PubMed] [Google Scholar]
  • 12.Alba C, Blanco A, Alarcón T. Antibiotic resistance in helicobacter pylori. Curr Opin Infect Dis. 2017;30:489–497. doi: 10.1097/QCO.0000000000000396. [DOI] [PubMed] [Google Scholar]
  • 13.Ranjbar R, Khamesipour F, Jonaidi-Jafari N, Rahimi E. Helicobacter pylori in bottled mineral water: genotyping and antimicrobial resistance properties. BMC Microbiol. 2016;16:40. doi: 10.1186/s12866-016-0647-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ranjbar R, Khamesipour F, Jonaidi-Jafari N, Rahimi E. Helicobacter pylori isolated from Iranian drinking water: vacA, cagA, iceA, oipA and babA2 genotype status and antimicrobial resistance properties. FEBS Open Bio. 2016;6:433–441. doi: 10.1002/2211-5463.12054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ho S-A, Hoyle J, Lewis F, Secker A, Cross D, Mapstone N, et al. Direct polymerase chain reaction test for detection of helicobacter pylori in humans and animals. J Clin Microbiol. 1991;29:2543–2549. doi: 10.1128/jcm.29.11.2543-2549.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Andrews J. BSAC disc diffusion method for antimicrobial susceptibility testing. 2.1.4 ed. British Society for Antimicrobial Chemotherapy: Birmingham, UK; 2003. [Google Scholar]
  • 17.NCCLS . Performance Standards for Antimicrobial Susceptibility Testing. Approved Standard M7-A5: Informational Supplement M100- S18. National Committee for Clinical Laboratory Standards: Wayne, PA; 2007. [Google Scholar]
  • 18.Glupczynski Y, Megraud F, Lopez-Brea M, Andersen L. European multicentre survey of in vitro antimicrobial resistance in helicobacter pylori. Eur J Clin Microbiol Infect Dis. 2001;20:820–823. doi: 10.1007/s100960100611. [DOI] [PubMed] [Google Scholar]
  • 19.Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, et al. Distinct diversity of vacA, cagA, and cagE genes of helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol. 2005;43:3906–3916. doi: 10.1128/JCM.43.8.3906-3916.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang J, Chi DS, Laffan JJ, Li C, Ferguson DA, Litchfield P, et al. Comparison of cytotoxin genotypes of helicobacter pylori in stomach and saliva. Digest Dis Sci. 2002;47:1850–1856. doi: 10.1023/A:1016417200611. [DOI] [PubMed] [Google Scholar]
  • 21.Peek JR, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ, et al. Adherence to gastric epithelial cells induces expression of a helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc Assoc Am Physicians. 1998;110:531–544. [PubMed] [Google Scholar]
  • 22.Sheu B, Sheu S, Yang H, Huang A, Wu J-J. Host gastric Lewis expression determines the bacterial density of helicobacter pylori in babA2 genopositive infection. Gut. 2003;52:927–932. doi: 10.1136/gut.52.7.927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dore MP, Sepulveda AR, El-Zimaity H, Yamaoka Y, Osato MS, Mototsugu K, et al. Isolation of helicobacter pylori from sheep—implications for transmission to humans. Am J Gastroenterol. 2001;96:1396. doi: 10.1111/j.1572-0241.2001.03772.x. [DOI] [PubMed] [Google Scholar]
  • 24.Bui D, Brown HE, Harris RB, Oren E. Serologic evidence for fecal–oral transmission of helicobacter pylori. Am J Trop Med Hyg. 2016;94:82–88. doi: 10.4269/ajtmh.15-0297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mard SA, Khadem Haghighian H, Sebghatulahi V, Ahmadi B. Dietary factors in relation to helicobacter pylori infection. Gastroenterol Res Pract. 2014;2014:1–5. doi: 10.1155/2014/826910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Stevenson TH, Bauer N, Lucia LM, Acuff GR. Attempts to isolate helicobacter from cattle and survival of helicobacter pylori in beef products. J Food Prot. 2000;63:174–178. doi: 10.4315/0362-028X-63.2.174. [DOI] [PubMed] [Google Scholar]
  • 27.Poms RE, Tatini SR. Survival of helicobacter pylori in ready-to-eat foods at 4 C. Int J Food Microbiol. 2001;63:281–286. doi: 10.1016/S0168-1605(00)00441-4. [DOI] [PubMed] [Google Scholar]
  • 28.Meng X, Zhang H, Law J, Tsang R, Tsang T. Detection of helicobacter pylori from food sources by a novel multiplex PCR assay. J Food Safety. 2008;28:609–619. doi: 10.1111/j.1745-4565.2008.00135.x. [DOI] [Google Scholar]
  • 29.Jiang X, Doyle MP. Optimizing enrichment culture conditions for detecting helicobacter pylori in foods. J Food Prot. 2002;65:1949–1954. doi: 10.4315/0362-028X-65.12.1949. [DOI] [PubMed] [Google Scholar]
  • 30.Herrera AG. Helicobacter pylori and food products. Public Health Microbiol. 2004:297–301. [DOI] [PubMed]
  • 31.Quaglia N, Dambrosio A, Normanno G, Parisi A, Firinu A, Lorusso V, et al. Survival of helicobacter pylori in artificially contaminated ultrahigh temperature and pasteurized milk. Food Microbiol. 2007;24:296–300. doi: 10.1016/j.fm.2006.04.008. [DOI] [PubMed] [Google Scholar]
  • 32.Fujimura S, Kawamura T, Kato S, Tateno H, Watanabe A. Detection of helicobacter pylori in cow's milk. Lett Appl Microbiol. 2002;35:504–507. doi: 10.1046/j.1472-765X.2002.01229.x. [DOI] [PubMed] [Google Scholar]
  • 33.Vale F, Vítor J. Transmission pathway of helicobacter pylori: does food play a role in rural and urban areas? Int J Food Microbiol. 2010;138:1–12. doi: 10.1016/j.ijfoodmicro.2010.01.016. [DOI] [PubMed] [Google Scholar]
  • 34.Angelidis AS, Tirodimos I, Bobos M, Kalamaki MS, Papageorgiou DK, Arvanitidou M. Detection of helicobacter pylori in raw bovine milk by fluorescence in situ hybridization (FISH) Int J Food Microbiol. 2011;151:252–256. doi: 10.1016/j.ijfoodmicro.2011.09.007. [DOI] [PubMed] [Google Scholar]
  • 35.Quaglia N, Dambrosio A, Normanno G, Parisi A, Patrono R, Ranieri G, et al. High occurrence of helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection? Int J Food Microbiol. 2008;124:43–47. doi: 10.1016/j.ijfoodmicro.2008.02.011. [DOI] [PubMed] [Google Scholar]
  • 36.Talaei R, Souod N, Momtaz H, Dabiri H. Milk of livestock as a possible transmission route of helicobacter pylori infection. Gastroenterol Hepatol Bed Bench. 2015;8:S30. [PMC free article] [PubMed] [Google Scholar]
  • 37.Rahimi E, Kheirabadi EK. Detection of helicobacter pylori in bovine, buffalo, camel, ovine, and caprine milk in Iran. Foodborne Pathog Dis. 2012;9:453–456. doi: 10.1089/fpd.2011.1060. [DOI] [PubMed] [Google Scholar]
  • 38.Osman EY, El-Eragi A, Musa AM, El-Magboul SB. Detection of helicobacter pylori glmM gene in bovine milk using nested polymerase chain reaction. Vet World. 2015;8:913. doi: 10.14202/vetworld.2015.913-917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Bianchini Valentina, Recordati Camilla, Borella Laura, Gualdi Valentina, Scanziani Eugenio, Selvatico Elisa, Luini Mario. Helicobacteraceae in Bulk Tank Milk of Dairy Herds from Northern Italy. BioMed Research International. 2015;2015:1–4. doi: 10.1155/2015/639521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Safaei HG, Rahimi E, Zandi A, Rashidipour A. Helicobacter pylori as a zoonotic infection: the detection of H pylori antigens in the milk and faeces of cows. J Res Med Sci. 2011;16:184. [PMC free article] [PubMed] [Google Scholar]
  • 41.Zamani M, Vahedi A, Maghdouri Z, Shokri-Shirvani J. Role of food in environmental transmission of helicobacter pylori. Caspian J Int Med. 2017;8:146. doi: 10.22088/cjim.8.3.146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Talimkhani A, Mashak Z. Prevalence and genotyping of helicobacter pylori isolated from meat, Milk and vegetable in Iran. Jundishapur J Microbiol. 2017;10.
  • 43.Khaji L, Banisharif G, Alavi I. Genotyping of the helicobacter pylori isolates of raw milk and traditional dairy products. Microbiol Res. 2017;8:43–46. doi: 10.4081/mr.2017.7288. [DOI] [Google Scholar]
  • 44.Esmaeiligoudarzi D, Tameshkel FS, Ajdarkosh H, Arsalani M, Sohani MH, Behnod V. Prevalence of helicobacter pyloriinIranian milk and dairy products using culture and ureC based-PCR techniques. Biomed Pharmacol J. 2015;8:179–183. doi: 10.13005/bpj/597. [DOI] [Google Scholar]
  • 45.Saeidi Elnaz, Sheikhshahrokh Amirhossein. vacAGenotype Status ofHelicobacter pyloriIsolated from Foods with Animal Origin. BioMed Research International. 2016;2016:1–6. doi: 10.1155/2016/8701067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hemmatinezhad B, Momtaz H, Rahimi E. VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of helicobacter pylori isolated from various types of ready to eat foods. Ann Clin Microbiol Antimicrob. 2016;15:2. doi: 10.1186/s12941-015-0115-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Hunt R, Xiao S, Megraud F, Leon-Barua R, Bazzoli F, Van der Merwe S, et al. Helicobacter pylori in developing countries. J Gastrointestin Liver Dis. 2011;20:299–304. [PubMed] [Google Scholar]
  • 48.Torkan S, Shahreza MHS. VacA, CagA, IceA and OipA genotype status of helicobacter pylori isolated from biopsy samples from Iranian dogs. Trop J Pharmaceu Res. 2016;15:377–384. doi: 10.4314/tjpr.v15i2.22. [DOI] [Google Scholar]
  • 49.Dabiri H, Jafari F, Baghaei K, Shokrzadeh L, Abdi S, Pourhoseingholi MA, et al. Prevalence of helicobacter pylori vacA, cagA, cagE, oipA, iceA, babA2 and babB genotypes in Iranian dyspeptic patients. Microb Pathog. 2017;105:226–230. doi: 10.1016/j.micpath.2017.02.018. [DOI] [PubMed] [Google Scholar]
  • 50.Podzorski RP, Podzorski DS, Wuerth A, Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn Microbiol Infect Dis. 2003;46:83–88. doi: 10.1016/S0732-8893(03)00034-8. [DOI] [PubMed] [Google Scholar]
  • 51.Momtaz H, Dabiri H, Souod N, Gholami M. Study of helicobacter pylori genotype status in cows, sheep, goats and human beings. BMC Gastroenterol. 2014;14:61. doi: 10.1186/1471-230X-14-61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Gilani A, Razavilar V, Rokni N, Rahimi E. VacA and cagA genotypes status and antimicrobial resistance properties of helicobacter pylori strains isolated from meat products in Isfahan province. Iran Iran J Vet Res. 2017;18:97. [PMC free article] [PubMed] [Google Scholar]
  • 53.Pakbaz Z, Shirazi MH, Ranjbar R. Frequency of sabA gene in helicobacter pylori strains isolated from patients in Tehran, Iran. Iran Red Crescent Med J. 2013;15:767. doi: 10.5812/ircmj.5044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Souod N, Kargar M, Doosti A, Ranjbar R, Sarshar M. Genetic analysis of cagA and vacA genes in helicobacter pylori isolates and their relationship with gastroduodenal diseases in the west of Iran. Iran Red Crescent Med J. 2013;15:371. doi: 10.5812/ircmj.3732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Farshad S, Alborzi A, Japoni A, Ranjbar R, Asl KH, Badiee P, et al. Antimicrobial susceptibility of helicobacter pylori strains isolated from patients in shiraz, southern Iran. World J Gastroenterol. 2010;16:5746. doi: 10.3748/wjg.v16.i45.5746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Ghasemi A, Shirazi M, Ranjbar R, Khorramizadeh M, Daryani N, Hosseini M. The prevalence of cagA and cagE genes in helicobacter pylori strains isolated from different patient groups by polymerase chain reaction. Pak J Biol Sci. 2008;11:2579–2583. doi: 10.3923/pjbs.2008.2579.2583. [DOI] [PubMed] [Google Scholar]
  • 57.Taneike I, Nami A, O'Connor A, Fitzgerald N, Murphy P, Qasim A, et al. Analysis of drug resistance and virulence-factor genotype of Irish helicobacter pylori strains: is there any relationship between resistance to metronidazole and cagA status? Aliment Pharmacol Ther. 2009;30:784–790. doi: 10.1111/j.1365-2036.2009.04095.x. [DOI] [PubMed] [Google Scholar]
  • 58.Boyanova L, Markovska R, Yordanov D, Gergova G, Mitov I. Clarithromycin resistance mutations in helicobacter pylori in association with virulence factors and antibiotic susceptibility of the strains. Microb Drug Resist. 2016;22:227–232. doi: 10.1089/mdr.2015.0199. [DOI] [PubMed] [Google Scholar]
  • 59.Karabiber H, Selimoglu MA, Otlu B, Yildirim O, Ozer A. Virulence factors and antibiotic resistance in children with helicobacter pylori gastritis. J Pediatr Gastroenterol Nutr. 2014;58:608–612. doi: 10.1097/MPG.0000000000000273. [DOI] [PubMed] [Google Scholar]
  • 60.van Doorn LJ, Glupczynski Y, Kusters JG, Mégraud F, Midolo P, Maggi-Solcà N, et al. Accurate prediction of macrolide resistance in helicobacter pylori by a PCR line probe assay for detection of mutations in the 23S rRNA gene: multicenter validation study. Antimicrob Agents Chemother. 2001;45:1500–1504. doi: 10.1128/AAC.45.5.1500-1504.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Godoy AP, Ribeiro ML, Benvengo YH, Vitiello L, Miranda Mde C, Mendonça S, et al. Analysis of antimicrobial susceptibility and virulence factors in helicobacter pylori clinical isolates. BMC Gastroenterol. 2003;3:20. doi: 10.1186/1471-230X-3-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.European Helicobacter pylori Study Group Current European concepts in the management of helicobacter pylori infection. The Maastricht consensus report. Gut. 1997;41:8–13. doi: 10.1136/gut.41.1.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Mégraud F, Lamouliatte H. The treatment of refractory helicobacter pylori infection. Aliment Pharmacol Ther. 2003;17:1333–1343. doi: 10.1046/j.1365-2036.2003.01592.x. [DOI] [PubMed] [Google Scholar]
  • 64.Mégraud F, Hazell S, Glupczynski Y. Antibiotic susceptibility and resistance. In: Mobley HLT, Mendz GL, Hazell SL, editors. Helicobacter pylori: physiology and genetics. Washington, DC: ASM Press; 2001. pp. 511–530. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed throughout this research are included in this published article.


Articles from Antimicrobial Resistance and Infection Control are provided here courtesy of BMC

RESOURCES