Skip to main content
BMC Research Notes logoLink to BMC Research Notes
. 2018 Oct 12;11:725. doi: 10.1186/s13104-018-3839-y

Genetic diversity and chemical variability of Lippia spp. (Verbenaceae)

Milene C Almeida 1, Ediedia S Pina 1, Camila Hernandes 2, Sonia M Zingaretti 1, Silvia H Taleb-Contini 1, Fátima R G Salimena 3, Svetoslav N Slavov 4, Simone K Haddad 4, Suzelei C França 1, Ana M S Pereira 1, Bianca W Bertoni 1,
PMCID: PMC6186075  PMID: 30314442

Abstract

Background

The genus Lippia comprises 150 species, most of which have interesting medicinal properties. Lippia sidoides (syn. L. origanoides) exhibits strong antimicrobial activity and is included in the phytotherapy program implemented by the Brazilian Ministry of Health. Since species of Lippia are morphologically very similar, conventional taxonomic methods are sometimes insufficient for the unambiguous identification of plant material that is required for the production of certified phytomedicines. Therefore, genetic and chemical analysis with chemotype identification will contribute to a better characterization of Lippia species.

Methods

Amplified Length Polymorphism and Internal Transcribed Spacer molecular markers were applied to determine the plants’ genetic variability, and the chemical variability of Lippia spp. was determined by essential oil composition.

Results

Amplified Length Polymorphism markers were efficient in demonstrating the intra and inter-specific genetic variability of the genus and in separating the species L. alba, L. lupulina and L. origanoides into distinct groups. Phylogenetic analysis using Amplified Length Polymorphism and markers produced similar results and confirmed that L. alba and L. lupulina shared a common ancestor that differ from L. origanoides. Carvacrol, endo-fenchol and thymol were the most relevant chemical descriptors.

Conclusion

Based on the phylogenetic analysis it is proposed that L. grata should be grouped within L. origanoides due to its significant genetic similarity. Although Amplified Length Polymorphism and Internal Transcribed Spacer markers enabled the differentiation of individuals, the genotype selection for the production of certified phytomedicines must also consider the chemotype classification that reflects their real medicinal properties.

Electronic supplementary material

The online version of this article (10.1186/s13104-018-3839-y) contains supplementary material, which is available to authorized users.

Keywords: Lippia origanoides, Phytomedicine, AFLP, ITS2, CG/MS, Phylogenetic relationships

Background

The genus Lippia comprises 150 species, most of which are distributed in the Neotropical ecozone [1]. Brazil stands out as the centre of diversity of the genus with 98 species presenting high degrees of endemism. More than half of these species are concentrated in the Espinhaço Range, which stretches 1000 km through the Brazilian states of Minas Gerais and Bahia [2]. However, 18 species are considered rare or endangered, and nine are under threat of extinction due to the destruction of their natural environments in the Cerrado region (Brazilian type of Savana) [3].

The Brazilian Ministry of Health has developed an extensive phytotherapy program over the last decade with the aim of providing access to herbal medicines for the entire population. One of the target species of this program is Lippia sidoides Cham. (syn. L. origanoides) (Verbenaceae), a plant that was included in the Formulário de Fitoterápicos da Farmacopéia Brasileira [4, 5] based on its strong antimicrobial activity, against Candida albicans [6, 7], Staphylococcus aureus, and Escherichia coli [8] were included due to the presence of terpenoids in the essential oil. It is well known that terpenoids are produced as part of the plant defense system and have been considered a promising source of biological compounds [912]. Several essential oil compounds such as linalool, eugenol, carvone, vanillin, carvacrol, and thymol have been accepted by the European Commission to be used in food preservation or flavorings [13].

The morphological similarities between this and other species within the genus tend to complicate the accurate botanical identification, leading to difficulties in the production of certified herbal medicines.

Based on the differential morphological characteristics, the genus Lippia was classified in seven sections [14]. The Zapania Schauer section is the most complex and exhibits inflorescences with flat bracts, spirally arranged, globose or hemispheric type, capituliform, with varying numbers of chromosomes (2n = 10–28). L. alba (Mill.) N.E.Br., L. aristata Schauer, L. brasiliensis (Link) T.R.S. Silva, L. corymbosa Cham., L. diamantinensis Glaz., L. duartei Moldenke, L. filifolia Mart. & Schauer, L. hermannioides Cham., L. lacunosa Mart. & Schauer, L. rotundifolia Cham. and L. rubella (Moldenke) T.R.S. Silva & Salimena [15, 16] are among the representatives of this section in the Brazilian flora.

The Goniostachyum Schauer section presents tetrastic inflorescences formed by four series of keeled bracts aligned in rows. This section is considered monophyletic and is characterized by small variations (2n = 12) in the number of chromosomes [15, 17]. A recent revision of the species belonging to Goniostachyum resulted in the validation of only four representatives, namely: L. grata Schauer, L. origanoides Kunth, L. sericea Cham. and L. stachyoides Cham. [17]. Thus, some nominations of species or varieties must be considered synonyms of L. origanoides including, amongst others, L. sidoides, L. graveolens Kunth, L. microphylla Cham., L. salviifolia Cham., L. velutina Schauer, and Lantana origanoides Martens & Galeotti. Additionally, L. dumetorum Herzog, L. gracilis Schauer ex DC, L. hickenii Tronc., L. laxibracteata Herzog, and others have received the synonym L. grata. [17]. The Rhodolippia Schauer section comprises species with numbers of chromosomes that are intermediate between those of sections Zapania and Goniostachyum [15, 18], including L. bradei Moldenke, L. felippei Moldenke, L. florida Cham., L. hederaefolia Mart. & Schauer, L. lupulina Cham., L. pseudothea Schauer, L. rhodocnemis Mart. & Schauer, and L. rosella Moldenke.

However, the taxonomic classification of Lippia remains incoherent mainly due to the morphological variability within the genus and the existence of a great number of nomenclatures for this species resulting in classification dualism, both of which can be explained if we consider the interaction between the genotype and the environment [19]. In this context, studies aimed at evaluating the genetic structure of the genus through analysis of molecular markers could be useful in classifying species into clusters according to their genetic similarities.

A number of reports confirm that the association of molecular markers such as amplified fragment length polymorphism (AFLP) and internal transcribed spacer 2 (ITS2) can contribute significantly to the analysis of genetic variability and phylogenetic inferences [20, 21].

Besides molecular markers, chemical markers can also be used to help the correct plant characterization. WinK [22] developed a phylogenetic classification based on the secondary metabolites produced by Fabaceae, Solanaceae and Lamiacea families. The author considered that the ability or inability to produce a specific metabolite—shown by different members of related phylogenetic groups, are the result of differential expression patterns that reflect specific plant strategies for adaptation that were incorporated into the phylogenetic structure.

Therefore, the aim of the present study was to assess the genetic and chemical variability of species of Lippia spp. using molecular and chemical markers, to draw inferences regarding the phylogenetic relationships within the genus, and to identify inconsistencies in the current taxonomic classification for the correct use of those plants in phytomedicine.

Methods

Plant materials, DNA extractions, PCR amplifications and sequencing

We used 141 accessions (Table 1) comprising six Lippia species; although L. sidoides and L. origanoides are synonymous, they were considered, for the purposes of this study, as they were classified. Thirty-seven of these accessions were from the medicinal plants germplasm bank (Ribeirão Preto University, Brazil) and 104 were collected in the medicinal botanical garden of Nature Pharmacy, Brazil, with voucher numbers; 1340; 1350;1351; 1353; 1355; 1359; 1360; 1362–1365; 1368–1376; 1378–1380; 2000–2015; 2017–2112; 2114; 2471; 2473–2475. Sampling permission, for both locations, were obtained from by the Brazilian Council for the Administration and Management of Genetic Patrimony (CGEN) of the Brazilian Ministry of the Environment (MMA) by the National Council for Scientific and Technological Development (CNPq—CGEN/MMA Process #: 02001.005059/2011-71). Fátima R. G. Salimena (Juiz de Fora Federal University, Brazil) identified all samples. Total genomic DNA was extracted from 0.15 g of frozen leaves using the cetyltrimethylammonium bromide (CTAB) method [23]. The DNA integrity was determined by electrophoresis on 0.8% agarose gels and the concentration and quality of the isolated nucleic acid was determined by a NanoPhotometer® P360 spectrophotometer (Inplen, Westlake Village, CA, USA).

Table 1.

Location, Geographical coordinates and voucher number of Lippia species

Individual Taxonomic identification Location (State) Geographical coordinates Voucher
LT1 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2000
LT2 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2001
LT3 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2002
LT4 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2003
LT5 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2007
LT6 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2004
LT7 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2005
LT8 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2006
LT9 L. grata Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2097
LT10 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2077
LT11 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2008
LT12 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2009
LT13 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2010
LT14 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2011
LT15 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2012
LT16 L. grata Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2098
LT18 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2013
LT19 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2014
LT20 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2015
LT23 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2078
LT24 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2079
LT26 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2017
LT27 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2018
LT30 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2019
LT31 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2020
LT32 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2021
LT33 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2022
LT34 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2023
LT35 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2024
LT36 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2025
LT38 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2026
LT40 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2080
LT42 L. velutina Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2096
LT43 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2027
LT44 L. grata Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2099
LT45 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2028
LT46 L. velutina Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2095
LT47 L. grata Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2100
LT48 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2029
LT49 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 2030
LT50 L. origanoides Minas Gerais 3 19°82′02.2″–43°91′96.9″ 589 m 2031
LT51 L. orig. × velut. Minas Gerais 3 19°82′02.2″–43°91′96.9″ 589 m 2081
LT52 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2032
LT53 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2033
LT54 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2082
LT55 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2034
LT57 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2035
LT59 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2036
LT60 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2037
LT61 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2038
LT63 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2083
LT64 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2039
LT65 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2040
LT66 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2041
LT67 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2042
LT68 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2084
LT69 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2085
LT70 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2043
LT71 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2044
LT72 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2045
LT73 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2046
LT75 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2047
LT76 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2048
LT77 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2086
LT78 L. velutina Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2094
LT79 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2087
LT80 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2049
LT81 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2050
LT82 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2051
LT83 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2052
LT86 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2088
LT87 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2053
LT88 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2089
LT89 L. velutina Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2093
LT90 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2054
LT91 L. orig. × velut. Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2090
LT92 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2055
LT93 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2056
LT94 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2057
LT96 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2058
LT97 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2059
LT98 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2060
LT99 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2061
LT100 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2062
LT101 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2063
LT102 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2064
LT103 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2065
LT104 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2066
LT105 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2067
LT107 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2068
LT108 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2069
LT109 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2070
LT110 L. origanoides Bahia 2 10°33′38.1″–40°16′37.7″ 489 m 2071
LT111 L. origanoides Bahia 3 11°11′ 25.5″–39°25′39.5″ 344 m 2072
LT112 L. origanoides Bahia 3 11°11′ 25.5″–39°25′39.5″ 344 m 2073
LT113 L. origanoides Bahia 3 11°11′ 25.5″–39°25′39.5″ 344 m 2075
LT114 L. origanoides Bahia 3 11°11′ 25.5″–39°25′39.5″ 344 m 2074
LT115 L. origanoides Bahia 3 11°11′ 25.5″–39°25′39.5″ 344 m 2076
LT116 L. orig. × velut. São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2091
LT117 L. orig. × velut. São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2092
LT118 L. origanoides Minas Gerais 1 19°36′49.9″–42°08′20.8″ 929 m 2110
LT120 L. alba São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2101
LT121 L. alba São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2102
LT122 L. alba São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2103
LT123 L. alba São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2104
LT124 L. alba São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2105
LT125 L. alba São Paulo 21°11′55.5″–47°44′08.8″ 566 m 2106
LT126 L. alba Minas Gerais 2 19°51′37.3″–47° 20 27.9″1069 m 2106
LT127 L. alba Minas Gerais 1 19°36′49.9″–42°08′20.8″ 929 m 2108
LT128 L. alba Minas Gerais 1 19°36′49.9″–42°08′20.8″ 929 m 2109
LU129 L. orig. × velut. Bahia 4 10°31′14.8″–40°13′57.7″ 594 m 1364
LU130 L. orig. × velut. Bahia 5 10°50′48.1″–39°35′45.0″ 358 m 1380
LU132 L. orig. × velut. Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1350
LU133 L. orig. × velut. Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1351
LU134 L. origanoides Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1353
LU135 L. origanoides Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1355
LU137 L. origanoides Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1359
LU138 L. origanoides Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1360
LU140 L. origanoides Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1362
LU141 L. origanoides Bahia 3 11°11′25.5″–39°25′39.5″ 344 m 1363
LU142 L. grata Bahia 6 11°11′25.5″–39°25′39.5″ 344 m 2475
LU143 L. grata Bahia 6 11°11′25.5″–39°25′39.5″ 344 m 2474
LU144 L. grata Bahia 6 11°11′25.5″–39°25′39.5″ 344 m 2473
LU145 L. velutina Ceará 1 03°69′79.3″–38°57′35.1″ 005 m 2111
LU146 L. velutina Ceará 1 03°69′79.3″–38°57′35.1″ 005 m 2112
LU148 L. velutina Ceará 1 03°69′79.3″–38°57′35.1″ 005 m 2114
LU150 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1365
LU151 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1366
LU153 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1368
LU154 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1369
LU155 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1370
LU156 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1371
LU157 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1372
LU158 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1373
LU159 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1374
LU160 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1375
LU161 L. origanoides Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1376
LU162 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1378
LU163 L. orig. × velut. Bahia 1 11°42′31.9″–39°31′10.5″ 222 m 1379
LU164 L. grata Ceará 2 03°80′41.1″–08°45′60.7″ 014 m 2471
LU165 L. lupulina Minas Gerais 2 19°51′37.3″–47°20′27.9″1069 m 1340

Location: Bahia 1: Riachão do Jacuípe; Bahia 2: Campo Formoso; Bahia 3: Santa Luz; Bahia 4: Missão; do Sahy; Bahia 5: Queimadas; Bahia 6: Contagem; Ceará 1: Quatro Varas; Ceará 2: Orto Fortaleza; Minas Gerais 1: Araxá; Minas Gerais 2: Sacramento; Minas Gerais 3: Mateus Leme; São Paulo: Jardinópolis

Reactions and analysis of AFLP data

Samples from all 141 genotypes were analyzed according to the method of Vos et al. [24]. Briefly, genomic DNA (300 ng) was digested with EcoRI/MseI enzymes (New England Biolabs, Ipswich, MA, US) at 37 °C for 3 h, followed by inactivation at 70 °C for 5 min. Resulting DNA fragments were ligated to adaptors complementary to the restriction enzymes recognition sites and the ligation products were then diluted 6× with deionized water. In the first round of polymerase chain reaction (PCR), pre-selective amplification was achieved with primers EcoRI + 1 (50 µM) and MseI + 1 (50 µM). The pre-selective products were diluted 10× with deionized water and a second round of PCR was carried out using marker primers fluorescently tagged with IRDye® (LI-COR Biosciences, Lincoln, NE, USA). The selected marked primers were those that generated the largest number of polymorphic bands. Genotyping of individuals was performed using a 4300 DNA Analyzer (LI-COR Biosciences, Lincoln, NE, USA) while data alignment was accomplished with the aid of SagaMX Automated AFLP Analysis software version 3.3 guided by molecular weight markers in the range 50–700 bp. A binary matrix was constructed based on a 1/0 score for the presence/absence of each electrophoretic band. The genetic distance was calculated from the binary matrix using Jaccard indices, whereas the dendrogram was constructed using the unweighted pair group method with arithmetic average (UPGMA) clustering technique with 1000 permutations and Free Tree software version 0.9.1.50 [25] and visualized through TreeView X program [26]. The genetic structure of genotypes was established by principal coordinates analysis (PCoA) using the software GenAlEx version 6.5 [27] and STRUCTURE version 2.2.4 [28], which generated a posterior distribution based on Bayesian and admixture models. Each analysis comprised a “burn-in” of 200,000 interactions followed by a run length of 500,000 interactions and five independent runs for each K value (K = 1 to 7). The most probable number of genetic groups was determined from the ΔK value [29]. The correlation between genetic and geographical data was performed using the Mantel test and the POPGENE 32 [30] and GENES version 2009.7.0 [31] programs with 1000 simulations.

Sequencing and phylogenetic analysis of the ITS2 gene

The primers employed in the amplification reactions ITS2F-5′AATTGCAGAATCCCGTGAAC3′ and ITS2R-5′GGTAATCCCGCCTGACCT3′ were designed based on ITS2 sequences of some Verbenaceae species from the GenBank database at the National Center for Biotechnology Information (NCBI), namely Aloysia gratissima (DQ463782.1), A. gratissima var. schulziae (AY178651.1), A. triphylla (EU761080.1), Lippia alba (EU761076.1), L. alba (EU761078.1), L. salsa (FJ867399.1), and Phyla dulcis (EU761079.1). Polymerase chain reaction was performed as described by Chen et al. [32] and the resulting amplified fragments were sequenced using a Thermo Sequenase™ Cycle Sequencing kit (Affymetrix, Inc, Cleveland, USA), following manufacturer recommendations, with e-Seq™ DNA Sequencing version 3.1 (LI-COR Biosciences). Consensus sequences were assembled with the aid of LI-COR Biosciences AlignIR software (version 2.1) and aligned with ClustalW. The sequence alignments were edited using the BioEdit software (version 7.2) [33]. Phylogenetic trees were inferred by the NJ method based on the Kimura-2 parameter using PHYLIP software version 3.69 [34]. The alignment quality of the final phylogenetic tree was verified by the presence of saturation of the nucleotide substitutions, and sequences exhibiting high genetic similarity were excluded from the phylogenetic analysis using DAMBE software version 4.0.36 [35]. Thirty-three sequences of the ITS2 region deposited in the NCBI GenBank were selected as references (Table 2).

Table 2.

Accession number for ITS2 references of region from NCBI and used code

Species Codea Accession number
Lantana micrantha Lamicr HM120854.1
Lantana angustifolia Laangu HM120857.1
Lantana scabrida Lascab HM120860.1
Lantana camara Lacama AF437858.1
Lantana sp. LaspX1 EF190037.1
Lantana strigocamara Lastri FJ004800.1
Lantana hodgei Lahodg HM120851.1
Lantana strigocamara LastrA HM120861.1
Glandularia subincana Glsubi FJ867442.1
Glandularia gooddingii var. gooddingii Glgvgo FJ867437.1
Glandularia guaranitica Glguar FJ867434.1
Glandularia mendocina Glmend FJ867421.1
Glandularia dissecta Gldiss FJ867419.1
Glandularia aristigera Glaris FJ867424.1
Glandularia cheitmaniana Glchei FJ867444.1
Glandularia bipinnatifida Glbipi JN686504.1
Glandularia chiricahensis Glchir FJ867436.1
Glandularia gooddingii var. nepetifolia Glgvne FJ867439.1
Glandularia wrightii Glwrig AY928525.1
Glandularia aurantiaca Glaura FJ867427.1
Glandularia bipinnatifida GlbipT Fj867440.1
Glandularia araucana Glarau FJ867429.1
Glandularia microphulla Glmicr FJ867432.1
Junellia micrantha Jumicr FJ867462.1
Junellia caespitosa Jucaes FJ867466.1
Junellia selaginoides Jusela FJ867463.1
Junellia aspera var. longidentata Juavlo FJ867460.1
Junellia spathulata Juspat FJ867456.1
Junellia ligustima var. lorentzii Julvlo FJ867568.1
Junellia uniflora Juunif FJ867450.1
Junellia asparagoides Juaspa FJ867458.1
Junellia aspera Juaspe FJ867459.1
Phyla canensis HM193969.1

aCode used in the phylogenetic tree

Extraction and analysis of essential oils

The essential oils of L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata were extracted from dried leaves and flowers by steam distillation in a Clevenger apparatus. A mixture of essential oil/ethyl acetate (v/4v) was analysed using gas chromatograph Varian, model 3900 (Palo Alto, CA, USA), coupled with a Saturn 2100T ion trap mass selective detector and equipped with a non-polar DB-5 fused silica capillary column (30 m × 0.25 mm i.d.; 0.25 μm). The analytical conditions were: carrier gas helium at 1 mL/min; oven temperature 60 to 240 °C at 3 °C/min; injector temperature 240 °C; detector temperature 230 °C; injector split ratio 1:20; injection volume 1 μL; ionization voltage 70 eV. Individual components of oil samples were identified from their Kovats retention indices [36] and by comparison of their electron impact spectra with entries in the NIST62 mass spectral library embedded in the GC/MS system. Data were submitted for principal component analysis (PCA) using the program GENES version 2009.7.0 [31] in order to determine which of the chemical descriptors contributed most to the variability.

Results

Analysis based on AFLP markers

The set of six primers selected for AFLP analysis of the 141 genotypes amplified 273 loci, of which 267 (97.8%) were polymorphic (Table 3). The dendrogram constructed from these amplified loci (Fig. 1) enabled the 141 genotypes to be discriminated into three distinct genotypic groups, namely group 1 (L. alba), group 2 (L. lupulina) and group 3 (L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata). Interestingly, L. alba appeared to be more closely related to L. lupulina (boostrap 100%) than to L. origanoides.

Table 3.

Sequences of selected primers IRDye 700/800 and number of amplified fragments

Primer Fragments total Polymorphic fragments (%) polymorphic fragments
IRDye 700
 E-AAT-M-AGG 45 44 97.8
 E-AAT-M-TC 45 45 100
 E-ATG-M-TCG 50 50 100
IRDye 800
 E-AGA-M-AT 17 16 94.1
 E-AGA-M-TA 70 68 97.1
 E-AG-M-TTC 46 44 95.6
Total 273 267 97.8%

Fig. 1.

Fig. 1

UPGMA dendrogram constructed using data obtained AFLP polymorphic markers (1000 permutations). Individuals featured: Black circle: L. grata (LT9, LT16, LT44, LT47, LU142, LU143, LU144); white circle: L. salvifolia (LT118); black small circle: L. sidoides (LT116; LT117); lozenge: L. velutina (LT42, LT46, LT78, LT89, LU145, LU146, LU148)

The cluster formed by group 3 indicated the absence of significant differentiation between L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata. However, only 29% of the hybrid individuals clustered together, whereas 71% assembled with other species. Furthermore, only 37.5% of L. grata individuals clustered together, while 62.5% clustered with other species, demonstrating the occurrence of intra- and inter-specific similarities in Lippia.

The results generated by PCoA analysis also revealed three groups (Fig. 2), but the Bayesian approach using the STRUCTURE software indicated that the genotypes could be organized into two main groups (K = 2), suggesting that L. lupulina (group 1) occupied an intermediate position between groups 1 and 3 (Fig. 3).

Fig. 2.

Fig. 2

Population structure as determined by principal coordinates analysis (PCoA) of 141 individuals of Lippia spp. Group 1—(Alb) L. alba; Group 2—(Lup) L. lupulina; Group 3—(Lor) L. origanoides, (Orv) L. origanoides × velutina, (Lv) L. velutina, (Sid) L. sidoides, (Sal) L. salviifolia and (Lgr) L. grata

Fig. 3.

Fig. 3

Population structure as determined by Bayesian analysis of 141 individuals genotypes of Lippia spp. Individual genotypes are represented by columns while the clusters (K = 2) are represented by the colors green and red. Two colors shown for the same individual indicate the percentages of the genome shared between the two groups

The measure of shared variance between the genetic and geographic variables for individuals in group 3 showed a significant positive correlation (r = 0.80; p = 0.46), while the isolation by distance showed the existence of gene flow across group 3 (Nm = 1.6), although gene flow between groups 1 and 3 was lower (Nm = 1.3).

Analysis based on ITS2 genotyping

Primers ITS2F and ITS2R amplified DNA fragments of approximately 340 bp. The saturation test revealed that the ITS2 region presents significant genetic variability among the Lippia spp.

The Neighbor-Joining (NJ) of the phylogenetic tree was rooted using the Phyla canescens species identified in France (Fig. 4: Table 4). The use of a outgroup species from a different geographic location favors a more robust separation of the tree branches confirming the separation of the phylogenetic groups.

Fig. 4.

Fig. 4

Evolutionary relationships between Lippia individuals generated from NJ analysis of ITS2 sequences (Kimura-2 model: PHYLIP software version 3.69). Reference sequences (see Table 2): Lamicr, Laangu, Lascab, Lacama, LaspX1, Lastri, Lahodg, LastrA, Glsubi, Glgvgo, Glguar, Glmend, Gldiss, Glaris, Glchei, Glbipi, Glchir, Glgvne, Glwrig, Glaura, GlbipT, Glarau, Glmicr, Jumicr, Jucaes, Jusela, Juavlo, Juspat, Julvlo, Juunif, Juaspa, Juaspe, Phylla canensis. Samples grouped by high genetic similarity: L2, L3, L4, L9, L11, L69, L118, L120, L129, L142 (see Table 4). Capital letters adjacent to code numbers 142 and 144 refer to the amplified bands of 340 bp (A) and 360 bp (B)

Table 4.

Lippia individual grouped by genetic similarity (ITS2) by DAMBE program version 4.0.36

Individuals with high genetic similarity Codea
LT2, LT31, LT34, LT36: L. origanoides
LT47: L. grata
LU156: L. orig. × velut.
L2
LT3, LT6, LT45: L. origanoides L3
LT4, LT26, LT52, LT73: L. origanoides
LT116: L. orig. × velut.
L4
LT7, LT20, LT27, LT32, LT55, LT57, LT60, LT61, LT65, LT66, LT70, LT71, LT75, LT80, LT82, LT87, LT94, LT97, LT98, LT100, LT105, LT107, LT108, LT109, LU137: L. origanoides
LT10, LT68, LT77, LT79,
LT63, LT117, LU130, LU151, LU153, LU158: L. orig. × velut.
LT42, LT78: L. velutina
L7
LT9: L. grata
LT23: L. orig. × velut.
LT90, LT92: L. origanoides
L9
LT1, LT11, LT12, LT15, LT24, LT30, LT35, LT43, LT48, LT49, LT64, LT67, LT72, LT104, LU141: L. origanoides
LT54, LU133: L. orig. × velut.
L11
LT14, LU155—L. origanoides L14
LT69, LU132: L. orig. × velut. L69
LT118, LU145, LU146: L. velutina
LU164: L. grata
L118
LT120, LT123, LT124, LT125, LT126, LT127: L. alba L120
LU129, LU159: L. orig. × velut. L129
LU142, LU143: L. grata L142
LU154, LU157: L. origanoides L154

aCode used in the phylogenetic tree

The phylogenetic analysis based on the species from the genus Lantana (A), Glandularia (B), Junellia (C), and Lippia (D) demonstrated separation of the three branches into four principal clusters with 83%, 93%, 85%, and 96% bootstrap, respectively. In the Lantana group, Lippia lupulina (L165) and Lippia alba (L120, L121, L122, L128), divided into subgroups with a bootstrap of 71% and 83%, respectively, were also identified. The group of Glandularia and Junellia was clearly subdivided into two groups: one belonging to the species of Glandularia and another to the Junellia subgroup.

Most of the analyzed species were separated within the Lippia group as a monophyletic group. Samples LU145 (L. velutina) and LT118 (L. salviifolia) were identical to the sample classified as L. grata (LU164). Furthermore, a sample classified as L. velutina (LT78) was identical to one of L. sidoides (LT117), as well as to samples of L. origanoides and L. origanoides × velutina. Additionally, a L. grata individual (LT47) was identical to one L. origanoides × velutina (LU156) and to some L. origanoides (LT2, LT31, LT34, LT36).

Principal Components Analysis (PCA) of essential oil profiles

The application of PCA analysis allowed individuals to be grouped according to their different chemical profiles and enabled the seven original chemical descriptors, namely carvacrol, endo-fenchol, thymol, β-caryophyllene, isoborneol, trans-caryophyllene, and bicyclogermacrene, to be reduced to the first three (Fig. 5). Endo-fenchol (PC1) and carvacrol (PC2) accounted for most of the total variation (86.36%), with the first and second components contributing factors of 0.69 and 0.17, respectively, while the contribution of thymol was minimal (only 0.063). Considering all the analyzed individuals, 72% contained carvacrol and 16% contained endo-fenchol; since no individuals contained both carvacrol and endo-fenchol, the quantification of these two components would cover 88% of the analyzed samples (Fig. 5).

Fig. 5.

Fig. 5

Principal component analysis of the chemical constituents of Lippia essential oil

Discussion

AFLP analysis

The employed AFLP technique distributed the 141 Lippia genotypes into three groups (Fig. 1) that were compatible with the existing taxonomic sections, namely Zapania (L. alba), Rhodolippia (L. lupulina) and Goniostachyum (L. origanoides, L. sidoides, L. salviifolia, L. origanoides × velutina, and L. grata) [16, 17]. The efficiency of dominant AFLP markers to regroup genetically similar species has been also demonstrated in a number of studies [3739], having been attributed to the large numbers of amplified loci that are generated [40]. Additionally, PCoA analysis (Fig. 2) confirmed the distribution of the studied genotypes into three groups, a separation likely related to the reduced gene flow between the groups [41] as demonstrated by the values of Nm (1.3–1.6) obtained for Lippia species.

However, Bayesian analysis performed using the program STRUCTURE identified only two genetic groups (K =2), demonstrating that L. lupulina shares 50% of the genome of each group (Fig. 3), for more detail see Additional file 1. This result corroborates the results of Campos et al., [18], which classified Rhodolippia section (Group 2) as an intermediary between Zapania (Group 1) and Goniostachyum (Group 3) sections.

A recent study by O’Leary et al. [17] grouped L. origanoides × velutina, L. velutina, L. sidoides, and L. salviifolia, but not L. grata, within L. origanoides. Our results showed that individuals classified as L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata formed a single group due to their strong genetic similarity, and therefore should be recognized as a single taxon to be named L. origanoides.

Nuclear ribosome ITS2

The results presented herein show that species in the genus Glandularia and Junellia may be considered genetically similar as were forming one group (Fig. 4), thus confirming former results [42]. Furthermore, the species used as an outgroup, Phyla canescens, showed clear genetic divergence from Lantana, Glandularia, Junellia and Lippia, even though the separation of these genus has been proposed based on increased morphological descriptors [43, 44].

Lippia alba and L. lupulina are closely related to members of the genus Lantana and, together, they can be considered sister-groups [4547], attesting the genetic similarity between the genera Lippia and Lantana [18, 48, 49].

Additionally, L. alba and L. lupulina exhibit longer branches in comparison with other Lippia species, suggesting that they underwent a more accelerated evolutionary rate and that they are older species [20, 43, 50].

The results of the phylogenetic analysis performed with ITS2 markers confirmed the results obtained with AFLP markers, suggesting the existence of only three species, namely L. alba, L. lupulina and L. origanoides. Of these, L. alba (section Zapania) can be considered the most divergent within the genus, whereas L. lupulina (section Rhodolippia) represents an intermediate between sections Zapania and Goniostachyum, for more detail see Additional files 2 and 3. In this aspect, the findings from the molecular-based analyses corroborate those based on cytogenetic and morphological characteristics [15, 16, 18].

Chemical markers

The PCA analysis of the terpenoid composition from L. origanoides L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia and L. grata showed no specific grouping by species (Fig. 5), suggesting that they are different chemotypes. Conversely, Sandasi et al. [51], when investigating the chemotaxonomic differentiation of South-African Lippia species, namely L. javanica, L. scaberrima, L. rehmannii and L. wilmsii, were able to separate the species into distinct clusters. These results, paired with AFPL and ITS, suggest that L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata belong to the same species, but present different chemotypes, for more detail see Additional file 4.

The chemotypes may be associated with the diverse biotic and abiotic stimuli to which each of the individuals had been subjected, which led to the creation of a complex biological system [52]. It is clear that nowadays the taxonomic identification of plants frequently rely on molecular biology techniques, especially when plants exhibit very similar morphological characters. In regards to medicinal plants, the use of chemical markers becomes essential if we consider that the biological activity can, most of the time, be related to a specific chemotype. Therefore, when any species is employed in the production of certified phytomedicines, the plant material must be identified taxonomically and the chemotype identified to assure the biological activity of the extract.

Conclusions

The molecular markers AFLP and ITS2 were efficient in separating L. alba and L. lupulina, and in grouping L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata. Moreover, the markers revealed the existence of intra- and inter-specific variability within the genus, as well as the close phylogenetic relationship between L. alba and L. lupulina. Since individuals grouped in L. origanoides exhibit morphological diversity and variability regarding the major constituents of the essential oils, the selection of genotypes for the production of certified phytomedicines must be based on the chemical profile of the oil produced.

Additional files

13104_2018_3839_MOESM1_ESM.xls (262.5KB, xls)

Additional file 1: Table S1. Binary data.

13104_2018_3839_MOESM2_ESM.docx (14.5KB, docx)

Additional file 2: Table S2. Accession number of ITS2 nucleotide sequence from GenBank database at the National Center for Biotechnology Information (NCBI), for all species used as reference.

13104_2018_3839_MOESM3_ESM.docx (17KB, docx)

Additional file 3: Table S3. Fasta Sequences of amplified ITS fragments for all samples.

13104_2018_3839_MOESM4_ESM.xls (37.5KB, xls)

Additional file 4: Table S4. Chemical data.

Authors’ contributions

Conceived and designed the experiments: AMSP BWB SMZ SCF. Performed the experiments: MCA ESP CH FRGS. Analyzed the data: BWB MCA SHTC SNS SKH. Taxonomic identification: FRGS. Contributed with reagents/materials/analysis tools SMZ AMSP SCF BWB. Wrote the paper: MCA SMZ AMSP BWB SNS. All authors read and approved the final manuscript.

Acknowledgements

The authors are grateful to Dr. Luciana Rossini Pinto from the Campinas Agriculture Institute (IAC) (Ribeirão Preto, SP, Brazil) for technical support with the LI-COR Biosciences 4300 DNA Analyzer.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article and its additional files.

Our data is available as Additional file 1: Table S1 Binary data, Additional file 2: Table S2 Chemical data, Additional file 3: Table S3 Genetic data and Additional file 4: Table S4 Accession number.

Consent to publish

Not applicable.

Ethics approval and consent to participate

Sampling permission, for both locations, were obtained from by the Brazilian Council for the Administration and Management of Genetic Patrimony (CGEN) of the Brazilian Ministry of the Environment (MMA) by the National Council for Scientific and Technological Development (CNPq—CGEN/MMA Process #: 02001.005059/2011-71).

Funding

Fundação de Pesquisa do Estado de São Paulo (FAPESP) (Process # 2011/11756-3).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Abbreviations

LT

individuals from the medicinal plants germplasm bank (Ribeirão Preto University, Brazil)

LU

individuals from medicinal botanical garden of Nature Pharmacy, Brazil

Contributor Information

Milene C. Almeida, Email: milene.far@hotmail.com

Ediedia S. Pina, Email: epina@unaerp.br

Camila Hernandes, Email: cahhernandes@gmail.com.

Sonia M. Zingaretti, Email: szingaretti@unaerp.br

Silvia H. Taleb-Contini, Email: scontini@unaerp.br

Fátima R. G. Salimena, Email: fatima.salimena@ufjf.edu.br

Svetoslav N. Slavov, Email: slavnslavov@gmail.com

Simone K. Haddad, Email: skashima@hemocentro.fmrp.usp.br

Suzelei C. França, Email: sfranca@unaerp.br

Ana M. S. Pereira, Email: apereira@unaerp.br

Bianca W. Bertoni, Email: bbertoni@unaerp.br

References

  • 1.Atkins S. Verbenaceae: the families and genera of flowering plants. Berlin: Springer; 2004. pp. 449–468. [Google Scholar]
  • 2.Salimena FRG, Kutschenco DC, Monteiro NP, Myssen C. Verbenaceae: Livro Vermelho da Flora do Brasil. Instituto de Pesquisas Jardim Botânico, Rio de Janeiro; 2013. http://cncflora.jbrj.gov.br/arquivos/arquivos/pdfs/LivroVervelho.pdf. Accessed 20 Sept 2014.
  • 3.Salimena F, França F, Silva TRS. VERBENACEAE: Plantas Raras do Brasil. Conservação Internacional, Belo Horizonte-MG; 2009. http://www.plantasraras.org.br/files/plantas_raras_do_brasil.pdf. Accessed 20 Sept 2014.
  • 4.Anvisa (Agência Nacional de Vigilância Sanitária). RDC nº 14 - Dispõe sobre o registro de medicamentos fitoterápicos; 2010. http://www.crfma.org.br/site/arquivos/legislacao/resolucoesinstrucoesnormativasdaanvisa/RDC%2014%202010.pdf. Accessed 20 Sept 2014.
  • 5.Anvisa (Agência Nacional de Vigilância Sanitária). Formulário de Fitoterápicos da Farmacopéia Brasileira, 1fst edition; 2011http://www.anvisa.gov.br/hotsite/farmacopeiabrasileira/conteudo/Formulario_de_Fitoterapicos_da_Farmacopeia_Brasileira.pdf. Accessed 20 Sept 2014.
  • 6.Botelho MA, Nogueira NAP, Bastos GM, Fonseca SGC, Lemos TLG, Matos FJA, et al. Antimicrobial activity of the essential oil from Lippia sidoides, carvacrol and thymol against oral pathogens. Braz J Med Biol Res. 2007;40:349–356. doi: 10.1590/S0100-879X2007000300010. [DOI] [PubMed] [Google Scholar]
  • 7.Fontenelle ROS, Morais SM, Brito EHS, Kerntopf MR, Brilhante RSN, Cordeiro RA, et al. Chemical composition, toxicological spects and antifungal activity of essential oil from Lippia sidoides Cham. J Antimicrob Chemother. 2007;59:934–940. doi: 10.1093/jac/dkm066. [DOI] [PubMed] [Google Scholar]
  • 8.Bertini LM, Pereira AF, Oliveira CLL, Menezes EA, Morais SM, Cunha FA, Cavalcanti ESB. Perfil de sensibilidade de bactérias frente a óleos essenciais de algumas plantas do nordeste do Brasil. Infarma. 2005;17:80–83. [Google Scholar]
  • 9.Almeida JRGS, Silva-Filho RN, Nunes XP, Dias CS, Pereira FO, Lima EO. Antimicrobial activity of the essential oil of Bowdichia virgilioides Kunt. Rev Bras Farmacogn. 2006;16:638–641. doi: 10.1590/S0102-695X2006000500009. [DOI] [Google Scholar]
  • 10.Arruda TA, Antunes RMP, Catão RMR, Lima EO, Sousa DP, Nunes XP, et al. Preliminary study of the antimicrobial activity of Mentha × villosa Hudson essential oil, rotundifolone and its analogues. Rev Bras Farmacogn. 2006;16:307–311. doi: 10.1590/S0102-695X2006000300005. [DOI] [Google Scholar]
  • 11.Benkeblia N. Antimicrobial activity of essential oil extracts of various onions (Allium cepa) and garlic (Allium sativum) LWT. 2005;37:263–268. doi: 10.1016/j.lwt.2003.09.001. [DOI] [Google Scholar]
  • 12.Nunes XP, Maia GLA, Almeida JRGS, Pereira FO, Lima EO. Antimicrobial activity of the essential oil of Sida cordifolia L. Rev Bras Farmacog. 2006;16:642–644. doi: 10.1590/S0102-695X2006000500010. [DOI] [Google Scholar]
  • 13.Hyldgaard M, Mygind T, Meyer RL. Essential oils in food preservation: mode of action, synergies, and interactions with food matrix components. Front Microbiol. 2012;3:1–24. doi: 10.3389/fmicb.2012.00012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Troncoso NS. Los géneros de Verbenaceae de Sudamérica extra tropical (Argentina, Chile, Bolivia, Uruguay & sur de Brasil) Darwiniana. 1974;18:295–412. [Google Scholar]
  • 15.Sanders RW. The genera of Verbenaceae in the southeastern United States. Harvard Papers in Botany. 2001;5:303–358. [Google Scholar]
  • 16.Viccini LF, Pierre PMO, Praça MM, Costa DCS, Romanel EC, Sousa SM, et al. Chromosome numbers in the genus Lippia (Verbenaceae) Pl Syst Evol. 2006;256:171–178. doi: 10.1007/s00606-005-0351-3. [DOI] [Google Scholar]
  • 17.O’Leary N, Denham SS, Salimena F, Múlgura ME. Species delimitation in Lippia section Goniostachyum (Verbenaceae) using the phylogenetic species concept. Bot J Linn Soc. 2012;170:197–219. doi: 10.1111/j.1095-8339.2012.01291.x. [DOI] [Google Scholar]
  • 18.Campos JMS, Souza SM, Silva PS, Pinheiro LC, Sampaio F, Viccini LF. Chromosome numbers and DNA C values in the genus Lippia (Verbenaceae) Plant Syst Evol. 2011;291:133–140. doi: 10.1007/s00606-010-0370-6. [DOI] [Google Scholar]
  • 19.Salimena FRG. Novos sinônimos e tipificações em Lippia sect. Rhodolippia (Verbenaceae) Darwiniana. 2002;40:121–125. [Google Scholar]
  • 20.Xu F, Sun M. Comparative analysis of phylogenetic relationships of grain amaranths and their wild relatives (Amaranthus; Amaranthaceae) using internal transcribed spacer, amplified fragment length polymorphism, and double-primer fluorescent intersimple sequence repeat markers. Mol Phylogenet Evol. 2001;21:372–387. doi: 10.1006/mpev.2001.1016. [DOI] [PubMed] [Google Scholar]
  • 21.Talavera M, Balao F, Casimiro-Soriguer R, Ortiz MA, Terrab A, Arista M, et al. Molecular phylogeny and systematics of the highly polymorphic Rumex bucephalophorus complex (Polygonaceae) Mol Phylogenet Evol. 2011;61:659–670. doi: 10.1016/j.ympev.2011.08.005. [DOI] [PubMed] [Google Scholar]
  • 22.Wink M. Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemistry. 2003;64:3–19. doi: 10.1016/S0031-9422(03)00300-5. [DOI] [PubMed] [Google Scholar]
  • 23.Doyle JJ, Doyle JL. Isolation of plant DNA from fresh tissue. Focus. 1987;12:13–15. [Google Scholar]
  • 24.Vos P, Hogers R, Bleeker M, Reijans M, Lee TV, Hornes M, et al. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 1995;23:4407–4414. doi: 10.1093/nar/23.21.4407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pavlícek A, Hrdá S, Flegr J. Free tree—freeware program for the construction of phylogenetic trees on the basis of distance data and Bootstrap/Jackknife analysis of the tree robustness. Application in the RAPD analysis of genus Frenkelia. Folia Biol (Praha) 1999;45:97–99. [PubMed] [Google Scholar]
  • 26.Page RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci. 1996;12:357–358. doi: 10.1093/bioinformatics/12.4.357. [DOI] [PubMed] [Google Scholar]
  • 27.Peakall R, Smouse PE. GenAIEx 65: genetic analysis in excel. Population genetic software for teaching and research—an update. Bioinformatics. 2012;28:2537–2539. doi: 10.1093/bioinformatics/bts460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–959. doi: 10.1093/genetics/155.2.945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 2005;14:2611–2620. doi: 10.1111/j.1365-294X.2005.02553.x. [DOI] [PubMed] [Google Scholar]
  • 30.Yeh FC, Yang R, Boyle T. POPGENE VERSION 1.31: Population Genetic Analysis. (Free access permitted by author); 1999. https://www.ualberta.ca/~fyeh/popgene.pdf. Accessed 15 Apr 2014.
  • 31.Cruz D. Programa GENES: biometria. Viçosa: UFV; 2006. p. 382. [Google Scholar]
  • 32.Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE. 2010;5:e-8613. doi: 10.1371/journal.pone.0008613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser J. 1999;41:95–98. [Google Scholar]
  • 34.Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x. [DOI] [PubMed] [Google Scholar]
  • 35.Xia X, Xie Z. DAMBE: software package for data analysis in molecular biology and evolution. J Hered. 2001;92:371–373. doi: 10.1093/jhered/92.4.371. [DOI] [PubMed] [Google Scholar]
  • 36.Adams RP. Identification of essential oil components by gas chromatography/mass spectroscopy. 4. Carol Stream: Allured Publishing Corporation; 2009. [Google Scholar]
  • 37.Cervera MT, Storme V, Soto A, Ivens B, Montagu MV, Rajora OP, et al. Intraspecific and interspecific genetic and phylogenetic relationships in the genus Populus based on AFLP markers. Theor Appl Genet. 2005;111:1440–1456. doi: 10.1007/s00122-005-0076-2. [DOI] [PubMed] [Google Scholar]
  • 38.De Riek J, De Cock K, Smulders MJM, Nybom H. AFLP-based population structure analysis as a means to validate the complex taxonomy of dogroses (Rosa section Caninae) Mol Phylogenet Evol. 2013;67:547–559. doi: 10.1016/j.ympev.2013.02.024. [DOI] [PubMed] [Google Scholar]
  • 39.Koopman WJM, Wissemann V, De Cock K, Van Huylenbroeck J, De Riek J, Sabatino GJH, et al. AFLP markers as a tool to reconstruct complex relationships: a case study in Rosa (Rosaceae) Am J Bot. 2008;95:353–366. doi: 10.3732/ajb.95.3.353. [DOI] [PubMed] [Google Scholar]
  • 40.El Rabey HA, Al-Malki AL, Abulnaja K, Kumosani TA, Khan JA. Efficiency of AFLP markers and seed storage protein electrophoresis to study the phylogeny of some Hordeum species. Spanish J Agr Res. 2013;11:814–819. doi: 10.5424/sjar/2013113-3935. [DOI] [Google Scholar]
  • 41.Jiménez-Mejías P, Escudero M, Guerra-Cárdenas S, Lye KA, Luceño M. Taxonomic delimitation and drivers of speciation in the Ibero-North African Carex sect. Phacocystis river-shore group (Cyperaceae) Am J Bot. 2011;98:1855–1867. doi: 10.3732/ajb.1100120. [DOI] [PubMed] [Google Scholar]
  • 42.Yuan YW, Olmstead RG. A species-level phylogenetic study of the Verbena complex (Verbenaceae) indicates two independent intergeneric chloroplast transfers. Mol Phylogenet Evol. 2008;48:23–33. doi: 10.1016/j.ympev.2008.04.004. [DOI] [PubMed] [Google Scholar]
  • 43.Steane DA, Scotland RW, Mabberley DJ, Wagstaff SJ, Reeves PA, Olmstead RG. Phylogenetic relationships of Clerodendrum s.l. (Lamiaceae) inferred from chloroplast DNA. Syst Bot. 1997;22:229–243. doi: 10.2307/2419455. [DOI] [Google Scholar]
  • 44.Wagstaff SJ, Olmstead RG. Phylogeny of Labiatae and Verbenaceae inferred from rbcL sequences. Syst Bot. 1997;22:165–179. doi: 10.2307/2419684. [DOI] [Google Scholar]
  • 45.Alarcón M, Roquet C, García-Fernández A, Vargas P, Aldasoro JJ. Phylogenetic and phylogeographic evidence for a Pleistocene disjunction between Campanula jacobaea (Cape Verde Islands) and C. balfourii (Socotra) Mol Phylogenet Evol. 2013;69:828–836. doi: 10.1016/j.ympev.2013.06.021. [DOI] [PubMed] [Google Scholar]
  • 46.Kropf M, Kadereit JW, Comes HP. Differential cycles of range contraction and expansion in European high mountain plants during the Late Quaternary: insights from Pritzelago alpina (L.) O. Kuntze (Brassicaceae) Mol Ecol. 2003;12:931–949. doi: 10.1046/j.1365-294X.2003.01781.x. [DOI] [PubMed] [Google Scholar]
  • 47.Renner MAM, Devos N, Patino J, Brown EA, Orme A, Elgey M, et al. Integrative taxonomy resolves the cryptic and pseudo-cryptic Radula buccinifera complex (Porellales, Jungermanniopsida), including two reinstated and five new species. PhytoKeys. 2013 doi: 10.3897/phytokeys.27.5523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Marx HE, O’Leary N, Yuan YW, Lu-Irving P, Tank DC, Múlgura ME, et al. A molecular phylogeny and classification of Verbenaceae. Am J Bot. 2010;97:1647–1663. doi: 10.3732/ajb.1000144. [DOI] [PubMed] [Google Scholar]
  • 49.Silva TRS, Salimena FRG. Novas combinações e novos sinônimos em Lippia e Lantana (Verbenaceae) Darwiniana. 2002;40:57–59. [Google Scholar]
  • 50.Schneider H. Qualidade dos dados: Métodos de Análises Filogenética: um Guia Prático. 3. Ribeirão Preto: Sociedade Brasileira de Genética/Holos; 2003. [Google Scholar]
  • 51.Sandasi M, Kamatou GPP, Combrinck S, Viljoen AM. A chemotaxonomic assessment of four indigenous South African Lippia species using GC–MS and vibrational spectroscopy of the essential oils. Biochem Syst Ecol. 2013;51:142–152. doi: 10.1016/j.bse.2013.08.028. [DOI] [Google Scholar]
  • 52.Dixon RA, Gang DR, Charlton AJ, Fiehn O, Kuiper HA, Reynolds TL, et al. Applications of metabolomics in agriculture. J Agric Food Chem. 2006;54:8984–8994. doi: 10.1021/jf061218t. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13104_2018_3839_MOESM1_ESM.xls (262.5KB, xls)

Additional file 1: Table S1. Binary data.

13104_2018_3839_MOESM2_ESM.docx (14.5KB, docx)

Additional file 2: Table S2. Accession number of ITS2 nucleotide sequence from GenBank database at the National Center for Biotechnology Information (NCBI), for all species used as reference.

13104_2018_3839_MOESM3_ESM.docx (17KB, docx)

Additional file 3: Table S3. Fasta Sequences of amplified ITS fragments for all samples.

13104_2018_3839_MOESM4_ESM.xls (37.5KB, xls)

Additional file 4: Table S4. Chemical data.

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article and its additional files.

Our data is available as Additional file 1: Table S1 Binary data, Additional file 2: Table S2 Chemical data, Additional file 3: Table S3 Genetic data and Additional file 4: Table S4 Accession number.


Articles from BMC Research Notes are provided here courtesy of BMC

RESOURCES