Abstract
Premise of the Study
Expressed sequence tag–simple sequence repeat (EST‐SSR) markers were developed for Carex angustisquama (Cyperaceae) to investigate the evolutionary history of this plant that is endemic to solfatara fields in northern Japan.
Methods and Results
Using RNA‐Seq data generated by the Illumina HiSeq 2000, 20 EST‐SSR markers were developed. Polymorphisms were assessed in C. angustisquama and the closely related species C. doenitzii and C. podogyna. In C. angustisquama, many loci were monomorphic within populations; the average number of alleles ranged from one to five, and levels of expected heterozygosity ranged from 0.000 to 0.580, while all markers were polymorphic in a population of C. doenitzii. This indicates that low genetic polymorphism of C. angustisquama is likely due to the species’ population dynamics, rather than to null alleles at the developed markers.
Conclusions
These markers will be used to assess genetic diversity and structure and to investigate evolutionary history in future studies of C. angustisquama and related species.
Keywords: Carex angustisquama, Carex doenitzii, Cyperaceae, expressed sequence tag–simple sequence repeat (EST‐SSR) markers, solfatara
Carex L. is one of the largest and most widespread genera of the flowering plants, with approximately 2000 species (Reznicek, 1990). Most of its species are distributed in the Northern Hemisphere, especially in northern temperate and arctic regions. In addition to its global distribution, it is noteworthy that the species in the genus occur in various habitats ranging from rainforests and dry grassland to wet meadows, temperate forests, and alpine zones (Starr et al., 1999), which makes them useful models to study plant adaptation to the environment.
Carex angustisquama Franch. (Cyperaceae) is a perennial sedge that is endemic to solfatara fields in the Tohoku region of northern Japan. Solfatara fields are areas around fumaroles emitting sulfide gases containing H2S and SO2 even after eruption (Tsujimura, 1979; Yamamoto et al., 2018). Acidified by sulfide gases from fumaroles, the soil in solfatara fields has low pH values of 2–3 and high concentrations of sulfur and aluminum, making a harsh environment for plants to survive. Carex angustisquama grows close to fumaroles where no other vascular plants are able to survive (Tsujimura, 1982). Because no other closely related species in Carex sect. Podogynae Holm grow in a similar habitat, C. angustisquama is assumed to have adapted to solfatara fields in the process of speciation. Carex angustisquama also represents a disjunct geographic distribution in six main volcanic areas in the Tohoku region, which are isolated by unsuitable forested vegetation. This pattern of distribution provides an ideal model to reconstruct the historical biogeography of C. angustisquama.
To investigate the genetic structure and evolutionary history of C. angustisquama, genetic markers are needed, but there are no available markers that can be applied to this species. Expressed sequence tag–simple sequence repeat (EST‐SSR) markers are widely distributed both in transcribed and nontranscribed regions (Morgante et al., 2002). EST‐SSR markers are regarded as easier and less expensive markers to develop and reported to be more transferable among closely related species (Bouck and Vision, 2007). Moreover, they are shown to be more reliable because they have lower frequencies of null alleles than anonymous genomic SSR markers (Ellis and Burke, 2007). Therefore, we developed EST‐SSR markers and examined their polymorphisms and transferability to closely related taxa.
METHODS AND RESULTS
Total RNA was extracted from C. angustisquama (population CA18, Appendix 1) using the Agilent Plant RNA Isolation Mini Kit (Agilent Technologies, Santa Clara, California, USA). A non‐normalized cDNA library was constructed and sequenced using the Illumina HiSeq 2000 system (Illumina, San Diego, California, USA). De novo assembly of 83,484,902 cleaned 100‐bp reads (DNA Data Bank of Japan [DDBJ], Bioproject PRJDB6849) using CLC Genomic Workbench version 10.1.1 software (CLC bio, Aarhus, Denmark) produced 53,628 contigs (N50: 1321 bp).
Microsatellite regions (≥8 dinucleotide repeats, ≥8 trinucleotide repeats) were searched using MSATCOMMANDER (Faircloth, 2008). We obtained 937 markers, of which 63 pairs were selected based on repeat number. For all loci, the forward primer was synthesized with one of four different M13 sequences (5′‐CACGACGTTGTAAAACGAC‐3′, 5′‐TGTGGAAT‐TGTGAGCGG‐3′, 5′‐CTATAGGGCACGCGTGGT‐3′, or 5′‐CGGA‐GAGCCGAGAGGTG‐3′) and the reverse primer was tagged with a PIG‐tail (5′‐GTTTCTT‐3′). PCR reactions were performed using a QIAGEN Multiplex PCR Kit (QIAGEN, Hilden, Germany) in a 10‐μL volume containing 20–30 ng of DNA, 5 μL of 2× Multiplex PCR Master Mix, 0.01 μM of forward primer, 0.2 μM of reverse primer, and 0.1 μM of fluorescently labeled M13 primer. The PCR protocol was as follows: 95°C for 30 min; followed by 35 cycles of 94°C for 30 s, 60°C for 3 min, 72°C for 1 min; and a final extension at 68°C for 30 min. Amplified products were loaded onto an ABI 3130 autosequencer (Applied Biosystems, Foster City, California, USA) using the GeneScan 600 LIZ Size Standard (Applied Biosystems), POP7 polymer (Applied Biosystems), and 36‐cm capillary array. Fragment size was determined using GeneMapper (Applied Biosystems).
For the initial PCR amplification trial, we used two individuals from population CA09 (Appendix 1). For the 32 primer pairs that showed clear peaks, two individuals from each population (CA09, CA13, CA14, and CA15; Appendix 1) were then used to check polymorphisms among populations. Using 20 primers that were polymorphic over the eight samples (details for 12 monomorphic markers are provided in Appendix 2), 24 individuals from each population (CA09, CA14, and CA15) were evaluated for within‐population polymorphisms. However, because few polymorphisms were detected within each population, we examined the transferability and evaluated polymorphisms in two closely related species (C. doenitzii Boeckeler and C. podogyna Franch. & Sav.; Appendix 1) to test whether low genetic variation of C. angustisquama was the result of null alleles at the markers or of the species’ genetic nature. GenAlEx 6.5 software (Peakall and Smouse, 2012) was used to calculate genetic diversity indices (number of alleles [A], observed heterozygosity [H o], and expected heterozygosity [H e]). FSTAT 2.9.3 software (Goudet, 1995) was used to test significance of Hardy–Weinberg equilibrium (HWE) by 1000 randomizations; the significance of the associated P values was adjusted by applying sequential Bonferroni correction. The test for the presence of null alleles was performed using MICRO‐CHECKER version 2.2.3 (van Oosterhout et al., 2004).
For C. angustisquama, all primer pairs (Table 1) were polymorphic when all populations were combined; A ranged from two to seven, and levels of H e and H o ranged from 0.100 to 0.703 and 0.000 to 0.286, respectively (Table 2). For each population, A ranged from one to five, and levels of H e and H o ranged from 0.000 to 0.580 and 0.000 to 0.524, respectively (Table 2). For cross‐species amplification, 20 and nine primer pairs were polymorphic in C. doenitzii and C. podogyna, respectively (Table 3). Significant departures (P < 0.01) from HWE were detected in three loci (Cang4398, Cang7240, and Cang48335) in C. doenitzii, although no significant departures were detected for any of the populations or loci in both C. angustisquama and C. podogyna. Analysis with MICRO‐CHECKER (at the 99% confidence level) highlighted the existence of null alleles at some loci in C. angustisquama and C. doenitzii (Tables 2, 3).
Table 1.
Twenty polymorphic EST‐SSR markers developed for Carex angustisquama
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | BLASTX top hit description | E‐value | GenBank accession no. |
|---|---|---|---|---|---|---|
| Cang_681 | F: TGTGGAATTGTGAGCGGAGCTTATTGGCCGCATGAAC | (AG)19 | 245–251 | B‐box zinc finger protein 22 [Ananas comosus] | 8.00E‐77 | FX986011 |
| R: GTTTCTTCCAACCGGATAAAGCTGCG | ||||||
| Cang_1267 | F: TGTGGAATTGTGAGCGGTAATGTGGGTCCCGGTACTG | (AGC)9 | 209–221 | PREDICTED: ATP‐dependent helicase BRM [Oryza brachyantha] | 0.0 | FX985999 |
| R: GTTTCTTCGTGAAACCGAAACCTGGTC | ||||||
| Cang_1881 | F: TGTGGAATTGTGAGCGGTGTGGATGACGTGGCATTTG | (AT)11 | 316–334 | Hypothetical protein GQ55_7G126900 [Panicum hallii var. hallii] | 9.00E‐149 | FX986003 |
| R: GTTTCTTTACAGCACAACATAGCCCTC | ||||||
| Cang_2073 | F: CTATAGGGCACGCGTGGTCAGTGCAGCCGAGATTCTTG | (AAG)10 | 466–475 | Putative DEAD‐box ATP‐dependent RNA helicase family protein [Zea mays] | 0.0 | FX986008 |
| R: GTTTCTTCCCATCTCGATCCCAAATCC | ||||||
| Cang_3069 | F: TGTGGAATTGTGAGCGGGTCTCCTCCGCCAAGTACTC | (AAG)10 | 398–439 | Poly(A)‐specific ribonuclease PARN [Ananas comosus] | 0.0 | FX986006 |
| R: GTTTCTTAATTGGAGGATGGCAAAGCG | ||||||
| Cang_3862 | F: CACGACGTTGTAAAACGACGATCCATCCACTCTCCCTCC | (AG)17 | 173–183 | Uncharacterized protein LOC100191912 [Zea mays] | 9.00E‐113 | FX986009 |
| R: GTTTCTTCATCCACCACGATACGCTTC | ||||||
| Cang_4293 | F: CTATAGGGCACGCGTGGTCGATTTCCACTGCGTGTACC | (AG)12 | 244–250 | PREDICTED: WD‐40 repeat‐containing protein MSI4‐like [Phoenix dactylifera] | 0.0 | FX986001 |
| R: GTTTCTTCCACTCGCAAACAACAGTCG | ||||||
| Cang_4398 | F: CGGAGAGCCGAGAGGTGTCCTACTAAAGTCCCTGCTGAG | (AG)12 | 147–153 | PREDICTED: uncharacterized protein LOC103721079 | 1.00E‐90 | FX985994 |
| R: GTTTCTTGTTGGTTGAGTGAGGCTGTG | ||||||
| Cang_5849 | F: CACGACGTTGTAAAACGACACCCACCCATAGTTCCAGAAG | (AG)10 | 406–418 | d‐cysteine desulfhydrase 2, mitochondrial‐like isoform X4 | 3.00E‐09 | FX986007 |
| R: GTTTCTTACCTATGAGTCAGCCCGAAC | ||||||
| Cang_7187 | F: CGGAGAGCCGAGAGGTGGCAGCGTGGGAAGGAAGAG | (AG)12 | 366–409 | WD repeat‐containing protein 44‐like [Ananas comosus] | 0.0 | FX986004 |
| R: GTTTCTTAAAGCGTTGGAAAGAGCGTC | ||||||
| Cang_7240 | F: CACGACGTTGTAAAACGACAAAGCTTGGCAGATTCGTCG | (AGG)11 | 210–218 | PREDICTED: protein TIC 21, chloroplastic [Musa acuminata] | 2.00E‐98 | FX985998 |
| R: GTTTCTTAATGCAGGCGTCGATGTTAC | ||||||
| Cang_7261 | F: CACGACGTTGTAAAACGACCTTCGTTTCACCACAGCTGC | (AG)12 | 236–238 | Protein ROOT PRIMORDIUM DEFECTIVE 1 [Asparagus officinalis] | 0.0 | FX986000 |
| R: GTTTCTTAAACCTCACCACTGCACTCG | ||||||
| Cang_10657 | F: CGGAGAGCCGAGAGGTGGAGGCGAATTGAGTTGCTCC | (AG)12 | 175–185 | Probable transcription factor At5g28040 [Ananas comosus] | 2.00E‐89 | FX985996 |
| R: GTTTCTTGCCAATGCCAAACTTTGAGG | ||||||
| Cang_18857 | F: CTATAGGGCACGCGTGGTCTCTCTCAGCTCGGACAGTG | (AG)12 | 398–408 | PREDICTED: protein TIFY 4B‐like isoform X4 [Phoenix dactylifera] | 8.00E‐58 | FX986005 |
| R: GTTTCTTTTCCACCGAAATCAGGGAGG | ||||||
| Cang_19507 | F: TGTGGAATTGTGAGCGGCACAGTATCTTTCTCCGCCC | (AG)19 | 201–215 | PREDICTED: histone deacetylase 19‐like [Elaeis guineensis] | 0.0 | FX986010 |
| R: GTTTCTTAGAAGTATGAGACCCGACGC | ||||||
| Cang_21384 | F: CACGACGTTGTAAAACGACGGGTTACCGAGGCACAATTG | (AC)12 | 118–136 | No significant similarity found. | — | FX985993 |
| R: GTTTCTTGATGCGACACAACTAACCCG | ||||||
| Cang_22899 | F: CTATAGGGCACGCGTGGTGGAGAGCAAATTCAGAGCGG | (AG)11 | 153–157 | PREDICTED: transcription factor PCL1‐like [Musa acuminata subsp. malaccensis] | 1.00E‐74 | FX985995 |
| R: GTTTCTTACAGAGAGAAGCAAGGCAGG | ||||||
| Cang_25819 | F: CTATAGGGCACGCGTGGTGGAGTTGATGATGGGTTTAGGG | (AG)17 | 287–297 | No significant similarity found. | — | FX986012 |
| R: GTTTCTTGGTCTGTGCCACTTAGTCCC | ||||||
| Cang_46532 | F: CGGAGAGCCGAGAGGTGAGCCCTAGAAACCTGACCTTG | (AC)12 | 302–305 | No significant similarity found. | — | FX986002 |
| R: GTTTCTTGGACACTATGCTGTACAAGGG | ||||||
| Cang_48335 | F: TGTGGAATTGTGAGCGGAGTTGTAGGTGGTGTAGCGG | (AG)10 | 185–189 | No significant similarity found. | — | FX985997 |
| R: GTTTCTTCCCTGGCACTGTTTAGCTTG |
Table 2.
Characteristics of the 20 polymorphic EST‐SSR markers in three populations of Carex angustisquama.a
| Locus | CA09 (N = 24) | CA14 (N = 24) | CA15 (N = 24) | All (N = 72) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H e | H o | A | H e | H o | A | H e | H o | A | H e | H o | |
| Cang_681 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.544 | 0.238b | 4 | 0.510 | 0.081b |
| Cang_1267 | 1 | 0.000 | 0.000 | 2 | 0.105 | 0.111 | 5 | 0.319 | 0.182 | 7 | 0.702 | 0.094b |
| Cang_1881 | 2 | 0.469 | 0.083b | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.525 | 0.030b |
| Cang_2073 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.466 | 0.217 | 3 | 0.511 | 0.076b |
| Cang_3069 | 2 | 0.249 | 0.292 | 1 | 0.000 | 0.000 | 3 | 0.232 | 0.174 | 5 | 0.703 | 0.167b |
| Cang_3862 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.662 | 0.000b |
| Cang_4293 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.663 | 0.000b |
| Cang_4398 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.662 | 0.000b |
| Cang_5849 | 2 | 0.249 | 0.292 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.100 | 0.106 |
| Cang_7187 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.463 | 0.000b |
| Cang_7240 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.662 | 0.000b |
| Cang_7261 | 1 | 0.000 | 0.000 | 2 | 0.105 | 0.000 | 2 | 0.087 | 0.091 | 4 | 0.506 | 0.031b |
| Cang_10657 | 1 | 0.000 | 0.000 | 2 | 0.054 | 0.056 | 1 | 0.000 | 0.000 | 3 | 0.409 | 0.016b |
| Cang_18857 | 2 | 0.080 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.159 | 0.087 | 3 | 0.509 | 0.030b |
| Cang_19507 | 2 | 0.353 | 0.292 | 1 | 0.000 | 0.000 | 3 | 0.580 | 0.524 | 4 | 0.621 | 0.286b |
| Cang_21384 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.049 | 0.050 | 3 | 0.423 | 0.016b |
| Cang_22899 | 1 | 0.000 | 0.000 | 2 | 0.054 | 0.056 | 1 | 0.000 | 0.000 | 3 | 0.409 | 0.016b |
| Cang_25819 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.662 | 0.000b |
| Cang_46532 | 2 | 0.413 | 0.167b | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.517 | 0.061b |
| Cang_48335 | 2 | 0.041 | 0.042 | 2 | 0.054 | 0.056 | 3 | 0.275 | 0.188 | 4 | 0.539 | 0.086b |
| Average | 1.350 | 0.093 | 0.058 | 1.55 | 0.019 | 0.014 | 1.8 | 0.136 | 0.088 | 3.4 | 0.538 | 0.055b |
A = number of alleles per locus; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals genotyped.
Voucher and locality information are provided in Appendix 1.
Significant possibility of presence of null alleles (99% confidence level) detected by MICRO‐CHECKER (van Oosterhout et al., 2004).
Table 3.
Cross‐amplification and genetic diversity statistics of the EST‐SSR markers developed for Carex angustisquama in two related species.a
| Locus | C. doenitzii (N = 24) | C. podogyna (N = 16) | ||||
|---|---|---|---|---|---|---|
| A | H e | H o | A | H e | H o | |
| Cang_681 | 5 | 0.321 | 0.182 | 2 | 0.444 | 0.333 |
| Cang_1267 | 4 | 0.574 | 0.292b | 2 | 0.305 | 0.250 |
| Cang_1881 | 8 | 0.806 | 0.522b | 1 | 0.000 | 0.000 |
| Cang_2073 | 6 | 0.747 | 0.87 | 1 | 0.000 | 0.000 |
| Cang_3069 | 7 | 0.694 | 0.609 | 1 | 0.000 | 0.000 |
| Cang_3862 | 6 | 0.713 | 0.435b | 2 | 0.486 | 0.500 |
| Cang_4293 | 5 | 0.712 | 0.783 | 2 | 0.320 | 0.133 |
| Cang_4398 | 4 | 0.644 | 0.045c, b | 3 | 0.331 | 0.267 |
| Cang_5849 | 3 | 0.46 | 0.364 | 1 | 0.000 | 0.000 |
| Cang_7187 | 2 | 0.315 | 0.217 | 1 | 0.000 | 0.000 |
| Cang_7240 | 6 | 0.753 | 0.375c, b | 1 | 0.000 | 0.000 |
| Cang_7261 | 6 | 0.751 | 0.826 | 1 | 0.000 | 0.000 |
| Cang_10657 | 4 | 0.396 | 0.294 | 2 | 0.444 | 0.000 |
| Cang_18857 | 5 | 0.694 | 0.739 | 2 | 0.451 | 0.563 |
| Cang_19507 | 7 | 0.794 | 0.762 | 1 | 0.000 | 0.000 |
| Cang_21384 | 5 | 0.718 | 0.591 | 2 | 0.117 | 0.125 |
| Cang_22899 | 2 | 0.194 | 0.217 | 1 | 0.000 | 0.000 |
| Cang_25819 | 5 | 0.688 | 0.571 | 1 | 0.000 | 0.000 |
| Cang_46532 | 2 | 0.258 | 0.217 | 2 | 0.358 | 0.333 |
| Cang_48335 | 5 | 0.5 | 0.125c, b | – | – | – |
| Average | 4.85 | 0.587 | 0.452 | 1.450 | 0.163 | 0.125 |
A = number of alleles per locus; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals genotyped.
Voucher and locality information are provided in Appendix 1.
Significant possibility of presence of null alleles (99% confidence level) detected by MICRO‐CHECKER (van Oosterhout et al., 2004).
Significant departures (P < 0.01) from Hardy–Weinberg equilibrium after Bonferroni correction.
EST‐SSR markers were shown to have a disadvantage of less polymorphism than genomic SSR markers (Bouck and Vision, 2007; Ellis and Burke, 2007), and we found low genetic variation in all populations of C. angustisquama. This may be caused by presence of null alleles. However, substantial polymorphisms were detected in C. doenitzii, which is the most closely related species to C. angustisquama (K. Nagasawa, H. Setoguchi, M. Maki, H. Goto, K. Fukushima, Y. Isagi, S. Sakaguchi, Y. Suyama, and Y. Tsunamoto, unpublished data). Moreover, in C. angustisquama, although most loci were homozygous within populations, these loci were fixed with different alleles for each population, which likely reflects evolutionary history rather than null alleles. Thus, we conclude that low genetic variation of C. angustisquama is probably caused by the species’ demographic history.
CONCLUSIONS
The 20 EST‐SSR markers developed for C. angustisquama are less polymorphic within populations. However, in intraspecific and cross‐species amplification, substantial polymorphisms were detected, indicating that low genetic variation in C. angustisquama results from the species’ demographic history, and not from the markers’ characteristics. Thus these markers will be useful for investigating intraspecific relationships among C. angustisquama populations occurring in disjunct solfatara fields. These markers are also useful in other Carex species, providing novel population genetic tools in this speciose genus.
DATA ACCESSIBILITY
Cleaned reads from the cDNA library have been deposited to the DNA Data Bank of Japan (DDBJ; Bioproject PRJDB6849). Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.
ACKNOWLEDGMENTS
The authors thank Mr. K. Sawa (Yamagata Prefecture), Mr. S. Kurata (University of Tokyo), Dr. Y. Suyama (Tohoku University), Dr. Y. Tsunamoto (Forest Research and Management Organization), and Dr. K. Yonekura (Tohoku University) for providing plant materials. We are also grateful to Dr. J. R. P. Worth for his comments on an earlier version of the manuscript. This research was supported by the Japan Society for the Promotion of Science (Bilateral program “The spatial and temporal dimensions and underlying mechanisms of lineage divergence and plant speciation of keystone species in Sino‐Japanese Forest subkingdom” and Grant‐in‐Aid for Young Scientists B [no. 17K15286]), the SICORP Program of the Japan Science and Technology Agency (“Spatial‐temporal dimensions and underlying mechanisms of lineage diversification and patterns of genetic variation of keystone plant taxa in warm‐temperate forests of Sino‐Japanese Floristic Region”; grant no. 4–1403), the TAKARA Harmonist Fund, the Nissei Fund, and the Pro Natura Foundation Japan for the Ashiu Biological Conservation project.
Appendix 1. Sample information for Carex species used in this study.
| Species | Population | N | Collection locality | Geographic coordinates (Altitude, m) | Voucher specimen accession no.a |
|---|---|---|---|---|---|
| Carex angustisquama Franch.b | CA18 | 1 | Goshogake, Senboku‐shi, Akita Pref., Japan | 35°21′38″N, 137°01′34″E (1002) | KYO 00023447 |
| Carex angustisquama c , d , e | CA09 | 24 | Katanuma, Osaki‐shi, Miyagi Pref., Japan | 38°44′02″N, 140°43′28″E (309) | KYO 00023438 |
| Carex angustisquama d | CA13 | 2 | Mt. Kurikoma, Ichinoseki‐shi, Iwate Pref., Japan | 38°58′47″N, 140°46′10″E (1113) | KYO 00023439 |
| Carex angustisquama d , e | CA14 | 24 | Mt. Hakkoda, Aomori‐shi, Aomori Pref., Japan | 40°38′56″N, 140°51′15″E (936) | KYO 00023440 |
| Carex angustisquama d , e | CA15 | 24 | Mt. Osorezan, Mutsu‐shi, Aomori Pref., Japan | 41°19′47″N, 141°05′10″E (216) | KYO 00023444 |
| Carex doenitizii Boeckelerf | C86 | 24 | Mt. Konsei, Nikko‐shi, Gunma Pref., Japan | 36°49′04″N, 139°23′37″E (2044) | KYO 00023454 |
| Carex podogyna Franch. & Sav.f | C116 | 16 | Mt. Shiogiri, Miyazu‐shi, Kyoto Pref., Japan | 35°39′01″N, 135°12′27″E (610) | NA |
Appendix 2. Twelve monomorphic EST‐SSR markers developed for Carex angustisquama.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | BLASTX top hit description | E‐value |
|---|---|---|---|---|---|
| Cang_103 | F: CACGACGTTGTAAAACGACGATCGGTGATTGGGCCTTTG | (AG)11 | 265 | Glutamine synthetase root isozyme 3 [Zea mays] | 0.0 |
| R: GTTTCTTGCCCTGATTTCTGAACCGTG | |||||
| Cang_594 | F: CTATAGGGCACGCGTGGTTGCTCCAGTCCCAACCATAG | (AG)20 | 325 | PREDICTED: calmodulin‐binding transcription activator 4 isoform X1 [Elaeis guineensis] | 0.0 |
| R: GTTTCTTTGGGTGTGCTTCTGAGACC | |||||
| Cang_1002 | F: TGTGGAATTGTGAGCGGCGGTGGTTGGAATTCGAAGG | (AG)11 | 434 | Sulfite exporter TauE/SafE family protein 4 [Sorghum bicolor] | 4.00E‐143 |
| R: GTTTCTTTCCAGTTCACCTCCAGCTTC | |||||
| Cang_1737 | F: TGTGGAATTGTGAGCGGGAGAAATCAACAGAGCGGGC | (AAG)14 | 414 | PREDICTED: eukaryotic translation initiation factor 3 subunit I‐like [Phoenix dactylifera] | 0.0 |
| R: GTTTCTTAACTGCGATTGGTCCTGTTG | |||||
| Cang_1744 | F: CACGACGTTGTAAAACGACTTCCTGGATCCTTGTCGACC | (AG)20 | 276 | PREDICTED: guanine nucleotide‐binding protein‐like NSN1 [Elaeis guineensis] | 0.0 |
| R: GTTTCTTGCCTACATAACCCATCGCTC | |||||
| Cang_2515 | F: TGTGGAATTGTGAGCGGACCCTAGACTCGGATCCTCC | (AG)23 | 279 | Carbon catabolite repressor protein 4 homolog 1‐like [Ananas comosus] | 0.00E+00 |
| R: GTTTCTTGCCAGACTTATACTCTCCCTCG | |||||
| Cang_2955 | F: CGGAGAGCCGAGAGGTGCTGTAACGAATCAGGTGCGG | (AAG)10 | 410 | Threonine dehydratase biosynthetic, chloroplastic [Ananas comosus] | 0.0 |
| R: GTTTCTTCTCCATTACCTGCTCCCTCC | |||||
| Cang_3156 | F: CACGACGTTGTAAAACGACTTCAGTAGCCGAGCCTCATC | (AG)12 | 413 | Eukaryotic translation initiation factor 1A [Citrus clementina] | 5.00E‐81 |
| R: GTTTCTTCCTCTCTTCCTGAACAAACCG | |||||
| Cang_3166 | F: CACGACGTTGTAAAACGACCGCTCTTGTGCAGTTCCAAC | (AT)19 | 206 | PREDICTED: uncharacterized protein LOC107807406 isoform X1 [Nicotiana tabacum] | 2.00E‐177 |
| R: GTTTCTTGGGAGAGGGATCTGAGCTTG | |||||
| Cang_3348 | F: CTATAGGGCACGCGTGGTATTGCCTCCACAGCCTCC | (AG)17 | 192 | PREDICTED: NADP‐dependent d‐sorbitol‐6‐phosphate dehydrogenase [Elaeis guineensis] | 0.0 |
| R: GTTTCTTAGCGGATAAGAGGAGATCGC | |||||
| Cang_4013 | F: TGTGGAATTGTGAGCGGACACGAAGCAGCTCTCTACC | (AG)18 | 114 | Peroxisome biogenesis protein 1 [Ananas comosus] | 0.0 |
| R: GTTTCTTATTCGCCTCTGAGTCGAGAC | |||||
| Cang_4089 | F: CGGAGAGCCGAGAGGTGCACCTCCTCCTCTCTAAACCC | (AG)24 | 198 | Auxin response factor 18 [Ananas comosus] | 0.0 |
| R: GTTTCTTCTGCTCTTCTCATTGGCGTC |
Nagasawa, K. , Setoguchi H., Maki M., Goto H., K. Fukushima , Isagi Y., and Sakaguchi S.. 2018. Development and characterization of EST‐SSR markers for Carex angustisquama (Cyperaceae), an extremophyte in solfatara fields. Applications in Plant Sciences 6(10): e1185.
Notes
N = number of individuals; NA = voucher unavailable.
Vouchers are deposited at Kyoto University (KYO), Kyoto, Japan.
Sample used for cDNA library construction.
Sample used for initial PCR amplification trials.
Samples used to check polymorphisms among populations.
Samples used for detailed evaluation for polymorphisms within populations.
Samples used for transferability test.
LITERATURE CITED
- Bouck, A. M. Y. , and Vision T.. 2007. The molecular ecologist's guide to expressed sequence tags. Molecular Ecology 16: 907–924. [DOI] [PubMed] [Google Scholar]
- Ellis, J. R. , and Burke J. M.. 2007. EST‐SSRs as a resource for population genetic analyses. Heredity 99: 125. [DOI] [PubMed] [Google Scholar]
- Faircloth, B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus‐specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Goudet, J. 1995. FSTAT (version 1.2): A computer program to calculate F‐statistics. Journal of Heredity 86: 485–486. [Google Scholar]
- Morgante, M. , Hanafey M., and Powell W.. 2002. Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nature Genetics 30: 194. [DOI] [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Reznicek, A. A. 1990. Evolution in sedges (Carex, Cyperaceae). Canadian Journal of Botany 68: 1409–1432. [Google Scholar]
- Starr, J. R. , Bayer R. J., and Ford B. A.. 1999. The phylogenetic position of Carex section Phyllostachys and its implications for phylogeny and subgeneric circumscription in Carex (Cyperaceae). American Journal of Botany 86: 563–577. [PubMed] [Google Scholar]
- Tsujimura, A. 1979. The arrangement of the vegetation of solfataras according to pH value of soils. Ecological Review 19: 59. [Google Scholar]
- Tsujimura, A. 1982. An ecological study of Carex angustisquama FRANCHET in solfataras I. Colony formation. Japanese Journal of Ecology 32: 213–218. [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P. M., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Yamamoto, A. , Wasaki J., Funatsu Y., and Nakatsubo T.. 2018. Distribution and stress tolerance of Fimbristylis dichotoma subsp. podocarpa (Cyperaceae) growing in highly acidic solfatara fields. Ecological Research 33: 971–978. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Cleaned reads from the cDNA library have been deposited to the DNA Data Bank of Japan (DDBJ; Bioproject PRJDB6849). Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.