The bioengineering of bacteria to selectively transport and metabolize natural substrates into specific metabolites is a valuable strategy for industrial-scale chemical production. The uptake of many substrates into cells requires specific transport systems, and so the identification and characterization of transporter genes are essential for industrial applications. A number of bacterial major facilitator superfamily transporters of aromatic acids have been identified and characterized, but many transporters of lignin-derived aromatic acids remain unidentified. The efficient conversion of lignin, an abundant but unutilized aromatic biomass resource, to value-added metabolites using microbial catabolism requires the characterization of transporters for lignin-derived aromatics. In this study, we identified the transporter gene responsible for the uptake of 5,5′-dehydrodivanillate, a lignin-derived biphenyl compound, in Sphingobium sp. strain SYK-6. In addition to characterizing its function, we applied this transporter gene to the production of a value-added metabolite from 5,5′-dehydrodivanillate.
KEYWORDS: Sphingobium; lignin; MFS transporter; MarR-type transcriptional regulator; 5,5′-dehydrodivanillate; 2-pyrone-4,6-dicarboxylate
ABSTRACT
The microbial conversion of lignin-derived aromatics is a promising strategy for the industrial utilization of this large biomass resource. However, efficient application requires an elucidation of the relevant transport and catabolic pathways. In Sphingobium sp. strain SYK-6, most of the enzyme genes involved in 5,5′-dehydrodivanillate (DDVA) catabolism have been characterized, but the transporter has not yet been identified. Here, we identified SLG_07710 (ddvK) and SLG_07780 (ddvR), genes encoding a putative major facilitator superfamily (MFS) transporter and MarR-type transcriptional regulator, respectively. A ddvK mutant of SYK-6 completely lost the capacity to grow on and convert DDVA. DdvR repressed the expression of the DDVA O-demethylase oxygenase component gene (ligXa), while DDVA acted as the gene inducer. A DDVA uptake assay was developed by employing this DdvR-controlled ligXa transcriptional regulatory system. A Sphingobium japonicum UT26S transformant expressing ddvK acquired DDVA uptake capacity, indicating that ddvK encodes the DDVA transporter. DdvK, probably requiring the proton motive force, was suggested to be a novel MFS transporter on the basis of the amino acid sequence similarity. Subsequently, we evaluated the effects of ddvK overexpression on the production of the DDVA metabolite 2-pyrone-4,6-dicarboxylate (PDC), a building block of functional polymers. A SYK-6 mutant of the PDC hydrolase gene (ligI) cultured in DDVA accumulated PDC via 5-carboxyvanillate and grew by utilizing 4-carboxy-2-hydroxypenta-2,4-dienoate. The introduction of a ddvK-expression plasmid into a ligI mutant increased the growth rate in DDVA and the amounts of DDVA converted and PDC produced after 48 h by 1.35- and 1.34-fold, respectively. These results indicate that enhanced transporter gene expression can improve metabolite production from lignin derivatives.
IMPORTANCE The bioengineering of bacteria to selectively transport and metabolize natural substrates into specific metabolites is a valuable strategy for industrial-scale chemical production. The uptake of many substrates into cells requires specific transport systems, and so the identification and characterization of transporter genes are essential for industrial applications. A number of bacterial major facilitator superfamily transporters of aromatic acids have been identified and characterized, but many transporters of lignin-derived aromatic acids remain unidentified. The efficient conversion of lignin, an abundant but unutilized aromatic biomass resource, to value-added metabolites using microbial catabolism requires the characterization of transporters for lignin-derived aromatics. In this study, we identified the transporter gene responsible for the uptake of 5,5′-dehydrodivanillate, a lignin-derived biphenyl compound, in Sphingobium sp. strain SYK-6. In addition to characterizing its function, we applied this transporter gene to the production of a value-added metabolite from 5,5′-dehydrodivanillate.
INTRODUCTION
Lignin is the most abundant aromatic compound on Earth and thus a promising renewable biomass resource for the industrial production of high-value metabolites. The lignin contained in the cell walls of plants forms a highly complex and stable three-dimensional structure by the random polymerization of monolignols (1–3). This structure contributes to the rigidity of plant cell walls but also to resistance against microbial degradation, which is a major obstacle to the industrial utilization of lignin (4).
The biphenyl structure, one of the intermonomer linkages constituting lignin, is estimated to account for approximately 5% to 7% of the milled wood lignin from Norway spruce (5, 6). The C—C bond between the benzene rings of this structure contributes to the resistance of lignin against microbial and chemical degradation (7); therefore, an elucidation of the bacterial biodegradation pathways is essential for the effective utilization of lignin. Sphingobium sp. strain SYK-6, first isolated as a 5,5′-dehydrodivanillate (DDVA) degrader from pulp effluent (8), is the bacterium with the best-characterized catabolic systems for lignin-derived aromatics (9, 10). Strain SYK-6 is able to utilize various lignin-derived biaryls, including β-aryl ether, phenylcoumaran, biphenyl, and diarylpropane, as well as monoaryls such as ferulate, vanillin, and syringaldehyde, as the sole source of carbon and energy. In SYK-6, the catabolic pathway of DDVA and almost all the enzyme genes involved in this pathway have been characterized (Fig. 1A). DDVA is O demethylated by DDVA O-demethylase, which consists of an oxygenase component (LigXa), ferredoxin (LigXc), and ferredoxin reductase (LigXd), to generate 2,2′,3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl (OH-DDVA) (11, 12). One of the two aromatic rings of OH-DDVA is cleaved by OH-DDVA dioxygenase (LigZ) (13, 14), and the resulting meta-cleavage compound is hydrolyzed to 5-carboxyvanillate (5CVA) and 4-carboxy-2-hydroxypenta-2,4-dienoate (CHPD) by LigY (13, 15). 5CVA is further converted to vanillate by 5CVA decarboxylases (LigW and LigW2) (16, 17), and vanillate then enters the tricarboxylic acid (TCA) cycle via O demethylation and the protocatechuate 4,5-cleavage pathway (10, 18). While CHPD is also expected to enter the TCA cycle, its catabolic pathway and pathway genes have yet to be elucidated. The protocatechuate 4,5-cleavage pathway generates 2-pyrone-4,6-dicarboxylate (PDC), a promising raw material for functional polyamides, polyesters, and polyurethanes (19–21). Therefore, the conversion to PDC by microbial metabolism is potentially among the most valuable uses of lignin.
FIG 1.
Catabolic pathway of DDVA in Sphingobium sp. strain SYK-6 and genetic localization of the DDVA catabolic genes. (A) Enzymes encoded by the genes in the DDVA gene cluster are shown in blue. Enzymes: LigXa, oxygenase component of DDVA O-demethylase; LigXc, ferredoxin of DDVA O-demethylase; LigXd, ferredoxin reductase of DDVA O-demethylase; LigZ, OH-DDVA dioxygenase; LigY, meta-cleavage compound hydrolase; LigW and LigW2, 5CVA decarboxylase; LigM, vanillate O-demethylase; LigA and LigB, small and large subunits of protocatechuate 4,5-dioxygenase; LigC, 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase; LigI, PDC hydrolase; LigU, 4-oxalomesaconate tautomerase; LigJ, 4-oxalomesaconate hydratase; LigK, 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase. Abbreviations: DDVA, 5,5′-dehydrodivanillate; OH-DDVA, 2,2′,3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl; 5CVA, 5-carboxyvanillate; CHPD, 4-carboxy-2-hydroxypenta-2,4-dienoate; PDC, 2-pyrone-4,6-dicarboxylate. (B) SLG_07710 (ddvK) and SLG_07780 (ddvR), characterized in this study, encode a major facilitator superfamily (MFS) transporter and a MarR-type transcriptional regulator, respectively. Each gene is indicated by an arrow.
Although the SYK-6 genes and enzymes for catabolism of various lignin-derived compounds have been extensively characterized, the uptake systems for these compounds, including DDVA, remain largely unknown except for the recently identified protocatechuate transporter (PcaK) (22). In general, aromatic acids do not readily diffuse across cell membranes at physiological pH due to the ionization of their carboxyl groups (23). To efficiently uptake these compounds, bacteria utilize active transporters. To date, multiple transporters involved in the uptake of aromatic acids have been identified, among which, the major facilitator superfamily (MFS) transporters are the most thoroughly investigated (9). The MFS transporters are secondary active transporters with 12 or 14 α-helix transmembrane (TM) segments consisting of 400 to 600 amino acid residues (24). The MFS includes over 83 families defined by substrate affinity (25). The transport of aromatic acids is mediated mainly by the aromatic acid/H+ symporter (AAHS) family, which utilizes the proton motive force (PMF) across cell membranes (26, 27). Among AAHS family members, 4-hydroxybenzoate/protocatechuate transporter (PcaK) (22, 26, 28), gallate/protocatechuate transporter (GalT) (29), benzoate transporter (BenK) (30–32), 2,4-dichlorophenoxyacetate transporter (TfdK) (33), 3-chlorobenzoate transporter (BenP) (34), 3-hydroxybenzoate transporter (MhbT) (35), gentisate transporter (GenK) (36), and 3-(3-hydroxyphenyl)propionate transporter (MhpT) (27) have been functionally characterized using a biosensor or radiolabeled substrates. In addition to the AAHS family, the anion/cation symporter (ACS) family members OphD in Burkholderia and HpaX in Escherichia were shown to transport phthalate and 4-hydroxyphenylacetate, respectively, into bacterial cells (37, 38). The metabolite/H+ symporter (MHS) family members CouT and PhdT were predicted to transport hydroxycinnamate derivatives, but this has not been directly demonstrated (39, 40). While 4-hydroxybenzoate/protocatechuate uptake by PcaK and gallate/protocatechuate uptake by GalT have been experimentally demonstrated, the transporters of other lignin-derived monoaryls and biaryls have not been identified.
The exogenous expression of MFS transporters can improve metabolite production by microbes (41, 42). For instance, a system for coenzyme Q10 production from 4-hydroxybenzoate and glucose using a Rhodobacter strain expressing Corynebacterium or Klebsiella pcaK demonstrated 1.18- to 1.21-fold greater yield than the wild-type Rhodobacter strain (43). Similarly, our laboratory found that pcaK overexpression in a SYK-6-derived strain enhanced PDC production 1.24-fold from protocatechuate (22). Wu et al. (44) reported that the introduction of the Rhodopseudomonas palustris CGA009 couP gene, which encodes a substrate binding protein of the ATP-binding cassette transporter presumed to be involved in the uptake of cinnamate derivatives, into Escherichia coli improved catechol production efficiency from vanillin by 1.3- to 1.4-fold (44). Therefore, the overexpression of transporter genes for lignin-derived aromatics appears to enhance the production of value-added metabolites by microbes.
The aim of current study was to identify the transporter for the uptake of lignin-derived aromatics by SYK-6. In addition to identifying the transporter for DDVA uptake, a gene responsible for the transcriptional regulation of a DDVA catabolic gene was also identified and used for the development of a DDVA uptake assay to characterize the transporter. Finally, we demonstrate that DDVA transporter gene overexpression can enhance PDC production from DDVA.
RESULTS AND DISCUSSION
Candidates for the transporter gene and transcriptional regulatory gene involved in DDVA catabolism.
The genes involved in the conversion of DDVA to vanillate, ligXa, ligZ, ligY, and ligW, are clustered on the SYK-6 genome (Fig. 1B; see also Table S1 in the supplemental material). A putative MFS transporter gene (SLG_07710) encoding 439 amino acids and a putative MarR-type transcriptional regulator gene (SLG_07780) encoding 215 amino acids were found immediately upstream of ligZ and ligXa, respectively. BLAST searches of the NCBI nonredundant database for SLG_07710 and SLG_07780 revealed no homologous genes with E value scores of <1E−100 except for the putative MFS member SLG_07600, which showed 46.1% amino acid sequence identity with SLG_07710 (E value score, 4.46E−134) (see Tables S2 and S3). The known genes with the highest amino acid sequence similarity to SLG_07710 and SLG_07780 are the benzoate transporter (BenK) from Corynebacterium glutamicum ATCC 13032 (23.8% identity) and the transcriptional regulator for 3-chlorobenzoate catabolic genes (CbaR) from Comamonas testosteroni BR60 (19.2% identity) (see Tables S4 and S5). In the following sections, we examined whether SLG_07710/SLG_07600 and SLG_07780 were involved in DDVA uptake and the transcriptional regulation of DDVA catabolic genes, respectively.
Characterization of putative transporter genes SLG_07710 and SLG_07600.
To investigate whether the putative transporter genes SLG_07710 and SLG_07600 are involved in DDVA catabolism, each gene was disrupted in SYK-6 through homologous recombination (see Fig. S1A to D), yielding an SLG_07710 mutant (strain SME133) and an SLG_07600 mutant (strain SME132). The growth of these mutant strains on DDVA, ferulate, syringate, vanillate, and protocatechuate were then examined. Mutant SME133 grew normally on ferulate, syringate, vanillate, and protocatechuate but did not grow on DDVA (Fig. 2A; see also Fig. S2). In addition, resting SME133 cells could not convert DDVA (Fig. 2B). These results suggest that SLG_07710 is essential for the catabolism of DDVA by SYK-6. On the other hand, the growth of SME132 was equivalent to that of the wild type in all substrates, suggesting that SLG_07600 is not involved in growth with these substrates.
FIG 2.
Characterization of SLG_07600 and SLG_07710 mutants. (A) Growth of SLG_07600 and SLG_07710 mutants using DDVA as a sole carbon and energy source. SYK-6 (○), SLG_07600 mutant (SME132; △), and SLG_07710 mutant (SME133; □) cells were incubated in Wx medium containing 5 mM DDVA. (B) Conversion of DDVA by the SME133 mutant. SYK-6 and SME133 mutant cells (OD600 of 5.0) were incubated with 100 μM DDVA. The culture supernatants were periodically collected and analyzed by HPLC. (C) Growth complementation of the SME133 mutant with pJB07710 carrying SLG_07710. SYK-6(pJB866) (○), SYK-6(pJB07710) (●), SME133(pJB866) (□), and SME133(pJB07710) (■) were incubated in Wx medium containing 5 mM DDVA and tetracycline. (D) Conversion of DDVA by SME133 harboring pJB07710. The cells (OD600 of 5.0) of SYK-6(pJB866) (○), SYK-6(pJB07710) (●), SME133(pJB866) (□), and SME133(pJB07710) (■) were incubated with 100 μM DDVA. Each value is the average ± the standard deviation from three independent experiments.
To verify that the lack of SME133 growth on DDVA was caused by the deletion of SLG_07710, we constructed a complementation plasmid, pJB07710, containing SLG_07710 and its putative promoter region (388 bp upstream from the initiation codon) downstream of the Pm promoter in pJB866 (see Fig. S3). Unlike SME133, SLG_07710-complemented SME133 grew on and converted DDVA, indicating that SLG_07710 is essential for the catabolism of DDVA (Fig. 2C and D). SME133 harboring pJB07710 took 28 h to reach stationary phase when cultured in 5 mM DDVA, while the wild type harboring pJB866 [i.e., SYK-6(pJB866)] required 36 h; although, both strains ultimately reached approximately equal final cell yields (Fig. 2C). In addition, resting SYK-6(pJB866) cells took 5 h to convert 100 μM DDVA compared to only 3 h for SYK-6(pJB07710) and SME133(pJB07710) cells (Fig. 2D). These results suggest that the introduction of SLG_07710 by multicopy plasmid can improve the DDVA uptake capacity. Thus, SLG_07710 appears to encode a transporter essential for SYK-6 growth in DDVA and so was designated ddvK.
Characterization of the putative transcriptional regulator gene SLG_07780.
In general, MarR-type transcriptional regulators are repressors that act by binding to the upstream regions of local target genes (45). To examine whether SLG_07780 is involved in the transcriptional regulation of its upstream gene ligXa, which encodes the DDVA O-demethylase oxygenase component, SLG_07780 was disrupted in SYK-6 (Fig. S1E and F) and the ligXa transcript level was measured by quantitative reverse transcription-PCR (qRT-PCR). The amount of ligXa transcript in SYK-6 cells grown with 5 mM DDVA was 93-fold higher than in cells grown without DDVA (Fig. 3A). In contrast, ligXa transcription by the SLG_07780 mutant (strain SME048) growing in either the presence or absence of DDVA was equivalent to that of the SYK-6 wild type growing in DDVA. These results suggest that SLG_07780 encodes a transcriptional repressor of ligXa. This gene was designated ddvR.
FIG 3.
Characterization of SLG_07780. (A) qRT-PCR analysis of ligXa expression. Total RNAs were isolated from SYK-6 and the SLG_07780 mutant (SME048) grown in Wx medium containing SEMP supplemented with (black bars) or without (white bars) 5 mM DDVA. Real-time PCR was performed using the ligXa-qF and ligXa-qR primer pair shown in Table 2. (B) ligXa promoter activities in SYK-6 cells incubated with lignin-derived aromatics. The β-galactosidase activities of SYK-6 cells harboring pS-XR grown in LB containing 5 mM DDVA, ferulate, syringate, vanillate, or protocatechuate were determined. (C) Identification of the inducer of ligXa expression. The β-galactosidase activities of SYK-6(pS-XR) and ligXd mutant [SME052(pS-XR)] grown in LB with (black bars) or without (white bars) 5 mM DDVA were determined. Each value is the average ± the standard deviation from three independent experiments.
To determine the inducer of ligXa expression, SYK-6 cells were transformed with a plasmid (pS-XR) containing ddvR and a putative ligXa promoter region (806 bp upstream from the initiation codon) in front of the lacZ reporter of vector pSEVA225 (Fig. S3), and the promoter activities were measured in the presence of various candidate inducers. The promoter activities of ligXa in SYK-6 cells harboring pS-XR were evaluated by β-galactosidase assays after incubating the cells for 1 h without an inducer or in the presence of 5 mM DDVA, ferulate, syringate, vanillate, or protocatechuate. The β-galactosidase activity was 5- to 11-fold higher in SYK-6(pS-XR) cells incubated with DDVA than in cells incubated without substrate or with ferulate, syringate, vanillate, or protocatechuate (1,210 ± 90 Miller units versus 110 to 250 Miller units, respectively) (Fig. 3B). These results suggest that the inducer of ligXa expression (i.e., the effector of DdvR) is DDVA and/or a metabolite such as OH-DDVA, a meta-cleavage product of OH-DDVA, or 5CVA.
To identify the actual effector of DdvR, pS-XR was introduced into strain SME052, which carries a mutant of ligXd, the gene encoding the ferredoxin reductase of DDVA O-demethylase. SME052 cells exhibited a minimal capacity to convert DDVA (12). When SME052(pS-XR) was incubated in the presence of 5 mM DDVA for 1 h, the promoter activity was 1,250 ± 40 Miller units, equivalent to the activity of SYK-6(pS-XR) incubated under the same conditions (Fig. 3C). This suggests that DDVA is the likely effector of DdvR. Further details on the transcriptional regulation of other DDVA catabolic genes by DdvR are under investigation.
Development of a DDVA uptake assay to confirm that DdvK transports DDVA.
The ability of bacterial cells to take up substrates can be evaluated using radiolabeled substrates (26, 35, 46). However, since radiolabeled DDVA is not available, a DDVA uptake assay was developed employing the ligXa transcriptional regulatory system controlled by DdvR.
The promoter assays described in the previous section indicated that DdvR repressed transcription from the ligXa promoter and that transcriptional repression was released in the presence of DDVA. In these assays, LacZ activity in cells harboring pS-XR resulted from the presumed interaction between DdvR and DDVA. Therefore, we speculated that it would be possible to measure the relative amount of DDVA transported in the cytoplasm via DdvK-mediated uptake by the level of LacZ activity. Sphingobium japonicum UT26S was selected as a host strain for these assays, as it has no homologs of ddvK and ddvR and no capacity to metabolize DDVA. First, plasmid pS-X carrying only the putative ligXa promoter region in pSEVA225 was introduced into UT26S cells (Fig. S3), and the β-galactosidase activity was measured. The β-galactosidase activity of these UT26S(pS-X) cells was dramatically higher than in UT26S cells harboring empty pSEVA225 (20,200 ± 300 Miller units versus 600 ± 80 Miller units, respectively) (Fig. 4A and B), indicating that the putative ligXa promoter was functional in UT26S cells. In contrast, β-galactosidase activity was greatly reduced in the UT26S cells harboring pS-XR (230 ± 0 Miller units), suggesting that DdvR represses transcription from the ligXa promoter (Fig. 4C). In addition, β-galactosidase activity was not enhanced in UT26S cells even in the presence of 5 mM DDVA, suggesting that UT26S cells are unable to take up DDVA. Next, pS-XRK carrying ddvK and its putative promoter region downstream of ddvR in pS-XR was introduced into UT26S cells (Fig. S3), and promoter activity was examined. These UT26S(pS-XRK) cells exhibited dramatically higher β-galactosidase activity in the presence of DDVA (18,700 ± 600 Miller units versus 80 ± 0 Miller units in the absence of DDVA) (Fig. 4D). These results clearly indicate that ddvK was expressed in UT26S cells and functioned as a DDVA transporter. In addition, DDVA was determined to be the effector of DdvR.
FIG 4.
DDVA uptake by S. japonicum UT26S cells carrying ddvK. The β-galactosidase activities of UT26S cells harboring pSEVA225 (A), pS-X (B), pS-XR (C), or pS-XRK (D) grown in LB with (filled symbols) or without (open symbols) 5 mM DDVA were evaluated. The left of each panel shows a schematic of DDVA uptake across the inner membrane (IM) of UT26S, and the β-galactosidase activities are shown on the right. A putative ligXa promoter region, ddvR, ddvK, lacZ, and DDVA are shown in purple, green, red, black, and blue, respectively. The inactive form of DdvR is shown in gray. Each value is the average ± the standard deviation from three independent experiments. The filled symbols in the graphs of panels A and C are behind the open symbols.
To assess the association between the DDVA concentration in the culture and ligXa promoter activity in UT26S(pS-XRK) cells, β-galactosidase activity was measured in UT26S(pS-XRK) cells incubated for 1 h in 50 to 5,000 μM DDVA. The β-galactosidase activity increased almost linearly up to 10,000 Miller units in 50 to 200 μM DDVA, with saturation at 300 μM or more (see Fig. S4).
Characterization of DdvK.
The ability of the ddvK mutant to take up DDVA was evaluated by measuring β-galactosidase activity in SME133 cells harboring pS-XR. No significant β-galactosidase activity was observed in SME133(pS-XR) cells after incubating with 5 mM DDVA for 1 h (70 ± 20 Miller units), while SYK-6(pS-XR) cells incubated under the same conditions exhibited substantial activity (860 ± 70 Miller units) (Fig. 5). On the other hand, SME133 cells harboring pS-XRK (i.e., a vector with ddvR and the ligXa promoter as well as ddvK and its promoter) exhibited substantial β-galactosidase activity in the presence of DDVA (920 ± 150 Miller units), indicating that ddvK encodes the transporter essential for DDVA uptake in SYK-6. In addition, the β-galactosidase activities of SYK-6(pS-XRK) and SME133(pS-XRK) increased by approximately 10% after 1 h of incubation with DDVA compared to that of SYK-6(pS-XR). The capacities of SYK-6(pJB07710) and SME133(pJB07710) to grow on and convert DDVA were also higher than those of the vector control strain (Fig. 2C and D). These results suggest that the overexpression of ddvK enhances DDVA uptake capacity.
FIG 5.
DDVA uptake by SYK-6 and ddvK mutant cells. The β-galactosidase activities of SYK-6(pS-XR) (○), SYK-6(pS-XRK) (●), SME133(pS-XR) (□), and SME133(pS-XRK) (■) cells incubated with 5 mM DDVA were evaluated. Each value is the average ± the standard deviation from three independent experiments.
To investigate the substrate range of DdvK, β-galactosidase activities were measured in UT26S(pS-XRK) cells incubated with 50 μM DDVA plus 100 μM other lignin-derived aromatic compounds (competitors) for 1 h. Compared to that of UT26S(pS-XRK) cells incubated with 50 μM DDVA alone (1,660 ± 170 Miller units), β-galactosidase activity was reduced to 50% in the presence of 100 μM ferulate (Fig. 6). This result suggests that DdvK may be capable of transporting ferulate. However, there is a crucial structural difference between ferulate and DDVA. To confirm that DdvK is truly involved in the transport of ferulate, we examined whether ferulate conversion by SYK-6 was promoted by the introduction of ddvK. No difference in ferulate conversion was observed between resting SYK-6(pJB866) cells and SYK-6(pJB07710) cells grown in LB (see Fig. S5). In addition, resting SME133(pJB866) cells and SME133(pJB07710) cells also showed activity equivalent to that of SYK-6(pJB866). These results suggest that DdvK has some affinity for ferulate but is unlikely to take it up. DdvK seems to be the DDVA-specific transporter of SYK-6.
FIG 6.
DDVA uptake by DdvK in the presence of lignin-derived aromatic monoaryls. The β-galactosidase activities of UT26S(pS-XRK) cells incubated in the presence of both DDVA (50 μM) and the indicated aromatic compound (100 μM competitor) were examined. The activity of UT26S(pS-XRK) cells without competitors was 1,660 ± 170 Miller units, which was set as 100% activity. Each value is the average ± the standard deviation from three independent experiments. Statistical differences from the control were determined by a one-way ANOVA with Dunnett's multiple-comparison test. *, P < 0.05.
To further characterize DdvK, we examined its PMF dependence by measuring the effect of the protonophore carbonyl cyanide m-chlorophenyl hydrazine (CCCP) on DDVA conversion in resting SYK-6 cells grown with DDVA. Under this treatment condition, SYK-6 cells completely lost the ability to convert DDVA (see Fig. S6). Since DdvK is the only DDVA transporter in SYK-6, it appears that DdvK utilizes the PMF for DDVA transport.
DdvK is a novel type of MFS transporter.
Generally, MFS transporters have TM regions consisting of 12 or 14 α-helices (24). An analysis of the amino acid sequence of DdvK using the TMHMM program revealed the presence of 12 predicted TM α-helices like other MFS transporters (see Fig. S7). Known MFS transporters responsible for the transport of aromatic acids are of the AAHS, ACS, and MHS families (Table S4). A phylogenetic analysis based on amino acid sequence similarity with MFS transporters of AAHS, ACS, and MHS families registered in the Transporter Classification Database (TCDB) and listed in Table S4 showed that DdvK and SLG_07600 are phylogenetically separate (Fig. 7). MFS transporters contain the conserved GXXXD[R/K]XGR[R/K] motif, which is thought to be the cytoplasmic gate for substrate transport, in the cytoplasmic hydrophilic loop between TM2 and TM3 (46–49). While the GXXXD[R/K]XGR[R/K] motif is also conserved in the cytoplasmic loop between TM8 and TM9, the sequence similarity of this motif among MFS transporters is lower than that of the TM2 to TM3 loop. The GXXXD[R/K]XGR[R/K] motif is partially conserved in the TM2 to TM3 and TM8 to TM9 loops of DdvK, but DdvK possesses no DGXD motif in TM1 (see Fig. S8), which is important for substrate transport by AAHS family members (27, 31, 50). Furthermore, there are no acidic amino acid residues in TM1 of DdvK. PSI-BLAST searches for DdvK using TCDB showed that even the 20 top hit transporters had E value scores of >1E−20, and their amino acid sequence identities were only 14% to 25% (see Table S6). Thus, DdvK is a novel type of MFS transporter that does not belong to any known family.
FIG 7.
Phylogenetic tree of DdvK and SLG_07600 with AAHS, ACS, and MHS families of MFS transporters. The scale bar corresponds to 0.05 amino acid substitutions per position. AAHS, ACS, and MHS family transporters are indicated by red, blue, and green letters, respectively. The accession numbers of MFS transporters in the GenBank or NCBI reference sequence for comparison are as follows. AAHS family: VanK_ADP1, CAG67874.1; VanK_ATCC 13032, NP_601586.1; HppK_PWD1, AAB81315.1; PcaK_SYK-6, BAK65963.1; BenK_ADP1, CAG68298.1; BenP_JMP134, AAZ63295.1; BenK_CSV86, EKX82696.1; BenK_KT2440, AAN68773.1; GenK_ATCC 13032, NP_602219.1; PcaK_ATCC 13032, NP_600304.1; BenK_ATCC 13032, NP_601609.1; BopK_19070, AAK58907.1; TsdT_RHA1, ABG93673.1; PcaK_ADP1, CAG68551.1; PcaK_PRS2000, AAA85137.1; PmdK_E6, GAO68738.1; GalT_KTGAL, CBJ94499.1; MhbT_M5a1, AAW63412.1; MhpT_K-12, APC50650.1; CadK_HW13, BAB78523.1; TfdK_JMP134, AAZ65767.1; and Orf1_KP7, BAA23264.1. ACS family: GudP_168, CAB12042.2; GudP_K-12, AAC75831.1; GarP_K-12, AAC76161.1; DgoT_K-12, AAC76714.2; IgoT_K-12, AAC77312.1; YybO_168, CAB16094.1; ExuT_K-12, AAC76128.2; ExuT_EC16, AAB70881.1; AlgT_NCIMB400, ABI72943.1; TtuB_AB3, AAB61622.1; HpaX_2229, AAD53495.1; HpaX_W, ADT77978.1; Pht1_pNMH102-2, BAA02509.1; OphD_ATCC 17616, BAG45577.1; and RhmT_K-12, AAC75306.2. MHS family: CitA_ATCC 13882, CAA35844.1; TcuC_LT2, AAL19633.1; KgtP_K-12, AAC75640.1; PcaT_PRS2000, AAA90923.1; ProP_K-12, AAC77072.1; MopB_Pc701, AAB41509.1; ShiA_K-12, AAC75045.1; YhjE_K-12, AAC76548.1; ThiU_RdKW20, AAC22076.1; CouT_RHA1, ABG96912.1; PhdT_ATCC 13032, NP_599535.2; Deh4p_MBA4, AAP47081.1; Deh2p_MBA4, AEI83217.1; Deh4p_DCMB5, AGG06758.1; and YdfJ_K-12, BAA15248.1. Other family: DdvK, BAK65446.1; and SLG_07600, BAK65435.1. Strains: ADP1, Acinetobacter sp. ADP1; ATCC 13032, Corynebacterium glutamicum ATCC 13032; PWD1, Rhodococcus globerulus PWD1; JMP134, Cupriavidus necator JMP134; SYK-6, Sphingobium sp. SYK-6; CSV86, Pseudomonas putida CSV86; KT2440, P. putida KT2440; 19070, Rhodococcus sp. 19070; RHA1, R. jostii RHA1; PRS2000, P. putida PRS2000; E6, Comamonas sp. E6; KTGAL, P. putida KTGAL; M5a1, Klebsiella pneumoniae M5a1; K-12, Escherichia coli K-12 substrain W3110 or MG1655; HW13, Bradyrhizobium sp. HW13; KP7, Nocardioides sp. KP7; 168, Bacillus subtilis subsp. subtilis 168; EC16, Dickeya chrysanthemi EC16; NCIMB400, Shewanella frigidimarina NCIMB 400; AB3, Agrobacterium vitis AB3; 2229, Salmonella enterica subsp. enterica serovar Dublin 2229; W, E. coli W; pNMH102-2, P. putida plasmid NMH102-2; ATCC 17616, Burkholderia cepacia ATCC 17616; ATCC 13882, K. pneumoniae ATCC 13882; LT2, S. enterica serovar Typhimurium LT2; Pc701, B. cepacia Pc701; RdKW20, Haemophilus influenzae Rd KW20; MBA4, Burkholderia sp. MBA4; DCMB5, Dehalococcoides mccartyi DCMB5. Asterisks indicate aromatic acid transporters in which substrate uptake was experimentally verified using radiolabeled compounds, reconstituted proteoliposomes, or biosensors. Abbreviations: AAHS, aromatic acid/H+ symporter; ACS, anion/cation symporter; MHS, metabolite/H+ symporter.
Production of PDC from DDVA in a SYK-6 mutant overexpressing ddvK.
Strain SYK-6 degrades DDVA to 5CVA and CHPD, and then 5CVA is degraded to form PDC (Fig. 1A). Although the CHPD catabolic pathway has not been elucidated, SYK-6 can utilize CHPD as a carbon source as evidenced by the growth of the PDC hydrolase gene (ligI) mutant (strain SME002-3) on DDVA (data not shown). During incubation with DDVA, the SME002-3 mutant grows using CHPD while accumulating PDC from 5CVA. When 5 mM DDVA was used as a carbon source, SME002-3(pJB866) cells reached the stationary phase at 56 h (Fig. 8A), while SME002-3(pJB07710) cells incubated under the same conditions reached the stationary phase in only 48 h; although, both strains eventually showed approximately equal maximum cell yields. The amounts of DDVA converted and PDC produced from 5 mM DDVA by SME002-3(pJB07710) after a 48-h incubation were 1.35-fold (4.66 ± 0.02 mM) and 1.34-fold (4.30 ± 0.02 mM) greater, respectively, than that produced by SME002-3(pJB866) (3.46 ± 0.03 mM and 3.22 ± 0.05 mM, respectively) (Fig. 8B). At 72 h of incubation, both strains completely converted DDVA and the yields of PDC were equivalent (96% to 97%). These results suggest that the overexpression of ddvK improves the rates of growth on DDVA, DDVA conversion, and PDC production.
FIG 8.
Effects of ddvK overexpression on growth of ligI mutant in DDVA and its PDC productivity. (A) Growth of ligI mutant [SME002-3(pJB866)] cells (○) and SME002-3(pJB07710) cells (●) in Wx medium containing 5 mM DDVA and tetracycline. (B) Amounts of DDVA converted (circles) and PDC produced (squares) in the cultures of SME002-3(pJB866) cells (open symbols) and SME002-3(pJB07710) cells (filled symbols) incubated with 5 mM DDVA. Each value is the average ± the standard deviation from three independent experiments. Error bars are hidden by symbols.
In conclusion, this study demonstrates that the enhancement of transporter gene expression can shorten the time required for the production of a value-added metabolite from a lignin-derived aromatic compound. This strategy appears to be applicable to the production of substances from other lignin-derived aromatics. Further research on the uptake systems for other lignin-derived biaryls and monoaryls is warranted to determine if this strategy is broadly applicable for the production of lignin-derived metabolites.
MATERIALS AND METHODS
Bacterial strains, plasmids, primers, and culture conditions.
The strains and plasmids used in this study are listed in Table 1, and the PCR primers are listed in Table 2. Sphingobium sp. strain SYK-6 and its mutants were grown at 30°C with shaking (160 rpm) in lysogeny broth (LB) or Wx minimal medium (51) containing SEMP (10 mM sucrose, 10 mM glutamate, 20 mg of methionine/liter, and 10 mM proline). S. japonicum UT26S and E. coli strains were grown in LB at 30°C and 37°C, respectively. The media for E. coli transformants carrying antibiotic resistance markers were supplemented with 100 mg of ampicillin/liter, 25 mg of kanamycin (Km)/liter, or 12.5 mg of tetracycline (Tc)/liter. When necessary, the media for SYK-6, its mutants, and UT26S transformants were supplemented with 50 mg of Km/liter, 12.5 mg of Tc/liter, or 100 mg of streptomycin/liter.
TABLE 1.
Strains and plasmids used in this study
| Strain or plasmid | Relevant characteristicsa | Reference or source |
|---|---|---|
| Strains | ||
| Sphingobium sp. | ||
| SYK-6 | Wild type; Nalr Smr | 8 |
| SME002-3 | SYK-6 derivative; ΔligI (entire coding sequence deletion); Nalr Smr | 22 |
| SME048 | SYK-6 derivative; ΔSLG_07780 (a 413-bp deletion in ddvR); Nalr Smr | This study |
| SME052 | SYK-6 derivative; ligXd::tet (a 799-bp deletion in ligXd); Nalr Smr Tcr | 12 |
| SME132 | SYK-6 derivative; ΔSLG_07600 (a 1,152-bp deletion); Nalr Smr | This study |
| SME133 | SYK-6 derivative; ΔSLG_07710 (a 1,210-bp deletion in ddvK); Nalr Smr | This study |
| Sphingobium japonicum | ||
| UT26S | Wild type; Nalr | 66 |
| Escherichia coli | ||
| HB101 | recA13 supE44 hsd20 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 | 67 |
| NEB 10-beta | araD139 Δ(ara-leu)7697 fhuA lacX74 galK ϕ80ΔlacZΔM15 recA1 endA1 nupG rpsL (Smr) Δ(mrr-hsdRMS-mcrBC) | New England Biolabs |
| Plasmids | ||
| pRK2013 | Tra+ Mob+ ColE1 replicon; Kmr | 68 |
| pAK405 | Plasmid for allelic exchange and markerless gene deletions in sphingomonads; Kmr | 58 |
| pK19mobsacB | oriT sacB; Kmr | 69 |
| pJB866 | RK2 broad-host-range expression vector; Tcr Pm xylS | 70 |
| pSEVA225 | RK2 lacZ promoter probe broad host range vector; Kmr | 71 |
| pAK07600 | pAK405 with a 2.0-kb deletion cassette carrying up- and downstream regions of SLG_07600 | This study |
| pAK07710 | pAK405 with a 2.0-kb deletion cassette carrying up- and downstream regions of ddvK | This study |
| pK07780 | pK19mobsacB with a 2.1-kb EcoRI-BamHI fragment carrying up- and downstream regions of ddvR | This study |
| pJB07710 | pJB866 with a 2.0-kb StuI-BamHI fragment of 3.2-kb PCR amplicon carrying ddvK | This study |
| pS-X | pSEVA225 with a 0.2-kb PCR amplicon carrying ligXa promoter region | This study |
| pS-XR | pSEVA225 with a 0.8-kb PCR amplicon carrying ddvR and ligXa promoter region | This study |
| pS-XRK | pS-XR with a 2.0-kb BamHI-EcoRI fragment carrying ddvK | This study |
Nal, nalidixic acid; Sm, streptomycin; Km, kanamycin; Ap, ampicillin; Tc, tetracycline.
TABLE 2.
Primer sequences used in this study
| Target plasmid or gene | Primer | Sequence (5′→3′) |
|---|---|---|
| For gene disruption | ||
| pAK07600 | Dis07600_TopF | CGGTACCCGGGGATCAAGATCGGCCTTGAGCCCGA |
| Dis07600_TopR | GATGACGAAGGCCTTGGCGA | |
| Dis07600_BotF | TCGCCAAGGCCTTCGTCATCCCCGTCTATCGGGACCGATT | |
| Dis07600_BotR | CGACTCTAGAGGATCGGCGCTTTACACCGGCAATA | |
| pAK07710 | Dis07710_TopF | CGGTACCCGGGGATCAAGAAGATCTCAGGCCCGGC |
| Dis07710_TopR | TCCGGCGCGAGATTGGTT | |
| Dis07710_BotF | AACCAATCTCGCGCCGGATTCCTGCTGACGTTCGTCCG | |
| Dis07710_BotR | CGACTCTAGAGGATCCGCAGCGCCTCGAAGAACAT | |
| pK07780 | 07780_DD | TCTGGATCCGCCCCATGTCC |
| 07780_DU | CATGATATCCTCGGGCAATATCTGG | |
| 07780_UD | CCAGATATTGCCCGAGGATATCATGCCACCTGCTTGAACGACACC | |
| 07780_UU | TCGAATTCGCGGAAGTCGAT | |
| For confirmation of gene disruption | ||
| SLG_07600 | 07600_F | GCACGACCGACCATCAATC |
| Dis07600_BotR | CGACTCTAGAGGATCGGCGCTTTACACCGGCAATA | |
| SLG_07710 | 07710_F | CGACGAGCATCTACACGGG |
| Dis07710_BotR | CGACTCTAGAGGATCCGCAGCGCCTCGAAGAACAT | |
| For qRT-PCR analysis | ligXa_qF | CGGCAGCACGGAAATGAC |
| ligXa_qR | GGAGCCCTTCTCCTGGAAGA | |
| Construction of plasmids | ||
| pS-X | pSEVA225_ligXa_F | GCAGGCATGCAAGCTGCGTGGAGCGGCACTATA |
| pSEVA225_ligXa_R | TTTTCCTCCTAAGCTTGGCCTCTCTCTCCTGGC | |
| pS-XR | pSEVA225_ligXa-ddvR_F | GCAGGCATGCAAGCTTCAGGGCGTGGACGCCAG |
| pSEVA225_ligXa_R | TTTTCCTCCTAAGCTTGGCCTCTCTCTCCTGGC |
Chemicals.
DDVA was chemically synthesized as described previously (52). Other aromatic compounds were purchased from Tokyo Chemical Co., Ltd., or Wako Pure Chemical Industries, Ltd. CCCP was purchased from Sigma-Aldrich Co., Ltd.
Sequence analysis.
Sequence analysis was performed with the MacVector program (MacVector, Inc.). Sequence similarity searches were conducted using the BLAST program (53) and PSI-BLAST in TCDB (http://www.tcdb.org/). Pairwise and multiple alignments were performed with the EMBOSS alignment tool (54) and the ClustalW program (55), respectively. Phylogenetic trees were generated using the FigTree program (http://tree.bio.ed.ac.uk/software/figtree/). Putative TM segments were predicted using the TMHMM program (56).
Construction of mutants.
To construct plasmids for the disruption of SLG_07600 (pAK07600) and SLG_07710 (pAK07710), 1-kb regions upstream and downstream of each gene were amplified by PCR from SYK-6 total DNA using the primer pairs listed in Table 2. The resulting fragments were cloned into pAK405 by in-fusion cloning (In-Fusion HD cloning kit; TaKaRa Bio, Inc.). The plasmids were independently introduced into SYK-6 cells by triparental mating using pRK2013 as a helper plasmid (57), and the mutant strains were selected as described previously (58). Disruptions of SLG_07600 and SLG_07710 were examined by colony PCR using the primer pair shown in Table 2. To construct pK07780 for the disruption of SLG_07780, 1-kb regions upstream and downstream of the gene were amplified and combined by overlapping PCR using SYK-6 total DNA and the primer pairs listed in Table 2. The 2.1-kb EcoRI-BamHI fragment of the resulting PCR amplicon was ligated into the same site of pK19mobsacB to obtain pK07780. The resulting plasmid was introduced into SYK-6 cells by electroporation, and candidate mutants were isolated as described previously (59, 60). The disruption of SLG_07780 was confirmed by Southern hybridization analysis.
Bacterial growth measurements.
SYK-6, SME132, and SME133 cells were grown in LB, harvested by centrifugation at 4,800 × g for 5 min, washed twice with Wx medium, and resuspended in 3 ml of Wx medium. The cells were then inoculated in fresh Wx medium containing 5 mM DDVA, ferulate, syringate, vanillate, or protocatechuate to an optical density at 660 nm (OD660) of 0.2. For growth in protocatechuate, 20 mg of methionine/liter was added to the medium, because SYK-6 exhibits auxotrophy for methionine in a methoxy group-free growth substrate (61, 62). Cell growth was periodically monitored by measuring the OD660 with a TVS062CA biophotorecorder (Advantec Co., Ltd.) with shaking (60 rpm) at 30°C. A complementation plasmid for SLG_07710, pJB07710, was introduced into SME133 cells by electroporation, and the growth of the transformant cells was examined as described.
Resting cell assays.
SYK-6 and SME133 cells were inoculated in LB (final concentration, 1%) and incubated to stationary phase. The cells were harvested by centrifugation at 4,800 × g for 5 min, washed twice with 50 mM Tris-HCl buffer (pH 7.5), and resuspended in 3 ml of the same buffer. The conversion of DDVA was measured at 30°C in a 1-ml mixture containing cells suspended to an OD600 of 5.0, 100 μM DDVA, and 50 mM Tris-HCl buffer (pH 7.5). The cell suspensions were first incubated for 5 min at 30°C, and then the conversion was started by adding DDVA. The reaction mixtures were incubated with shaking (1,500 rpm), and 100-μl samples were collected at the start and after 1, 3, 6, 10, and 24 h of incubation for analysis. For the examination of SYK-6 and SME133 cells harboring pJB866 or pJB07710, samples were collected at the start and after 1, 2, 3, 4, and 5 h of incubation. The conversion of ferulate was measured in a mixture containing the same Tris-HCl buffer, cells (OD600 of 1.0), and 200 μM ferulate. Samples were collected at the start and after 10, 20, 30, 60, and 90 min of incubation. The reactions were stopped by centrifugation at 18,800 × g for 10 min, and the supernatants were diluted 10-fold in water, filtered, and analyzed by high-performance liquid chromatography (HPLC).
For inhibition experiments, SYK-6 cells were grown in Wx medium containing SEMP for 12 h and then in the same Wx medium plus 3 mM DDVA for an additional 4 h. The cells (OD600 of 2.0) were incubated with 100 μM CCCP for 5 min at 30°C prior to adding 100 μM DDVA. Since ethanol was used as a solvent for CCCP, ethanol was added to the control assay mixtures (final concentration, 5%). Samples were collected at the start and after 2, 4, 6, 8, 16, and 24 h and analyzed by HPLC.
HPLC conditions.
The reaction mixtures were analyzed by HPLC (Acquity UPLC system; Waters Corporation) using a TSKgel ODS-140HTP column (2.1 mm by 100 mm; Tosoh Corporation). The mobile phase for the analysis of DDVA and ferulate was a mixture of water (85%) and acetonitrile (15%) containing 0.1% formic acid at a flow rate of 0.5 ml/min. For the analysis of PDC, the mobile phase was a mixture of water (85%) and acetonitrile (15%) containing 0.1% phosphoric acid at a flow rate of 0.3 ml/min. DDVA, ferulate, and PDC were detected at 223.8 nm, 322.6 nm, and 315.8 nm with retention times of 2.0, 1.8, and 0.9 min, respectively.
qRT-PCR.
qRT-PCR was conducted essentially as described in a previous study (63). SYK-6 and SME048 cells grown in LB were harvested and washed twice with Wx medium. The cells were resuspended to an OD600 of 0.2 in Wx medium containing SEMP and cultivated at 30°C. When the OD600 of the culture reached 0.5, 5 mM DDVA was added and the cells further incubated for 6 h. As a control, cells were further incubated for 2 h without adding DDVA. Total RNA was isolated from the cells using the illustra RNAspin Mini isolation kit (GE Healthcare), and 2 μg was reverse transcribed into cDNAs using the SuperScript IV First-strand synthesis system (Invitrogen). A qRT-PCR analysis was performed using the cDNA sample, gene-specific primers (900 nM) (Table 2), and a Fast SYBR green master mix (Applied Biosystems) with a StepOne real-time PCR system (Applied Biosystems). To normalize the amounts of RNA in each sample, 16S rRNA was used as an internal standard.
Construction of plasmids to monitor ligXa promoter activity and DDVA uptake.
To construct pS-X and pS-XR, a putative ligXa promoter region and its region plus ddvR were amplified by PCR using SYK-6 total DNA and the primer pairs listed in Table 2. The resulting fragments were cloned into the HindIII site of pSEVA225 by in-fusion cloning. The 2.0-kb BamHI-EcoRI fragment of pJB07710 carrying ddvK was ligated into the same site of pS-XR to obtain pS-XRK. A schematic representation of the plasmids is shown in Fig. S3 in the supplemental material. The resulting plasmids were independently introduced into SYK-6, its mutants, and UT26S cells by electroporation or triparental mating.
Assay for ligXa promoter activity.
β-Galactosidase activities were measured using 2-nitrophenyl-β-d-galactopyranoside (ONPG) as the substrate according to a modified Miller assay [https://openwetware.org/wiki/Beta-Galactosidase_Assay_(A_better_Miller)] (64, 65). SYK-6 and SME052 cells harboring pS-XR were grown in LB containing Km. After growth to stationary phase, the cells were resuspended to an OD600 of 2.0 in 0.5 ml LB containing 5 mM DDVA, ferulate, syringate, vanillate, or protocatechuate. After incubating the cells for 1 h with shaking (1,500 rpm) at 30°C, the OD600 (A600) was measured using a spectrophotometer V-630BIO (Jasco Corporation). Twenty microliters of a culture solution and 80 μl permeabilization solution (100 mM Na2HPO4, 20 mM KCl, 2 mM MgSO4, 0.8 mg/ml hexadecyltrimethylammonium bromide, 0.4 mg/ml sodium deoxycholate, and 5.4 μl/ml β-mercaptoethanol) were mixed and incubated for 30 min at 30°C. Six hundred microliters of substrate solution (60 mM Na2HPO4, 40 mM NaH2PO4, 1 mg/ml ONPG, and 2.7 μl/ml β-mercaptoethanol) was added to the sample and incubated for 5 min at 30°C. After this incubation, 700 μl stop solution (1 M Na2CO3) was added and the solution was centrifuged at 18,800 × g for 10 min to collect the supernatant. The A420 of the supernatant was measured with a multimode plate reader (Infinite 200 PRO; Tecan Co., Ltd.). The β-galactosidase activities are expressed as Miller units [1,000 × A420/(t × vol × A600)] where A420 is the absorbance of o-nitrophenol, t is the reaction time (min), vol is the volume of culture solution (ml), and A600 is the cell density.
DDVA uptake assay.
SYK-6, SME133, and UT26S cells harboring pS-XR or pS-XRK were grown in LB containing Km and then resuspended to an OD600 of 1.0 (UT26S cells) or 2.0 (SYK-6 and SME133 cells) in 0.5 or 1 ml LB with or without 5 mM DDVA. Samples were incubated with shaking (1,500 rpm) at 30°C and collected at the start and after 1, 2, and 3 h (UT26S cells) or 20, 40, 60, and 90 min (SYK-6 and SME133 cells). The β-galactosidase activities of the cells were measured according to the method described in “Assay for ligXa promoter activity.” To assess the correlation between DDVA concentration in the culture and ligXa promoter activity in UT26S(pS-XRK) cells, the cells prepared as described above (OD600 of 1.0) were incubated with 50, 100, 200, 300, 500, 1,000, or 5,000 μM DDVA and their β-galactosidase activities were measured. For the determination of the substrate range of DdvK, UT26S(pS-XRK) cells (OD600 of 1.0) were incubated with 50 μM DDVA plus 100 μM syringate, vanillate, protocatechuate, 4-hydroxybenzoate, benzoate, sinapinate, ferulate, caffeate, p-coumarate, cinnamate, coniferyl aldehyde, or coniferyl alcohol. These cultures were collected after 1 h, and β-galactosidase activities of the cells were measured. Statistical significance was analyzed by a one-way analysis of variance (ANOVA) with Dunnett's multiple-comparison test using GraphPad Prism 7 software (GraphPad Software, Inc.).
PDC production from DDVA.
SME002-3 cells harboring pJB866 or pJB07710 were grown in LB containing Tc. The cells were harvested by centrifugation at 4,800 × g for 5 min, washed twice with Wx medium, and resuspended in 3 ml of the same medium. The cells were then inoculated in 5 ml Wx medium containing 5 mM DDVA and Tc to an OD660 of 0.2 and incubated with shaking (60 rpm) at 30°C. Cell growth was periodically monitored by measuring the OD660 with a TVS062CA biophotorecorder. Samples (each 50 μl) were collected at the start and after 12, 24, 36, 48, 60, and 72 h of incubation for analysis. The reaction was stopped by centrifugation, and the samples were diluted, filtered, and analyzed by HPLC.
Supplementary Material
ACKNOWLEDGMENTS
This work was supported in part by a research grant from the Institute for Fermentation, Osaka, and JSPS KAKENHI (15H04473).
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.01314-18.
REFERENCES
- 1.Boerjan W, Ralph J, Baucher M. 2003. Lignin biosynthesis. Annu Rev Plant Biol 54:519–546. doi: 10.1146/annurev.arplant.54.031902.134938. [DOI] [PubMed] [Google Scholar]
- 2.Vanholme R, Demedts B, Morreel K, Ralph J, Boerjan W. 2010. Lignin biosynthesis and structure. Plant Physiol 153:895–905. doi: 10.1104/pp.110.155119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Janusz G, Pawlik A, Sulej J, Świderska-Burek U, Jarosz-Wilkołazka A, Paszczyński A. 2017. Lignin degradation: microorganisms, enzymes involved, genomes analysis and evolution. FEMS Microbiol Rev 41:941–962. doi: 10.1093/femsre/fux049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Himmel ME, Ding SY, Johnson DK, Adney WS, Nimlos MR, Brady JW, Foust TD. 2007. Biomass recalcitrance: engineering plants and enzymes for biofuels production. Science 315:804–807. doi: 10.1126/science.1137016. [DOI] [PubMed] [Google Scholar]
- 5.Sette M, Wechselberger R, Crestini C. 2011. Elucidation of lignin structure by quantitative 2D NMR. Chemistry 17:9529–9535. doi: 10.1002/chem.201003045. [DOI] [PubMed] [Google Scholar]
- 6.Capanema EA, Balakshin MY, Kadla JF. 2004. A comprehensive approach for quantitative lignin characterization by NMR spectroscopy. J Agric Food Chem 52:1850–1860. doi: 10.1021/jf035282b. [DOI] [PubMed] [Google Scholar]
- 7.Kim S, Chmely SC, Nimlos MR, Bomble YJ, Foust TD, Paton RS, Beckham GT. 2011. Computational study of bond dissociation enthalpies for a large range of native and modified lignins. J Phys Chem Lett 2:2846–2852. doi: 10.1021/jz201182w. [DOI] [Google Scholar]
- 8.Katayama Y, Nishikawa S, Nakamura M, Yano K, Yamasaki M, Morohoshi N, Haraguchi T. 1987. Cloning and expression of Pseudomonas paucimobilis SYK-6 genes involved in the degradation of vanillate and protocatechuate in P. putida. Mokuzai Gakkaishi 33:77–79. [Google Scholar]
- 9.Kamimura N, Takahashi K, Mori K, Araki T, Fujita M, Higuchi Y, Masai E. 2017. Bacterial catabolism of lignin-derived aromatics: new findings in a recent decade. Environ Microbiol Rep 9:679–705. doi: 10.1111/1758-2229.12597. [DOI] [PubMed] [Google Scholar]
- 10.Masai E, Katayama Y, Fukuda M. 2007. Genetic and biochemical investigations on bacterial catabolic pathways for lignin-derived aromatic compounds. Biosci Biotechnol Biochem 71:1–15. doi: 10.1271/bbb.60437. [DOI] [PubMed] [Google Scholar]
- 11.Sonoki T, Obi T, Kubota S, Higashi M, Masai E, Katayama Y. 2000. Coexistence of two different O demethylation systems in lignin metabolism by Sphingomonas paucimobilis SYK-6: cloning and sequencing of the lignin biphenyl-specific O-demethylase (LigX) gene. Appl Environ Microbiol 66:2125–2132. doi: 10.1128/AEM.66.5.2125-2132.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yoshikata T, Suzuki K, Kamimura N, Namiki M, Hishiyama S, Araki T, Kasai D, Otsuka Y, Nakamura M, Fukuda M, Katayama Y, Masai E. 2014. Three-component O-demethylase system essential for catabolism of a lignin-derived biphenyl compound in Sphingobium sp. strain SYK-6. Appl Environ Microbiol 80:7142–7153. doi: 10.1128/AEM.02236-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Peng X, Masai E, Katayama Y, Fukuda M. 1999. Characterization of the meta-cleavage compound hydrolase gene involved in degradation of the lignin-related biphenyl structure by Sphingomonas paucimobilis SYK-6. Appl Environ Microbiol 65:2789–2793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kuatsjah E, Chen HM, Withers SG, Eltis LD. 2017. Characterization of an extradiol dioxygenase involved in the catabolism of lignin-derived biphenyl. FEBS Lett 591:1001–1009. doi: 10.1002/1873-3468.12611. [DOI] [PubMed] [Google Scholar]
- 15.Kuatsjah E, Chan ACK, Kobylarz MJ, Murphy MEP, Eltis LD. 2017. The bacterial meta-cleavage hydrolase LigY belongs to the amidohydrolase superfamily, not to the α/β-hydrolase superfamily. J Biol Chem 292:18290–18302. doi: 10.1074/jbc.M117.797696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Peng X, Masai E, Kitayama H, Harada K, Katayama Y, Fukuda M. 2002. Characterization of the 5-carboxyvanillate decarboxylase gene and its role in lignin-related biphenyl catabolism in Sphingomonas paucimobilis SYK-6. Appl Environ Microbiol 68:4407–4415. doi: 10.1128/AEM.68.9.4407-4415.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Peng X, Masai E, Kasai D, Miyauchi K, Katayama Y, Fukuda M. 2005. A second 5-carboxyvanillate decarboxylase gene, ligW2, is important for lignin-related biphenyl catabolism in Sphingomonas paucimobilis SYK-6. Appl Environ Microbiol 71:5014–5021. doi: 10.1128/AEM.71.9.5014-5021.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kamimura N, Masai E. 2014. The protocatechuate 4,5-cleavage pathway: overview and new findings, p 207–226. In Nojiri H, Tsuda M, Fukuda M, Kamagata Y (ed), Biodegradative bacteria: how bacteria degrade, survive, adapt, and evolve. Springer Japan, Tokyo, Japan. [Google Scholar]
- 19.Masai E, Momose K, Hara H, Nishikawa S, Katayama Y, Fukuda M. 2000. Genetic and biochemical characterization of 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase and its role in the protocatechuate 4,5-cleavage pathway in Sphingomonas paucimobilis SYK-6. J Bacteriol 182:6651–6658. doi: 10.1128/JB.182.23.6651-6658.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hishida M, Shikinaka K, Katayama Y, Kajita S, Masai E, Nakamura M, Otsuka Y, Ohara S, Shigehara K. 2009. Polyesters of 2-pyrone-4,6-dicarboxylic acid (PDC) as bio-based plastics exhibiting strong adhering properties. Polym J 41:297–302. doi: 10.1295/polymj.PJ2008291. [DOI] [Google Scholar]
- 21.Michinobu T, Bito M, Yamada Y, Tanimura M, Katayama Y, Masai E, Nakamura M, Otsuka Y, Ohara S, Shigehara K. 2009. Fusible, elastic, and biodegradable polyesters of 2-pyrone-4,6-dicarboxylic acid (PDC). Polym J 41:1111–1116. doi: 10.1295/polymj.PJ2009045R. [DOI] [Google Scholar]
- 22.Mori K, Kamimura N, Masai E. 2018. Identification of the protocatechuate transporter gene in Sphingobium sp. strain SYK-6 and effects of overexpression on production of a value-added metabolite. Appl Microbiol Biotechnol 102:4807–4816. doi: 10.1007/s00253-018-8988-3. [DOI] [PubMed] [Google Scholar]
- 23.Kashket ER. 1985. The proton motive force in bacteria: a critical assessment of methods. Annu Rev Microbiol 39:219–242. doi: 10.1146/annurev.mi.39.100185.001251. [DOI] [PubMed] [Google Scholar]
- 24.Pao SS, Paulsen IT, Saier MH Jr. 1998. Major facilitator superfamily. Microbiol Mol Biol Rev 62:1–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Västermark Å Driker A, Li J, Saier MH Jr. 2015. Conserved movement of TMS11 between occluded conformations of LacY and XylE of the major facilitator superfamily suggests a similar hinge-like mechanism. Proteins 83:735–745. doi: 10.1002/prot.24755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Nichols NN, Harwood CS. 1997. PcaK, a high-affinity permease for the aromatic compounds 4-hydroxybenzoate and protocatechuate from Pseudomonas putida. J Bacteriol 179:5056–5061. doi: 10.1128/jb.179.16.5056-5061.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Xu Y, Chen B, Chao H, Zhou NY. 2013. mhpT encodes an active transporter involved in 3-(3-hydroxyphenyl)propionate catabolism by Escherichia coli K-12. Appl Environ Microbiol 79:6362–6368. doi: 10.1128/AEM.02110-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Pernstich C, Senior L, MacInnes KA, Forsaith M, Curnow P. 2014. Expression, purification and reconstitution of the 4-hydroxybenzoate transporter PcaK from Acinetobacter sp. ADP1. Protein Expr Purif 101:68–75. doi: 10.1016/j.pep.2014.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Nogales J, Canales Á Jiménez-Barbero J, Serra B, Pingarrón JM, García JL, Díaz E. 2011. Unravelling the gallic acid degradation pathway in bacteria: the gal cluster from Pseudomonas putida. Mol Microbiol 79:359–374. doi: 10.1111/j.1365-2958.2010.07448.x. [DOI] [PubMed] [Google Scholar]
- 30.Collier LS, Nichols NN, Neidle EL. 1997. benK encodes a hydrophobic permease-like protein involved in benzoate degradation by Acinetobacter sp. strain ADP1. J Bacteriol 179:5943–5946. doi: 10.1128/jb.179.18.5943-5946.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wang SH, Xu Y, Liu SJ, Zhou NY. 2011. Conserved residues in the aromatic acid/H+ symporter family are important for benzoate uptake by NCgl2325 in Corynebacterium glutamicum. Int Biodeterior Biodegradation 65:527–532. doi: 10.1016/j.ibiod.2011.02.004. [DOI] [Google Scholar]
- 32.Choudhary A, Purohit H, Phale PS. 2017. Benzoate transport in Pseudomonas putida CSV86. FEMS Microbiol Lett 364:fnx118. doi: 10.1093/femsle/fnx118. [DOI] [PubMed] [Google Scholar]
- 33.Leveau JHJ, Zehnder AJB, van der Meer JR. 1998. The tfdK gene product facilitates uptake of 2,4-dichlorophenoxyacetate by Ralstonia eutropha JMP134(pJP4). J Bacteriol 180:2237–2243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ledger T, Aceituno F, González B. 2009. 3-Chlorobenzoate is taken up by a chromosomally encoded transport system in Cupriavidus necator JMP134. Microbiology 155:2757–2765. doi: 10.1099/mic.0.029207-0. [DOI] [PubMed] [Google Scholar]
- 35.Xu Y, Gao X, Wang SH, Liu H, Williams PA, Zhou NY. 2012. MhbT is a specific transporter for 3-hydroxybenzoate uptake by Gram-negative bacteria. Appl Environ Microbiol 78:6113–6120. doi: 10.1128/AEM.01511-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Xu Y, Wang SH, Chao HJ, Liu SJ, Zhou NY. 2012. Biochemical and molecular characterization of the gentisate transporter GenK in Corynebacterium glutamicum. PLoS One 7:e38701. doi: 10.1371/journal.pone.0038701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Chang HK, Zylstra GJ. 1999. Characterization of the phthalate permease OphD from Burkholderia cepacia ATCC 17616. J Bacteriol 181:6197–6199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Prieto MA, García JL. 1997. Identification of the 4-hydroxyphenylacetate transport gene of Escherichia coli W: construction of a highly sensitive cellular biosensor. FEBS Lett 414:293–297. doi: 10.1016/S0014-5793(97)01012-0. [DOI] [PubMed] [Google Scholar]
- 39.Otani H, Lee YE, Casabon I, Eltis LD. 2014. Characterization of p-hydroxycinnamate catabolism in a soil actinobacterium. J Bacteriol 196:4293–4303. doi: 10.1128/JB.02247-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Kallscheuer N, Vogt M, Kappelmann J, Krumbach K, Noack S, Bott M, Marienhagen J. 2016. Identification of the phd gene cluster responsible for phenylpropanoid utilization in Corynebacterium glutamicum. Appl Microbiol Biotechnol 100:1871–1881. doi: 10.1007/s00253-015-7165-1. [DOI] [PubMed] [Google Scholar]
- 41.Zhang H, Pereira B, Li Z, Stephanopoulos G. 2015. Engineering Escherichia coli coculture systems for the production of biochemical products. Proc Natl Acad Sci U S A 112:8266–8271. doi: 10.1073/pnas.1506781112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Chen Z, Huang J, Wu Y, Wu W, Zhang Y, Liu D. 2017. Metabolic engineering of Corynebacterium glutamicum for the production of 3-hydroxypropionic acid from glucose and xylose. Metab Eng 39:151–158. doi: 10.1016/j.ymben.2016.11.009. [DOI] [PubMed] [Google Scholar]
- 43.Qi F, Zou L, Jiang X, Cai S, Zhang M, Zhao X, Huang J. 2017. Integration of heterologous 4-hydroxybenzoic acid transport proteins in Rhodobacter sphaeroides for enhancement of coenzyme Q10 production. RSC Adv 7:17346–17352. doi: 10.1039/C7RA02346D. [DOI] [Google Scholar]
- 44.Wu W, Liu F, Singh S. 2018. Toward engineering E. coli with an autoregulatory system for lignin valorization. Proc Natl Acad Sci U S A 115:2970–2975. doi: 10.1073/pnas.1720129115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Perera IC, Grove A. 2010. Molecular mechanisms of ligand-mediated attenuation of DNA binding by MarR family transcriptional regulators. J Mol Cell Biol 2:243–254. doi: 10.1093/jmcb/mjq021. [DOI] [PubMed] [Google Scholar]
- 46.Yamaguchi A, Someya Y, Sawai T. 1992. Metal-tetracycline/H+ antiporter of Escherichia coli encoded by transposon Tn10. The role of a conserved sequence motif, GXXXXRXGRR, in a putative cytoplasmic loop between helices 2 and 3. J Biol Chem 267:19155–19162. [PubMed] [Google Scholar]
- 47.Ditty JL, Harwood CS. 1999. Conserved cytoplasmic loops are important for both the transport and chemotaxis functions of PcaK, a protein from Pseudomonas putida with 12 membrane-spanning regions. J Bacteriol 181:5068–5074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Jessen-Marshall AE, Parker NJ, Brooker RJ. 1997. Suppressor analysis of mutations in the loop 2-3 motif of lactose permease: evidence that glycine-64 is an important residue for conformational changes. J Bacteriol 179:2616–2622. doi: 10.1128/jb.179.8.2616-2622.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Jessen-Marshall AE, Paul NJ, Brooker RJ. 1995. The conserved motif, GXXX(D/E)(R/K)XG[X](R/K)(R/K), in hydrophilic loop 2/3 of the lactose permease. J Biol Chem 270:16251–16257. doi: 10.1074/jbc.270.27.16251. [DOI] [PubMed] [Google Scholar]
- 50.Ditty JL, Harwood CS. 2002. Charged amino acids conserved in the aromatic acid/H+ symporter family of permeases are required for 4-hydroxybenzoate transport by PcaK from Pseudomonas putida. J Bacteriol 184:1444–1448. doi: 10.1128/JB.184.5.1444-1448.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Kasai D, Kamimura N, Tani K, Umeda S, Abe T, Fukuda M, Masai E. 2012. Characterization of FerC, a MarR-type transcriptional regulator, involved in transcriptional regulation of the ferulate catabolic operon in Sphingobium sp. strain SYK-6. FEMS Microbiol Lett 332:68–75. doi: 10.1111/j.1574-6968.2012.02576.x. [DOI] [PubMed] [Google Scholar]
- 52.Peng X, Egashira T, Hanashiro K, Masai E, Nishikawa S, Katayama Y, Kimbara K, Fukuda M. 1998. Cloning of a Sphingomonas paucimobilis SYK-6 gene encoding a novel oxygenase that cleaves lignin-related biphenyl and characterization of the enzyme. Appl Environ Microbiol 64:2520–2527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden TL. 2008. NCBI BLAST: a better web interface. Nucleic Acids Res 36:W5–W9. doi: 10.1093/nar/gkn201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Rice P, Longden I, Bleasby A. 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 16:276–277. doi: 10.1016/S0168-9525(00)02024-2. [DOI] [PubMed] [Google Scholar]
- 55.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
- 56.Krogh A, Larsson B, von Heijne G, Sonnhammer EL. 2001. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305:567–580. doi: 10.1006/jmbi.2000.4315. [DOI] [PubMed] [Google Scholar]
- 57.Ditta G, Stanfield S, Corbin D, Helinski DR. 1980. Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci U S A 77:7347–7351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Kaczmarczyk A, Vorholt JA, Francez-Charlot A. 2012. Markerless gene deletion system for sphingomonads. Appl Environ Microbiol 78:3774–3777. doi: 10.1128/AEM.07347-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Masai E, Shinohara S, Hara H, Nishikawa S, Katayama Y, Fukuda M. 1999. Genetic and biochemical characterization of a 2-pyrone-4,6-dicarboxylic acid hydrolase involved in the protocatechuate 4,5-cleavage pathway of Sphingomonas paucimobilis SYK-6. J Bacteriol 181:55–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Sato Y, Moriuchi H, Hishiyama S, Otsuka Y, Oshima K, Kasai D, Nakamura M, Ohara S, Katayama Y, Fukuda M, Masai E. 2009. Identification of three alcohol dehydrogenase genes involved in the stereospecific catabolism of arylglycerol-β-aryl ether by Sphingobium sp. strain SYK-6. Appl Environ Microbiol 75:5195–5201. doi: 10.1128/AEM.00880-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Abe T, Masai E, Miyauchi K, Katayama Y, Fukuda M. 2005. A tetrahydrofolate-dependent O-demethylase, LigM, is crucial for catabolism of vanillate and syringate in Sphingomonas paucimobilis SYK-6. J Bacteriol 187:2030–2037. doi: 10.1128/JB.187.6.2030-2037.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Masai E, Sasaki M, Minakawa Y, Abe T, Sonoki T, Miyauchi K, Katayama Y, Fukuda M. 2004. A novel tetrahydrofolate-dependent O-demethylase gene is essential for growth of Sphingomonas paucimobilis SYK-6 with syringate. J Bacteriol 186:2757–2765. doi: 10.1128/JB.186.9.2757-2765.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Kamimura N, Takamura K, Hara H, Kasai D, Natsume R, Senda T, Katayama Y, Fukuda M, Masai E. 2010. Regulatory system of the protocatechuate 4,5-cleavage pathway genes essential for lignin downstream catabolism. J Bacteriol 192:3394–3405. doi: 10.1128/JB.00215-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Zhang X, Bremer H. 1995. Control of the Escherichia coli rrnB P1 promoter strength by ppGpp. J Biol Chem 270:11181–11189. doi: 10.1074/jbc.270.19.11181. [DOI] [PubMed] [Google Scholar]
- 65.Miller JH. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
- 66.Senoo K, Wada H. 1989. Isolation and identification of an aerobic γ-HCH-decomposing bacterium from soil. Soil Sci Plant Nutr 35:79–87. doi: 10.1080/00380768.1989.10434739. [DOI] [Google Scholar]
- 67.Bolivar F, Backman K. 1979. Plasmids of Escherichia coli as cloning vectors. Methods Enzymol 68:245–267. doi: 10.1016/0076-6879(79)68018-7. [DOI] [PubMed] [Google Scholar]
- 68.Figurski DH, Helinski DR. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A 76:1648–1652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69–73. doi: 10.1016/0378-1119(94)90324-7. [DOI] [PubMed] [Google Scholar]
- 70.Blatny JM, Brautaset T, Winther-Larsen HC, Karunakaran P, Valla S. 1997. Improved broad-host-range RK2 vectors useful for high and low regulated gene expression levels in Gram-negative bacteria. Plasmid 38:35–51. doi: 10.1006/plas.1997.1294. [DOI] [PubMed] [Google Scholar]
- 71.Silva-Rocha R, Martínez-García E, Calles B, Chavarría M, Arce-Rodríguez A, de las Heras A, Páez-Espino AD, Durante-Rodríguez G, Kim J, Nikel PI, Platero R, de Lorenzo V. 2013. The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Res 41:D666–D675. doi: 10.1093/nar/gks1119. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








