Abstract
Premise of the Study
Microsatellite loci were developed for Nuphar shimadai (Nymphaeaceae) to evaluate the population genetic dynamics for conservation purposes. The species is an endemic aquatic species in Taiwan that is endangered by anthropogenic activities.
Methods and Results
A magnetic bead enrichment protocol was used to identify 72 potential microsatellite loci and develop 39 microsatellite markers from N. shimadai. The number of alleles per locus ranged from one to 10 per locus, with levels of observed heterozygosity ranging from 0 to 1.0 within populations. As a result of inbreeding within isolated populations, 65% of loci significantly deviated from Hardy–Weinberg equilibrium within populations.
Conclusions
These novel markers should be valuable tools to evaluate the genetic diversity within the endangered aquatic taxon N. shimadai for conservation and reintroduction purposes in Taiwan.
Keywords: conservation, microsatellites, Nuphar shimadai, Nymphaeaceae, reintroduction, yellow water lily
The genus Nuphar Sm. (Nymphaeaceae) contains 52 extant aquatic taxa, which are widely distributed in lowland lakes and ponds in the temperate Northern Hemisphere, including Europe, North America, and Asia (Padgett et al., 1999). Nuphar shimadai Hayata, known as yellow water lily, is a Taiwanese endemic aquatic species that typically occurs in lowland lakes and ponds of northern Taiwan. Remaining populations of N. shimadai are rare due to the severe destruction of natural habitat. As a result, N. shimadai is recognized as a Critically Endangered species under the IUCN Red List Categories and Criteria Version 3.1 (IUCN, 2012) and listed in A Preliminary Red List of Taiwanese Vascular Plants (Wang et al., 2012). Therefore, it is urgent to explore and identify microsatellite markers, which can be used to effectively evaluate genetic diversity in N. shimadai. Previous studies of Nuphar only focused on matK, ITS regions of nuclear ribosomal DNA (Padgett et al., 1999), and AFLPs (Shiga et al., 2006); these markers are used primarily for phylogenetic studies, and thus do not have the resolution to address population‐specific questions. Moreover, microsatellite markers have only been developed for N. lutea (L.) Sm. (Ouborg et al., 2000) and N. japonica DC. (Kondo et al., 2016), and the cross‐amplification and polymorphism of these markers to N. shimadai has been shown to be limited in preliminary tests. To date, highly polymorphic DNA regions have scarcely been used to elucidate intraspecies relationships of Nuphar species. In the present study, we developed 39 highly variable microsatellite primer pairs from N. shimadai and examined their applicability in two related Nuphar species. These polymorphic microsatellite markers will be a viable strategy to evaluate population genetics and demographic history of N. shimadai and its related taxa, which can be used to infer inter‐ and intraspecific relationships. Therefore, these markers can also assist in the establishment of conservation management strategies for N. shimadai and related species.
METHODS AND RESULTS
Sampling and DNA extraction
Five populations of N. shimadai from throughout its geographic distribution range were sampled from different ponds in two localities in northern Taiwan (Taoyuan: populations WP, GPa, GPb, GPn, and Ilan: population LD; Appendix 1). Nuphar pumila (Timm) DC. subsp. sinensis (Hand.‐Mazz.) Padgett was obtained from Jiangxi Province in China (population GJ); N. japonica was acquired from Owase, Japan (population JP) (Appendix 1). All voucher specimens are deposited in the Herbarium of the Taiwan Forestry Research Institute (TAIF). Genomic DNA was extracted from silica gel–dried leaf tissue using a Genomic DNA Extraction Kit (RBC Bioscience, Taipei, Taiwan).
Development of microsatellite markers
The microsatellite‐enriched library of N. shimadai was constructed using a magnetic bead procedure (Liao et al., 2009; Chiang et al., 2011). The genomic DNA of N. shimadai was digested by the restriction enzyme MseI (Promega Corporation, Madison, Wisconsin, USA). Fragments from 400 to 1000 bp were isolated and ligated to the double‐stranded adapter (complementary oligo A: 5′‐TACTCAGGACTCAT‐3′; phosphorylated oligo B: 5′‐GACGATGAGTCCTGAG‐3′). To enrich the partial genomic library, the adapter‐specific MseI‐N primer (5′‐GATGAGTCCTGAGTAAN‐3′) was used to perform 18 cycles of prehybridization PCR amplification. The PCR protocol was as follows: initial denaturation at 94°C for 5 min, followed by 18 cycles of 94°C for 30 s, 53°C for 1 min, and 72°C for 1 min. PCR products were isolated, denatured, and separately hybridized to two biotinylated probes (B‐(AG)15, B‐(AC)15) at 68°C for 1 h. One milligram of Streptavidin MagneSphere Paramagnetic Particles (Promega Corporation) was added to the hybridized PCR products to capture the hybridizations at 42°C for 2 h. The enriched (AG) and (AC) DNA fragments were washed with high‐ and low‐salt solutions, then eluted, and purified DNA fragments were used as templates for 25 cycles of PCR amplification using MseI‐N. Purified DNA fragments were cloned using the pGEM‐T Easy Vector System (Promega Corporation) and screened by PCR (primer pairs: (AG)10 or (AC)10 and SP6 or T7). A total of 239 selected clones were isolated and sequenced in both directions using the ABI BigDye Terminator 3.1 Cycle Sequencing Kit with the ABI PRISM 3700 DNA Sequencer (Applied Biosystems, Waltham, Massachusetts, USA). Microsatellite loci were identified applying the Tandem Repeats Finder version 4.07b (Benson, 1999). A total of 72 primer pairs were developed using FastPCR software version 6.4.18 (Kalendar et al., 2011) based on the following detailed limitation settings: amplicon size range from 100 to 350 bp, an optimal annealing temperature of 55°C, and a GC content ranging from 40–60%. The optimal annealing temperature for each locus was obtained from temperature‐gradient PCR under the following PCR conditions: 94°C for 2 min; 35 cycles of 94°C for 45 s, 50–60°C gradient for 45 s, and 72°C for 50 s; followed by a final elongation at 72°C for 7 min. The PCR reaction volume per 20 μL contained approximately 5 ng of genomic DNA, 4 μL of 5× reaction buffer, 0.2 μM dNTP mix, 2 mM MgCl2, 0.5 units of GoTaq MDx Hot Start Polymerase (Promega Corporation), 0.2 μM of both primers, and sterile ddH2O to total 20 μL. PCR amplification was performed on a Labnet MultiGene 96‐well Gradient Thermal Cycler (Labnet, Edison, New Jersey, USA). From the 72 microsatellite loci, we obtained 39 primer pairs with discrete amplicon peaks, and the target PCR products of these 39 microsatellite loci were electrophoresed on 1% agarose gel and confirmed by sequencing. To evaluate the genetic diversity for N. shimadai and two related taxa, microsatellite loci were amplified by PCR and the target amplicons were visualized using the FloGel FGIS‐3 fluorescent gel image system (Top BIO Co., Taipei, Taiwan) after being re‐resolved on a 10% polyacrylamide gel. Amplicon molecular weights containing microsatellite loci were scored using Quantity One version 4.6.2 software (Bio‐Rad Laboratories, Hercules, California, USA) and adjusted manually.
Molecular data analysis and results
Genetic diversity parameters, including average and effective numbers of alleles per locus, expected and observed heterozygosity (H e and H o), and deviation from Hardy–Weinberg equilibrium, were evaluated using GenAlEx version 6.5 (Peakall and Smouse, 2012). Microsatellite sequences were submitted to GenBank, including the 39 microsatellite markers developed and used in this study (Table 1) and an additional 33 monomorphic microsatellite markers that were developed but not used (Appendix 2). The numbers of observed and effective alleles per locus ranged from one to 10 and one to 4.6, respectively. Levels of H o and H e varied from 0 to 1.0 and 0 to 0.8, respectively. A total of 30, 23, 27, 33, and 39 loci deviated significantly from Hardy–Weinberg equilibrium in the WP, GPb, GPa, GPn, and LD populations, respectively (P < 0.05; Table 2). Tests for linkage disequilibrium between loci were performed and no pairs of loci exhibited significant linkage disequilibrium.
Table 1.
Characteristics of 39 microsatellite loci developed in Nuphar shimadai
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | T a (°C) | GenBank accession no. |
|---|---|---|---|---|---|
| NS‐AG‐144 | F: CACTGCTGTGTTACAGGAAG | (AG)10 | 103–107 | 50 | MH396370 |
| R: TCATGGCATTAGCATCTAGG | |||||
| NS‐AG‐146 | F: TTGGTGATGCTTATAACACG | (TG)14 | 214–232 | 50 | MH396371 |
| R: GTACATACAATCTCTCAAGG | |||||
| NS‐AG‐152 | F: TGTGATACAATCTAGTGTCC | (TC)14 | 172–212 | 52 | MH396372 |
| R: TTTCTGAATCACTCTAGTGG | |||||
| NS‐AG‐158 | F: AGCATCTGTAAGATGTACGC | (TG)9 | 157–217 | 56 | MH396373 |
| R: TGTGCTATCAATGCATTGCC | |||||
| NS‐AG‐159 | F: GGTCAATGAGAGTTTGTAGG | (TG)9 | 174–180 | 56 | MH396374 |
| R: CATATGTTTCCCTCGTGCAC | |||||
| NS‐AG‐164 | F: ATGGCATCATAGGATAAGCC | (TG)14(AG)6 | 186–188 | 57 | MH396375 |
| R: TCCAGCAATTTCACGCTTGC | |||||
| NS‐AG‐167 | F: CTCATCACATGGAGGGAATC | (CA)11(TACA)14 | 256–300 | 55 | MH396376 |
| R: TGGAGATCCTGACCAATTCC | |||||
| NS‐AC‐152 | F: TCGACCTATTTGGTTTGACC | (CA)11 | 182–216 | 57 | MH396377 |
| R TGGTATGGATCTGGTCAGAC | |||||
| NS‐AG‐196 | F: ACTAGACTGTGACATACCTG | (TG)10 | 158–190 | 57 | MH396378 |
| R: TGAATCATCGCATGTCCTGG | |||||
| NS‐AG‐207 | F: TCTTTGAGACATGGTACCTG | (TG)10 | 168–182 | 56 | MH396379 |
| R: CCATACAAACGTCAATTCAC | |||||
| NS‐AG‐223 | F: AGTGACAGAGTCATAGGTAC | (AC)8 | 202–210 | 56 | MH396380 |
| R: TAGGGCTTAGACAATGGACC | |||||
| NS‐AG‐224 | F: GAACCTTCACAGTGAAACAG | (TG)9N(AG)10 | 270–280 | 56 | MH396381 |
| R: TTTCAAACATGCTGCCAAGC | |||||
| NS‐AG‐225 | F: AGCCAAAGTTCTTACCATCG | (TC)15 | 230–250 | 55 | MH396382 |
| R: CTAGATTTGGACCGTACAAG | |||||
| NS‐AC‐139 | F: AAGCCTTCCGAATTCAGAAG | (AG)12 | 150–162 | 56 | MH396383 |
| R: GCCAACTTATGAATGGAAGT | |||||
| NS‐AC‐143 | F: ACATGGTGTTGTAGCTAGGC | (AG)22 | 218–242 | 57 | MH396384 |
| R: GCTGCACTACTTGGCTTCAC | |||||
| NS‐AC‐149 | F: CTTGCTTGCGCTAGGTGTTG | (CT)13 | 276–312 | 58 | MH396385 |
| R: CTATGTGACAGGGACTCTGC | |||||
| NS‐AC‐150 | F: TTGGATGCACGGGCTTATAG | (CT)10 | 204–218 | 58 | MH396386 |
| R: CTGTGCTTGTCACAATGATCC | |||||
| NS‐AC‐155 | F: AAAACTACCACCCAAGGGAG | (TC)23 | 202–226 | 58 | MH396387 |
| R: CATCTCTTCTTCTCCATGTG | |||||
| NS‐AC‐165 | F: TGTGAATCAACAAGAGGAAG | (AG)12 | 164–180 | 57 | MH396388 |
| R: ACTTGGATGGGGATTCTTAC | |||||
| NS‐AC‐170 | F: CACCATAGCATACCCATGTG | (GA)9 | 144–156 | 57 | MH396389 |
| R: ATCATTCGTTCGACAACTGC | |||||
| NS‐AC‐171 | F: GTCTTGCTTATGAAGGTAGG | (TC)14 | 182–224 | 56 | MH396390 |
| R: AGTAGAATCAGCATACGTGC | |||||
| NS‐AC‐172 | F: TGAGCTTCTCCCCAAGATTG | (AC)11 | 140–146 | 56 | MH396391 |
| R: GTTTCATTTCTGCAGCAGAG | |||||
| NS‐AC‐176 | F: GTGGTAATACAGGAGCCAGC | (TG)8 | 208–234 | 58 | MH396392 |
| R: GGAGTGCCCATTGACATATC | |||||
| NS‐AC‐178 | F: ATATAGGAAGCCTGCCGAAC | (GAGTGT)3 | 138–142 | 53 | MH396393 |
| R: GGCACCATTAGCTCTGATAC | |||||
| NS‐AC‐182a | F: GACATGCACATTGCAACAGAG | (AG)17 | 186–206 | 56 | MH396394 |
| R: CAAGCGGCTGTCTAATGTTC | |||||
| NS‐AC‐182b | F: GAACATTAGACAGCCGCTTG | (AG)19 | 180–184 | 57 | MH396395 |
| R: TTAGGCCGTAGGCGTTCAAC | |||||
| NS‐AC‐186 | F: GATCTTTTGTGTTACGTGAG | (GA)15 | 122–126 | 57 | MH396396 |
| R: GAGAATTTGTTGCATGCACG | |||||
| NS‐AC‐189 | F: CAAAGCCAGCCAAAGTAACG | (TG)4(GA)29 | 170–196 | 56 | MH396397 |
| R: TTCTCTTTCATCCCCATCAC | |||||
| NS‐AC‐198b | F: AACAAAGCCTGCAATTTGTG | (AG)11 | 160–190 | 57 | MH396398 |
| R: ACGCACATGAAGATACTTGC | |||||
| NS‐AC‐206 | F: TCTTCAAATCCAATGGTTCG | (GA)14 | 122–134 | 57 | MH396399 |
| R: TAAAGGTACAACCACAGTCC | |||||
| NS‐AC‐136 | F: CGTGGTCTACCAAAAACTAG | (TG)4(AG)12 | 170–192 | 57 | MH396400 |
| R: ACTGCCCAAAATCTTCGATC | |||||
| NS‐AC‐111 | F: GCATCAGGAAGCACACCATC | (TC)13 | 132–136 | 58 | MH396401 |
| R: GTCGTACAGGAATGGAGACG | |||||
| NS‐AC‐112 | F: CCACTAGAAGAATCCGATCC | (AG)18 | 136–140 | 56 | MH396402 |
| R: AAGGGTACTGACCTACCAAG | |||||
| NS‐AC‐129 | F: CTAACCATAAACCACTGCTG | (TC)18 | 174–176 | 53 | MH396403 |
| R: TCTTAGAAAACCCACTTCCC | |||||
| NS‐AC‐130 | F: CACACTTAACAACTACCACC | (TC)27 | 164–176 | 55 | MH396404 |
| R: TCTTGAGTCATCGAATTGTC | |||||
| NS‐AC‐131 | F: TGGAAGAAGTTGCTGTGATG | (AG)10 | 174–176 | 56 | MH396405 |
| R: GACCTAAGTTAGCAAATACC | |||||
| NS‐AC‐132 | F: TGTCCTCATGATATGTCAAC | (TG)14 | 164–204 | 55 | MH396406 |
| R: GTGAACACATTTACAGTGTC | |||||
| NS‐AG‐135 | F: GGAAACGATCTCCGGAAACG | (CT)16 | 164–168 | 58 | MH396407 |
| R: GGCAATATTCCGAGTCGTAC | |||||
| NS‐AC‐173 | F: CAAGCTTGCATTTGCATCTC | (CA)6N(AG)19 | 274–280 | 53 | MH396408 |
| R: TAATCCCAGCCATCCAATGG |
T a = annealing temperature.
Table 2.
Genetic variation of 39 novel microsatellite loci in five populations of Nuphar shimadai.a
| Locus | WP (n = 22) | GPb (n = 13) | GPa (n = 11) | GPn (n = 16) | LD (n = 78) | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | A e | H o | H e b | A | A e | H o | H e b | A | A e | H o | H e b | A | A e | H o | H e b | A | A e | H o | H e b | |
| AG144 | 2 | 1.3 | 0.0 | 0.2*** | 2 | 1.7 | 0.0 | 0.4*** | 2 | 1.2 | 0.0 | 0.2*** | 2 | 2.0 | 0.0 | 0.5*** | 4 | 3.6 | 0.7 | 0.7ns |
| AG146 | 2 | 1.3 | 0.0 | 0.2*** | 2 | 1.2 | 0.0 | 0.1*** | 2 | 1.2 | 0.0 | 0.2*** | 2 | 2.0 | 0.0 | 0.5*** | 4 | 2.9 | 0.6 | 0.7ns |
| AG152 | 2 | 1.2 | 0.0 | 0.2*** | 3 | 2.3 | 0.0 | 0.6*** | 2 | 1.7 | 0.0 | 0.4*** | 4 | 2.2 | 0.0 | 0.5*** | 6 | 3.8 | 0.8 | 0.7ns |
| AG158 | 6 | 3.3 | 0.5 | 0.7ns | 2 | 2.0 | 1.0 | 0.5*** | 4 | 2.4 | 1.0 | 0.6*** | 4 | 2.9 | 1.0 | 0.7*** | 3 | 1.9 | 0.0 | 0.5*** |
| AG159 | 3 | 1.2 | 0.0 | 0.2*** | 2 | 1.2 | 0.0 | 0.1*** | 2 | 1.2 | 0.0 | 0.2*** | 3 | 1.5 | 0.0 | 0.3*** | 4 | 2.9 | 0.7 | 0.7ns |
| AG164 | 2 | 1.4 | 0.0 | 0.3*** | 2 | 1.2 | 0.0 | 0.1*** | 2 | 1.2 | 0.0 | 0.2*** | 2 | 1.8 | 0.0 | 0.4*** | 4 | 2.3 | 0.7 | 0.6ns |
| AG167 | 3 | 2.3 | 0.5 | 0.6ns | 4 | 2.4 | 0.3 | 0.6** | 2 | 1.7 | 0.0 | 0.4*** | 2 | 1.4 | 0.0 | 0.3*** | 4 | 3.0 | 0.8 | 0.7*** |
| AC152 | 4 | 2.7 | 0.4 | 0.6ns | 4 | 3.5 | 1.0 | 0.7*** | 2 | 2.0 | 1.0 | 0.5*** | 3 | 2.3 | 0.4 | 0.6ns | 3 | 1.5 | 0.0 | 0.4*** |
| AG196 | 6 | 2.8 | 0.9 | 0.6*** | 4 | 3.5 | 1.0 | 0.7*** | 4 | 2.8 | 1.0 | 0.7*** | 5 | 2.5 | 0.8 | 0.6ns | 4 | 1.4 | 0.1 | 0.3* |
| AG207 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.2 | 0.0 | 0.1*** | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.8 | 0.0 | 0.4*** | 3 | 1.8 | 0.0 | 0.5*** |
| AG223 | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.4 | 0.0 | 0.3*** | 2 | 2.0 | 0.0 | 0.5*** | 3 | 1.5 | 0.0 | 0.4*** |
| AG224 | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.1 | 0.0 | 0.1*** | 4 | 1.2 | 0.0 | 0.2*** |
| AG225 | 5 | 3.8 | 0.0 | 0.7*** | 2 | 1.7 | 0.0 | 0.4*** | 1 | 1.0 | 0.0 | 0.0 | 3 | 1.7 | 0.0 | 0.4*** | 6 | 3.6 | 0.8 | 0.7ns |
| AC139 | 4 | 2.2 | 1.0 | 0.5*** | 4 | 2.3 | 1.0 | 0.6*** | 2 | 2.0 | 1.0 | 0.5*** | 3 | 2.5 | 0.8 | 0.6ns | 4 | 3.2 | 0.5 | 0.7ns |
| AC143 | 3 | 1.7 | 0.5 | 0.4ns | 4 | 2.3 | 1.0 | 0.6*** | 4 | 2.4 | 1.0 | 0.6*** | 7 | 3.4 | 0.8 | 0.7ns | 4 | 2.0 | 0.1 | 0.5*** |
| AC149 | 4 | 2.1 | 0.5 | 0.5ns | 2 | 2.0 | 0.8 | 0.5* | 4 | 1.9 | 0.5 | 0.5ns | 4 | 2.4 | 0.8 | 0.6ns | 10 | 4.4 | 0.7 | 0.8ns |
| AC150 | 2 | 1.9 | 0.0 | 0.5*** | 1 | 1.0 | 0.0 | 0.0 | 3 | 1.5 | 0.0 | 0.3*** | 2 | 1.1 | 0.0 | 0.1*** | 6 | 3.2 | 0.7 | 0.7ns |
| AC155 | 3 | 2.2 | 0.8 | 0.5*** | 3 | 2.1 | 0.6 | 0.5ns | 2 | 1.9 | 0.8 | 0.5* | 5 | 2.6 | 0.3 | 0.6** | 5 | 1.8 | 0.0 | 0.4*** |
| AC165 | 4 | 2.7 | 0.5 | 0.6ns | 2 | 2.0 | 0.0 | 0.5*** | 2 | 1.2 | 0.0 | 0.2*** | 2 | 1.8 | 0.7 | 0.5* | 4 | 2.5 | 0.0 | 0.6*** |
| AC170 | 2 | 1.2 | 0.2 | 0.2ns | 2 | 1.4 | 0.0 | 0.3*** | 2 | 1.4 | 0.0 | 0.3*** | 2 | 1.1 | 0.0 | 0.1*** | 5 | 3.4 | 0.9 | 0.7ns |
| AC171 | 5 | 2.5 | 0.7 | 0.6ns | 2 | 1.3 | 0.2 | 0.2ns | 2 | 1.7 | 0.5 | 0.4ns | 1 | 1.0 | 0.0 | 0.0 | 8 | 3.7 | 0.1 | 0.7*** |
| AC172 | 2 | 1.7 | 0.5 | 0.4ns | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 3 | 1.8 | 0.6 | 0.4ns | 6 | 4.5 | 0.6 | 0.8* |
| AC176 | 2 | 1.5 | 0.4 | 0.3ns | 2 | 1.9 | 0.0 | 0.5*** | 2 | 2.0 | 0.0 | 0.5*** | 2 | 2.0 | 0.0 | 0.5*** | 4 | 2.3 | 0.2 | 0.6*** |
| AC178 | 2 | 1.5 | 0.0 | 0.4*** | 2 | 1.7 | 0.0 | 0.4*** | 2 | 1.4 | 0.0 | 0.3*** | 2 | 2.0 | 0.0 | 0.5*** | 4 | 1.9 | 0.6 | 0.5ns |
| AC182a | 3 | 1.7 | 0.5 | 0.4ns | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.3 | 0.0 | 0.2*** | 3 | 1.2 | 0.0 | 0.2*** |
| AC182b | 3 | 1.5 | 0.0 | 0.3*** | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.2 | 0.0 | 0.2*** | 2 | 1.1 | 0.0 | 0.1*** | 2 | 1.1 | 0.0 | 0.1*** |
| AC186 | 2 | 1.7 | 0.0 | 0.4*** | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.2 | 0.0 | 0.2*** | 3 | 1.7 | 0.3 | 0.4ns | 2 | 1.9 | 0.7 | 0.5* |
| AC189 | 3 | 2.9 | 0.0 | 0.7*** | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.3 | 0.0 | 0.2*** | 5 | 1.8 | 0.0 | 0.5*** |
| AC198b | 3 | 2.9 | 0.6 | 0.7ns | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.7 | 0.0 | 0.4*** | 2 | 1.4 | 0.0 | 0.3*** | 3 | 1.3 | 0.0 | 0.2*** |
| AC206 | 4 | 2.0 | 0.0 | 0.5*** | 2 | 2.0 | 1.0 | 0.5*** | 2 | 2.0 | 1.0 | 0.5*** | 3 | 1.7 | 0.4 | 0.4ns | 4 | 1.7 | 0.1 | 0.4*** |
| AC136 | 2 | 2.0 | 0.0 | 0.5*** | 2 | 2.0 | 0.0 | 0.5*** | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 4 | 2.0 | 0.8 | 0.5** |
| AC111 | 2 | 1.9 | 0.0 | 0.5*** | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.9 | 0.0 | 0.5*** | 2 | 1.4 | 0.0 | 0.3*** |
| AC112 | 2 | 1.7 | 0.0 | 0.4*** | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.1 | 0.0 | 0.1*** | 5 | 2.7 | 0.8 | 0.6ns |
| AC129 | 2 | 1.7 | 0.0 | 0.4*** | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.4 | 0.0 | 0.3*** | 2 | 1.5 | 0.0 | 0.3*** |
| AC130 | 2 | 1.7 | 0.5 | 0.4ns | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.9 | 0.0 | 0.5*** | 3 | 1.8 | 0.4 | 0.4ns | 2 | 1.2 | 0.0 | 0.1*** |
| AC131 | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.1 | 0.0 | 0.1*** | 3 | 1.5 | 0.0 | 0.4*** |
| AC132 | 6 | 4.4 | 0.8 | 0.8ns | 4 | 3.4 | 0.6 | 0.7ns | 6 | 4.6 | 1.0 | 0.8*** | 6 | 4.5 | 0.6 | 0.8ns | 5 | 1.4 | 0.0 | 0.3*** |
| AG135 | 2 | 1.8 | 0.0 | 0.4*** | 2 | 1.2 | 0.0 | 0.1*** | 3 | 1.8 | 0.0 | 0.4*** | 3 | 1.9 | 0.0 | 0.5*** | 5 | 2.7 | 0.0 | 0.6*** |
| AC173 | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.2 | 0.0 | 0.2*** | 3 | 1.1 | 0.1 | 0.1ns | 5 | 3.8 | 1.0 | 0.7*** |
| Mean | 2.8 | 1.9 | 0.3 | 0.4 | 2.0 | 1.6 | 0.2 | 0.3 | 2.1 | 1.6 | 0.2 | 0.3 | 2.7 | 1.8 | 0.2 | 0.4 | 4.2 | 2.4 | 0.3 | 0.5 |
A = number of alleles; A e = number of effective alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
aVoucher and locality information are provided in Appendix 1.
bDeviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001, ns = not significant.
All 39 microsatellite markers were cross‐amplified to N. pumila subsp. sinensis and N. japonica under the same conditions described above, except for annealing procedures displaced by optimal annealing temperature (Table 1). For N. pumila subsp. sinensis and N. japonica, the highest numbers of alleles per locus were four and nine, respectively, and the highest numbers of effective alleles were 3.8 and 6.8, respectively (Table 3). Both N. pumila subsp. sinensis and N. japonica showed high H o levels of 1.0 and high H e levels of 0.7 and 0.8, respectively. In addition, locus AC182b was found to be monomorphic between the two species.
Table 3.
Results of cross‐amplification of 39 newly developed microsatellite loci for Nuphar shimadai in N. pumila subsp. sinensis and N. japonica.a
| Locus | Nuphar pumila subsp. sinensis (n = 5) | Nuphar japonica (n = 20) | ||||||
|---|---|---|---|---|---|---|---|---|
| A | A e | H o | H e b | A | A e | H o | H e b | |
| AG144 | 1 | 1.0 | 0.0 | 0.0 | 5 | 4.2 | 0.7 | 0.7ns |
| AG146 | 2 | 2.0 | 1.0 | 0.5*** | 7 | 4.3 | 0.9 | 0.8ns |
| AG152 | 2 | 2.0 | 1.0 | 0.5*** | 6 | 5.2 | 1.0 | 0.8*** |
| AG158 | 2 | 1.5 | 0.0 | 0.3*** | 3 | 2.2 | 0.0 | 0.6*** |
| AG159 | 1 | 1.0 | 0.0 | 0.0 | 3 | 2.8 | 0.8 | 0.7ns |
| AG164 | 2 | 2.0 | 1.0 | 0.5*** | 8 | 6.1 | 1.0 | 0.8*** |
| AG167 | 2 | 1.5 | 0.0 | 0.3*** | 4 | 3.4 | 0.6 | 0.7ns |
| AC152 | 2 | 2.0 | 1.0 | 0.5*** | 3 | 2.4 | 0.3 | 0.6** |
| AG196 | 2 | 1.5 | 0.0 | 0.3*** | 4 | 3.1 | 0.1 | 0.7*** |
| AG207 | 1 | 1.0 | 0.0 | 0.0 | 5 | 3.2 | 0.1 | 0.7*** |
| AG223 | 2 | 2.0 | 1.0 | 0.5*** | 3 | 2.0 | 0.8 | 0.5** |
| AG224 | 2 | 2.0 | 1.0 | 0.5*** | 9 | 5.6 | 0.9 | 0.8ns |
| AG225 | 1 | 1.0 | 0.0 | 0.0 | 4 | 3.1 | 0.1 | 0.7*** |
| AC139 | 1 | 1.0 | 0.0 | 0.0 | 4 | 3.2 | 0.8 | 0.7ns |
| AC143 | 1 | 1.0 | 0.0 | 0.0 | 7 | 4.8 | 0.1 | 0.8*** |
| AC149 | 2 | 1.9 | 0.8 | 0.5ns | 9 | 6.8 | 0.9 | 0.6** |
| AC150 | 2 | 1.5 | 0.4 | 0.3ns | 7 | 4.0 | 0.5 | 0.8** |
| AC155 | 4 | 2.9 | 1.0 | 0.7*** | 8 | 4.2 | 0.5 | 0.7ns |
| AC165 | 1 | 1.0 | 0.0 | 0.0 | 5 | 2.4 | 0.0 | 0.6*** |
| AC170 | 1 | 1.0 | 0.0 | 0.0 | 7 | 4.2 | 0.2 | 0.7*** |
| AC171 | 2 | 1.2 | 0.2 | 0.2ns | 7 | 3.8 | 0.3 | 0.7*** |
| AC172 | 1 | 1.0 | 0.0 | 0.0 | 3 | 2.4 | 0.6 | 0.6ns |
| AC176 | 4 | 3.8 | 1.0 | 0.7*** | 5 | 2.3 | 0.1 | 0.6*** |
| AC178 | 2 | 2.0 | 1.0 | 0.5*** | 5 | 3.5 | 0.3 | 0.7*** |
| AC182a | 1 | 1.0 | 0.0 | 0.0 | 3 | 2.2 | 0.0 | 0.6*** |
| AC182b | 1 | 1.0 | 0.0 | 0.0 | 1 | 1.0 | 0.0 | 0.0 |
| AC186 | 2 | 2.0 | 1.0 | 0.5*** | 5 | 4.1 | 0.8 | 0.8ns |
| AC189 | 1 | 1.0 | 0.0 | 0.0 | 3 | 2.6 | 0.4 | 0.6ns |
| AC198b | 1 | 1.0 | 0.0 | 0.0 | 7 | 3.7 | 0.2 | 0.7*** |
| AC206 | 1 | 1.0 | 0.0 | 0.0 | 4 | 3.1 | 0.0 | 0.7*** |
| AC136 | 1 | 1.0 | 0.0 | 0.0 | 2 | 2.0 | 0.4 | 0.5ns |
| AC111 | 2 | 1.9 | 0.0 | 0.5*** | 3 | 2.4 | 0.0 | 0.6*** |
| AC112 | 2 | 2.0 | 1.0 | 0.5*** | 8 | 5.8 | 0.9 | 0.8ns |
| AC129 | 1 | 1.0 | 0.0 | 0.0 | 4 | 2.4 | 0.1 | 0.6*** |
| AC130 | 2 | 1.9 | 0.0 | 0.5*** | 5 | 3.7 | 0.5 | 0.7ns |
| AC131 | 1 | 1.0 | 0.0 | 0.0 | 2 | 1.2 | 0.0 | 0.2*** |
| AC132 | 1 | 1.0 | 0.0 | 0.0 | 6 | 3.6 | 0.3 | 0.7*** |
| AG135 | 2 | 1.5 | 0.0 | 0.3*** | 4 | 3.6 | 0.0 | 0.7*** |
| AC173 | 2 | 2.0 | 1.0 | 0.5*** | 9 | 4.1 | 0.5 | 0.8*** |
| Mean | 1.6 | 1.5 | 0.3 | 0.3 | 5.1 | 3.5 | 0.4 | 0.7 |
A = number of alleles; A e = number of effective alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
aVoucher and locality information are provided in Appendix 1.
bDeviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001, ns = not significant.
CONCLUSIONS
In the present study, we developed 39 microsatellite loci in N. shimadai and demonstrated their cross‐amplification in two closely related species, N. pumila subsp. sinensis and N. japonica. For conservation purposes, these markers will be useful tools in the evaluation of genetic diversity of the endangered N. shimadai in Taiwan. Based on the applicability of these markers in the related species identified here, they will be useful in future investigations of genetic variation and evolutionary history of Nuphar and related taxa.
AUTHOR CONTRIBUTIONS
H.Y.L., H.C.S., L.P.J., and Y.C.C. conceived and designed the experiments. H.Y.L., H.C.S., L.P.J., C.C.H., and Y.C.C. performed the experiments. H.Y.L., H.C.S., and Y.C.C. analyzed the data. H.Y.L., L.P.J., C.C.H., and Y.C.C. contributed reagents, materials, or analysis tools. H.Y.L. and Y.C.C. wrote the paper. H.Y.L., H.C.S., L.P.J., C.C.H., and Y.C.C. conceived of the study, edited the manuscript, and approved the final manuscript.
DATA ACCESSIBILITY
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1 and Appendix 2.
ACKNOWLEDGMENTS
This research was supported by funding from the Ministry of Science and Technology, Taiwan (MOST 105‐2621‐B‐110‐003‐MY3 and MOST 105‐2621‐B‐110‐001 to Y.C.C.), and partial grants from the National Sun Yat‐sen University (NSYSU) Higher Education Sprout Project.
Appendix 1. Locality and voucher information of sampled populations of Nuphar shimadai in Taiwan and two related Nuphar species of mainland China and Japan.
| Species | Voucher specimen accession no.a | Collection locality | Locality code | Geographic coordinates | n |
|---|---|---|---|---|---|
| N. shimadai Hayata | Ju3171–Ju3192 | Taoyuan, Taiwan | WP | 24°53′16″N, 121°11′39″E | 22 |
| Ju3206–Ju3216 | Taoyuan, Taiwan | GPa | 24°52′46″N, 121°11′33″E | 11 | |
| Ju3193–Ju3205 | Taoyuan, Taiwan | GPb | 24°52′44″N, 121°11′34″E | 13 | |
| Ju3230–Ju3245 | Taoyuan, Taiwan | GPn | 24°53′01″N, 121°11′36″E | 16 | |
| Ju2976–Ju3051; Ju3053–Ju3054 | Ilan, Taiwan | LD | 24°45′27″N, 121°35′38″E | 78 | |
| N. pumila (Timm) DC. subsp. sinensis (Hand.‐Mazz.) Padgett | Ju3218; Ju3220 | Jiangxi Province, China | GJ | 29°33′09″N, 115°58′13″E | 5 |
| N. japonica DC. | Ju3221; Ju3224 | Owase, Japan | JP | 36°56′01″N, 139°17′42″E | 20 |
Appendix 2. Characteristics of 33 monomorphic microsatellite loci developed in Nuphar shimadai.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size (bp) | GenBank accession no. |
|---|---|---|---|---|
| NS‐AG‐171 | F: TACAAGGCATGTGTTACAGC | (TC)11 | 158 | MH700494 |
| R: GAGACCTTACACTTGCCAAG | ||||
| NS‐AG‐175 | F: GAAGAAGTCTTACCTTGAAG | (GA)22 | 156 | MH700495 |
| R: AAGATCAACCGGCTATCTTG | ||||
| NS‐AG‐187 | F: GGTCAATGAGAGTTTGTAGG | (TG)10 | 178 | MH700496 |
| R: TATGTTTCCCTCGTGCACAG | ||||
| NS‐AG‐216 | F: AATGTCACCGTAGTTGTCAC | (AG)21 | 145 | MH700497 |
| R: TACCCGTTGATAAGAGCGAC | ||||
| NS‐AC‐145 | F: AGGAAGATTGACCGAGAAGC | (AG)17 | 192 | MH700498 |
| R: ATTGTTCGGTTCATGGGTTC | ||||
| NS‐AC‐158 | F: TTGCTCCTATATGACGGCTG | (AG)19 | 215 | MH700499 |
| R: CAGCCGTCATATAGGAGCAA | ||||
| NS‐AC‐168 | F: TTTGGTTCATATCGCTGACC | (TTG)7 | 171 | MH700500 |
| R: TCCCAAGGCTATTCCTTATG | ||||
| NS‐AC‐175 | F: ATCAGTCCCTATTGATCACG | (AG)23 | 152 | MH700501 |
| R: ACGAGTTTTCTATTGTGCAG | ||||
| NS‐AC‐196 | F: ACCACCTCAACAATGGAGTC | (GA)20 | 157 | MH700502 |
| R: AGAAAGTTATGATGGGGAGC | ||||
| NS‐AC‐198a | F: CGACACCATGAGTCAATGAC | (TG)8 | 176 | MH700503 |
| R: TGCCATGGTGTTGCCGAATG | ||||
| NS‐AG‐58 | F: ACTCACGTGCTGCGAACATG | (AG)28 | 195 | MH700504 |
| R: GGGCAGAACGAGAAAATGCC | ||||
| NS‐AG‐7 | F: CGATGACATACATCCGTTGC | (TC)23 | 158 | MH700505 |
| R: GATCATATTTGGAGCCCGAG | ||||
| NS‐AG‐12 | F: ACTAAGGGCATGTTTGGAAG | (AG)22 | 247 | MH700506 |
| R: TGTTCTTGTTCAGTTCATGG | ||||
| NS‐AG‐25 | F: AGTGAGAAGACGTACTGAGG | (AG)16 | 162 | MH700507 |
| R: GCTACAGGATTCTCAATGTTG | ||||
| NS‐AG‐26 | F: TTTGAACACCTCTCGGTAAC | (AG)40 | 203 | MH700508 |
| R: GGAAGATTATTAGACCCTAG | ||||
| NS‐AG‐37 | F: CCAAACCTGGACAACAAAAC | (TC)9 | 124 | MH700509 |
| R: AGCATCCAAGTCACTCAAGC | ||||
| NS‐AG‐38 | F: GTCTCAACCTTCTCCGAAGC | (AG)22 | 184 | MH700510 |
| R: TAAGGTGGAAGAGGCAACCC | ||||
| NS‐AG‐43 | F: TAAGGCATGAAGGAAGAGAG | (TC)23 | 168 | MH700511 |
| R: AACTAGTACTTGTATCCCTG | ||||
| NS‐AG‐49 | F: TGAACTTGTCATGCTGCACC | (AG)15 | 182 | MH700512 |
| R: ACTAGTTTATGCATCCCACG | ||||
| NS‐AC‐94 | F: TAAGCAGGTAGATGCCTGTC | (TG)21 | 127 | MH700513 |
| R: CAGCAAAGCACCAGTGCTAG | ||||
| NS‐AC‐103 | F: ATGAGTCGTGGGTAACCATG | (AC)9 | 149 | MH700514 |
| R: GGGGGTCTTATGATAGCTTG | ||||
| NS‐AC‐119 | F: CCTAATAACAAGGGAGTTGG | (TC)20 | 171 | MH700515 |
| R: ATATAGAAAGTGGGCCTGTG | ||||
| NS‐AC‐120 | F: TTGTTAGACTGAAAGAGTCG | (AG)9 | 141 | MH700516 |
| R: CATTCATGCATGTCAATGTG | ||||
| NS‐AC‐133 | F: ATACTGCAACATACTCGAGC | (TG)9 | 160 | MH700517 |
| R: TTTGGAGGAAAGGGATAAAC | ||||
| NS‐AC‐134 | F: ATGGATTCCACCATGAGTCC | (TC)20 | 171 | MH700518 |
| R: TTCCCTCGTTGATCTTATTG | ||||
| NS‐AG‐151 | F: TGCACGTGAACTAAATCCTG | (AC)8 | 135 | MH700519 |
| R: TTTTAGATCACAGCTGCATC | ||||
| NS‐AG‐75 | F: GATTGAGAAGATGCAACCTG | (AG)25 | 209 | MH700520 |
| R: GATCCAAAGAATATGTTGCC | ||||
| NS‐AG‐91 | F: TTTTCACGGGTAGGATCTAC | (CT)25 | 226 | MH700521 |
| R: ATTGACTGATACCCCTTACC | ||||
| NS‐AG‐104 | F: TTTTGCAACCATCTTTTGCC | (TC)24(AC)11 | 171 | MH700522 |
| R: ATAGGTTGTCTACAATCCAG | ||||
| NS‐AG‐119 | F: CACGCTCCCAAGATCAATTG | (AG)18 | 158 | MH700523 |
| R: TAACCCATGTATGGGTTGAG | ||||
| NS‐AG‐153 | F: TTCTAGCCAAAGCAAATAGG | (AG)9 | 164 | MH700524 |
| R: GTCACGATTTCATTAGCAGC | ||||
| NS‐AG‐65 | F: TTTGATTCACACGGCCTGCC | (CT)8 | 121 | MH700525 |
| R: TGCCTGCAGGTCGACTCTAG | ||||
| NS‐AG‐113 | F: TAACGATAACATGGGGAGTT | (CT)14 | 126 | MH700526 |
| R: AAAATGAAGAGGGATGGTGG |
Lu, H.‐Y. , Shih H.‐C., Ju L.‐P., Hwang C.‐C., and Chiang Y.‐C.. 2018. Characterization of 39 microsatellite markers from Nuphar shimadai (Nymphaeaceae) and cross‐amplification in two related taxa. Applications in Plant Sciences 6(10): e1188.
Notes
n = number of individuals sampled.
Herbarium vouchers are deposited in the Herbarium of the Taiwan Forestry Research Institute (TAIF).
LITERATURE CITED
- Benson, G. 1999. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Research 27: 573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chiang, Y. C. , Shih H. C., Chang L. W., Li W. R., Lin H. Y., and Ju L. P.. 2011. Isolation of 16 polymorphic microsatellite markers from an endangered and endemic species, Podocarpus nakaii (Podocarpaceae). American Journal of Botany 98: e306–e309. [DOI] [PubMed] [Google Scholar]
- IUCN . 2012. IUCN Red List categories and criteria: version 3.1, 2nd ed. Gland, Switzerland, and Cambridge, United Kingdom
- Kalendar, R. , Lee D., and Schulman A. H.. 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics 98: 137–144. [DOI] [PubMed] [Google Scholar]
- Kondo, T. , Watanabe S., Shiga T., and Isagi Y.. 2016. Microsatellite markers for Nuphar japonica (Nymphaeaceae), an aquatic plant in the agricultural ecosystem of Japan. Applications in Plant Sciences 4: 1600082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liao, P. C. , Gong X., Shih H. C., and Chiang Y. C.. 2009. Isolation and characterization of eleven polymorphic microsatellite loci from an endemic species, Piper polysyphonum (Piperaceae). Conservation Genetics 10: 1911–1914. [Google Scholar]
- Ouborg, N. J. , Goodall‐Copestake W. P., Saumitou‐Laprade P., Bonnin I., and Epplen J. T.. 2000. Novel polymorphic microsatellite loci isolated from the yellow waterlily, Nuphar lutea . Molecular Ecology 9: 497–498. [DOI] [PubMed] [Google Scholar]
- Padgett, D. J. , Les D. H., and Crow G. E.. 1999. Phylogenetic relationships in Nuphar (Nymphaeaceae): Evidence from morphology, chloroplast DNA, and nuclear ribosomal DNA. American Journal of Botany 86: 1316–1324. [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shiga, T. , Ishii J., Isagi Y., and Kadono Y.. 2006. Nuphar submersa (Nymphaeaceae), a new species from central Japan. Acta Phytotaxonomica et Geobotanica 57: 113–122. [Google Scholar]
- Wang, J. C. , Chiou W. L., and Chang H. M.. 2012. A preliminary red list of Taiwanese vascular plants. Endemic Species Research Institute, Nantou, Taiwan. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1 and Appendix 2.