Abstract
Mannose phosphotransferase system (Man-PTS) serves as a receptor for several bacteriocins in sensitive bacterial cells, namely subclass IIa bacteriocins (pediocin-like; pediocins) and subclass IId ones - lactococcin A (LcnA), lactococcin B (LcnB) and garvicin Q (GarQ). Here, to identify the receptor for three other narrow-spectrum subclass IId bacteriocins - garvicins A, B and C (GarA-C) Lactococcus garvieae mutants resistant to bacteriocins were generated and sequenced to look for mutations responsible for resistance. Spontaneous mutants had their whole genome sequenced while in mutants obtained by integration of pGhost9::ISS1 regions flanking the integration site were sequenced. For both types of mutants mutations were found in genes encoding Man-PTS components IIC and IID indicating that Man-PTS likely serves as the receptor for these bacteriocins as well. This was subsequently confirmed by deletion of the man-PTS operon in the bacteriocin-sensitive L. garvieae IBB3403, which resulted in resistant cells, and by heterologous expression of appropriate man-PTS genes in the resistant Lactococcus lactis strains, which resulted in sensitive cells. GarA, GarB, GarC and other Man-PTS-targeting bacteriocins differ in the amino acid sequence and activity spectrum, suggesting that they interact with the receptor through distinct binding patterns. Comparative analyses and genetic studies identified a previously unrecognized extracellular loop of Man-PTS subunit IID (γ+) implicated in the L. garvieae sensitivity to the bacteriocins studied here. Additionally, individual amino acids localized mostly in the sugar channel-forming transmembrane parts of subunit IIC or in the extracellular parts of IID likely involved in the interaction with each bacteriocin were specified. Finally, template-based 3D models of Man-PTS subunits IIC and IID were built to allow a deeper insight into the Man-PTS structure and functioning.
Introduction
Mannose phosphotransferase system (Man-PTS) is a major phosphoenolpyruvate (PEP)-dependent sugar transporting system for mannose uptake and its concurrent phosphorylation in Firmicutes and Gammaproteobacteria1. It has a fairly broad substrate specificity as, besides mannose, it can also transport glucose, fructose, glucosamine, N-acetylglucosamine and galactosamine2. It is a multi-component system, composed of general PTS proteins, enzyme I and HPr (phosphoryl group donors for different PTS permeases), and enzyme II, which is a permease specific for the carbohydrates listed above. Enzyme II consists of the cytoplasmatic subunits IIA and IIB and the membrane subunits IIC and IID. The intracellular components transfer the phosphoryl group from PEP to the incoming sugar substrate while the membrane components form a sugar-specific binding site and translocation channel1. It has been proposed that in addition to its basic transport-related function, Man-PTS can also regulate a variety of intracellular processes, including metabolism, mutagenesis and gene expression3. Moreover, Man-PTS is also a target for several antimicrobial agents, such as bacteriocins4, and bacteriophage lambda5. Importantly, Man-PTS is considered as convenient drug target as it is absent in eukaryotic cells6.
Early studies indicating that Man-PTS may serve as a receptor for bacteriocins based on the observation that mutants resistant to some subclass IIa bacteriocins (pediocin-like bacteriocins; pediocins) exhibited no or low level of expression of Man-PTS-encoding genes7–10. Also heterologous expression of the Man-PTS-encoding genes in a resistant strain caused sensitivity to pediocins11. Nonetheless, a definitive conclusion that Man-PTS is a bacteriocin receptor came from a study by Diep et al.4. Using immunoprecipitation, they also showed that several subclass IIa bacteriocins and two subclass IId bacteriocins - lactococcin A (LcnA) and lactococcin B (LcnB) (LcnA-like bacteriocins; lactococcins) interact with the components of Man-PTS and that for self-protection, an immunity protein directly binds the receptor and the bacteriocin in a tripartite complex (receptor:bacteriocin:immunity). Recently, another subclass IId bacteriocin, garvicin Q (GarQ), was shown to employ Man-PTS IIC and IID components as target12.
Amongst the three Man-PTS phylogenetic groups, only one (group I) can serve as a receptor for class II bacteriocins13. This group is characterized by the presence of three distinct regions termed α, β and γ. Region α is localized in the N-terminal part of subunit IIC and, depending on the host sensitivity, it contains a conserved GGQGxxG or GG[D/K]FxxxG sequence, where x indicates any amino acid. Region β is localized in the C-terminal part of subunit IIC, is rich in glycine and contains a conserved DP[I/L/V]GDI[I/L][D/E/N]xY sequence. Region γ is localized in subunit IID and contains a sequence of 35–40 amino acids which is absent in the IID components from phylogenetic groups II and III.
The distinct features of the α, β and γ regions of the phylogenetic group I Man-PTS play a key role in the host sensitivity to bacteriocins. Subclass IIa bacteriocins are known to have a broad antimicrobial spectrum being active against bacteria from the genera Carnobacterium, Clostridium, Enterococcus, Lactobacillus, Leuconostoc, Listeria, Pediococcus and Streptococcus. They are most active against Listeria and Enterococcus spp. that harbor the mptACD operon encoding Man-PTS containing regions α, β and γ. On the other hand, LcnA-like bacteriocins have an extremely narrow activity spectrum as they target only Lactococcus lactis strains in which Man-PTS encoded by the ptnABCD operon lacks the α region6,14. The susceptibility to pediocins depends on the presence of region α, whereas unspecified regions of both IIC and IID subunits from lactococcal Man-PTS are essential for the specific recognition by lactococcins6,14. Interestingly, GarQ is active against both listerial and lactococcal species including Lactococcus garvieae that harbors the manABCD operon encoding Man-PTS and is resistant to pediocin- and LcnA-like bacteriocins. It has been proposed that the interaction of GarQ with its receptor may involve a few amino acids located in the N-terminal part and the extracellular loop (region γ) of subunit IID and in the transmembrane region of subunit IIC12.
The three subclass IId bacteriocins investigated in this study are encoded by plasmids from a human blood isolate L. garvieae 2188115. Garvicin A (GarA) is encoded by pGL5 together with genes responsible for immunity and secretion. It has a narrow activity spectrum limited only to other L. garvieae strains, including many animal and human pathogenic strains15. The other two bacteriocins (accession no. WP_014386584.1 and WP_014386275.1), here named Garvicin B (GarB) and Garvicin C (GarC), are encoded respectively by pGL2 and pGL1 plasmids and, unlike GarA, they are not expressed in the host strain probably due to a lack of genes required for their secretion. The precursors of GarA, GarB and GarC contain leader peptides of 20 or 21 amino acids with a typical double-glycine motif, whereas their mature peptides are 43 (GarA) or 51 (GarB and GarC) amino acids long. The GarA prepeptide shows 50% and 42.9% identity with the GarB and GarC prepeptides, respectively, while mature GarA is 42.3% and 19.6% identical with mature GarB and GarC peptides15.
In the present study we identified Man-PTS as a receptor for the three bacteriocins GarA, GarB and GarC. These bacteriocins use distinct bacteriocin - receptor binding patterns when compared to each other and to the Man-PTS-targeting bacteriocins characterized earlier. Among the specific amino acids from distinct regions of L. garvieae Man-PTS IICD engaged in the bacteriocin – receptor interaction, those from the IID extracellular loop (region γ+) seem to be the most important for the interaction with all three garvicins. The constructed 3D models of Man-PTS IICD indicated transmembrane localization of subunit IIC and monotopic localization of IID suggesting, respectively, entry and docking receptor functions for these subunits.
Materials and Methods
Bacterial strains, plasmids and culture conditions
The bacterial strains and plasmids used in this study are listed in Supplementary Table S1. Indicator strains, L. garvieae IBB3403-derived strains with random mutations, deletion or complementation of the manABCD operon, L. lactis IL1403-derived strains and L. lactis NZ9000-derived strains were grown in brain heart infusion (BHI) medium (Oxoid, Hampshire, UK) at 30 °C. L. garvieae IBB3403-derived strains with missense mutations were grown in chemically defined medium (CDM)16 supplemented with 1% mannose (man-CDM) at 30 °C. When appropriate, erythromycin (Ery) and/or chloramphenicol (Cam) were added to the concentration of 5 µg/ml each. Escherichia coli EC1000-derived strains were grown in Luria-Bertani (LB) medium (Becton, Dickinson and Company, East Rutherford, NJ, USA) at 37 °C. When appropriate erythromycin, chloramphenicol or ampicillin (Amp) were added to 75 µg/ml, 20 µg/ml or 100 µg/ml, respectively. Transcription of the manABCD operon cloned in pNZ8037 was induced by the addition of nisin to the concentration between 10 and 50 ng/ml. Soft agar (soft BHI-agar, soft man-CDM-agar) and agar plates (BHI-agar, man-CDM-agar) were prepared by adding agar (Merck, Darmstadt, Germany) to 0.75% and 1.5%, respectively.
Bacteriocin preparation
Lyophilized bacteriocins with a purity of over 95% for GarA and over 90% for GarB and GarC were synthesized by a commercial service (PepMic, Suzhou, China). Before use, the peptides were dissolved at 1 mg/ml in 0.1% trifluoroacetic acid (TFA) (Sigma, Darmstadt, Germany).
Inhibitory spectrum assay and selection of resistant mutants
The activity spectrum of bacteriocins was determined and resistant mutants with random or missense mutations within manABCD operon were obtained as described before12.
DNA isolation and manipulation
PCR products were purified using Wizard® SV Gel and PCR Clean-Up System (Promega, Fitchburg, WI, USA). Plasmids and genomic DNA were isolated using, respectively, PureYieldTM Plasmid Mini-prep System (Promega, Fitchburg, WI, USA) and Genomic Mini Kit (A&A Biotechnology, Gdynia, Poland). Samples for genome sequencing were prepared with Nextera XT DNA Sample Preparation Kit, Nextera XT Indexing Kit and PhiX Control V3 Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. Miseq Sequencer (Illumina, San Diego, CA, USA) was used for sequencing. For data analysis DNAStar SeqMan Gen program (DNAStar, Madison, WI, USA) was used. Samples for manCD sequencing were prepared by PCR with manCfor/rev and manDfor/rev primers (Supplementary Table S1). In silico translation was performed with the translate tool on the ExPasy online server17 (https://www.expasy.org/). Amino acid sequences were compared using the MultAlin software18 (http://multalin.toulouse.inra.fr/multalin/) or Clustal Omega software at the EMBL-EBI online server19 (https://www.ebi.ac.uk/services). Conserved domains were identify using CD-search online service at the NCBI Conserved Domain Database20–23 (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml). Prediction of transmembrane protein regions was done with the HMMTOP server24,25 (http://www.enzim.hu/hmmtop/). Signal peptide were predicted using SignalP 4.1 online server26 (http://www.cbs.dtu.dk/services/SignalP/). Predicted topology of Man-PTS subunits IIC and IID was visualized with Protter27 (http://wlab.ethz.ch/protter/). Template-based 3D models of GarA, GarB, GarC and Man-PTS subunits IIC and IID were built with the I-TASSER web service28–30 (https://zhanglab.ccmb.med.umich.edu/I-TASSER/). For GarA, GarB and GarC, respectively CDI toxin-immunity protein complex from E. coli (PDB ID 5HKQA), fragment of FlgE, the hook protein from Campylobacter jejuni (PDB ID 5AZ4A) and carbonyl sulfide hydrolase from Thiobacillus thioparus (PDB ID 3VQJA) were used as a templates of the highest significance. For IIC and IID, cation-bound Multidrug and Toxin Compound Extrusion transporter from Vibrio cholerae (PDB ID 3MKTA) was used as a template of the highest significance. Orientation of the 3D models in the membrane was predicted with the PPM web server31 (http://opm.phar.umich.edu). The 3D models were visualized using the PyMOL Molecular Graphics System, Version 2.0 (Schrödinger, LLC; https://pymol.org/2/).
Non-specific mutagenesis by plasmid integration
Plasmid pGhost9::ISS1 was transformed into L. garvieae IBB3403 cells by electroporation and chromosomal DNA was randomly mutagenized by its integration as described by Maguin et al.32, with minor modifications including the use of BHI medium, 1000-fold dilution and incubation at 30 °C for 150 min and then 37 °C for 150 min. Aliquots of 1, 2 and 5 ml of the mutagenized L. garvieae IBB3404:pGh9::ISS1 culture were centrifuged, resuspended in 100 μl of BHI medium and plated onto BHI-agar plates with Ery (5 µg/ml) and GarA (7 µg/ml) preheated to 37 °C and grown for 3 days at 37 °C. Mutant colonies were collected and their level of sensitivity to GarA was estimated using microtiter plates with two-fold bacteriocin dilutions. Next, the DNA rescue cloning procedure was applied as described previously32. Briefly, total DNA isolated from the erythromycin- and GarA-resistant pGhost9::ISS1 integration mutants was digested with EcoRI or HindIII (Thermo Fisher Scientific, Waltham, MA, USA), self-ligated with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) and used to transform an E. coli repA+ strain (EC1000) since pGhost::ISS1 due to its temperature-sensitive replicon (repA−) is unable to replicate at 37 °C. Clones containing pGhost9::ISS1 with flanking chromosomal DNA fragments (left - EcoRI or right - HindIII) were selected on LB plates containing Ery. Rescued fragments were sequenced directly from the pGhost9::ISS1 plasmid with pairs of primers pISS1Eco/pGh9 or pISS1Hind/uni (Supplementary Table S1). The sequences obtained were analysed and compared with the L. garvieae genome sequence using BLAST network service (NCBI; https://blast.ncbi.nlm.nih.gov) and standard parameters.
Construction of manABCD deletion mutants
The mutants were created by a double crossover between pGhost9 plasmids harboring DNA fragments flanking the manABCD operon or its selected genes and the chromosomal region containing these DNA fragments. DNA fragments flanking the entire manABCD operon, manCD, manC or manD genes were created by amplification with primers pairs manABCDUPfor/rev and manABCDDNfor/rev, manCDUPfor/rev and manABCDDNfor/rev, manCDUPfor/rev and manCDNfor/rev or manDUPfor/rev and manABCDDNfor/rev, respectively (Supplementary Table S1). To each UPrev and DNfor primer the EcoRI restriction site was added. After amplification, PCR products were purified, digested with EcoRI and ligated with T4 DNA ligase, which resulted in DNA fragments containing joined upstream and downstream DNA regions of the manABCD gene(s) to be deleted. An additional PCR was performed using suitable UPfor and DNrev primers and the amplified product was ligated with pGEM-T Easy vector (Promega, Fitchburg, WI, USA) by TA cloning and then cloned into pGhost9 using the ApaI and NotI (Thermo Fisher Scientific, Waltham, MA, USA). Overnight L. garvieae IBB3403 cultures harboring the above pGhost9 derivatives diluted 103-fold in BHI medium with Ery (5 µg/ml). Homologous recombination was enforced by incubation at 30 °C for 1.5 h and at 37 °C for 2.5 h. Integrants were selected at 37 °C on BHI-agar plates containing Ery (5 µg/ml). Excision from the chromosome and removing of the integration vector from the L. garvieae IBB3403 strains was performed by culturing the integrants in the absence of antibiotic for at least 100 generations at 30 °C. The genetic structure of the resulting deletion strains was confirmed by colony PCR with manABCDfor/rev primers (Supplementary Table S1), sequencing of the DNA region containing the deleted genes and determination of sensitivity to erythromycin.
Construction of Man-PTS complementing plasmids
In order to complement the deletion of the manABCD operon or its selected genes, two-plasmid nisin-controlled gene expression system (NICE) with pNZ9530 and pNZ8037 plasmids was used33,34. Amplification of the entire manABCD operon, manCD, manC or manD genes was performed using primer pairs complmanfor and complmanrev, complCDfor and complmanrev, complCDfor and complCrev or complDfor and complmanrev, respectively (Supplementary Table S1). Resulting DNA fragments were purified, digested with NcoI and XhoI and ligated with pNZ8037 plasmid. Obtained constructs were expressed in L. garvieae 548a, L. lactis B464 and/or L. lactis NZ9000. Additional complementing plasmid was created by amplification of the pNZ8037 plasmid harboring manCD genes with γ+ for/rev primers (Supplementary Table S1). Obtained construct was expressed in L. lactis B464.
Results
GarA, GarB and GarC have a narrow activity spectrum
GarA activity has been examined earlier against strains from the genera Bordetella, Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Listeria, Pediococcus, Salmonella, Staphylococcus and Streptococcus and found to be limited to L. garvieae15. In this study we used an expanded set of strains to determine the activity spectra of GarB and GarC and reexamine it for GarA. In addition to the above, we included several strains from the genera Bacillus, Campylobacter, Candida, Leuconostoc and Pseudomonas (Supplementary Table S2). GarA and GarB showed a narrow spectrum of antimicrobial activity, being highly active only against L. garvieae strains; at a high concentration (1 mg/ml), GarA exhibited minimal activity against L. lactis strains and some strains from the genera Carnobacterium, Enterococcus, Lactobacillus, Leuconostoc and Pediococcus (Supplementary Table S2). GarC exhibited a slightly wider spectrum, being potent against all Lactococcus spp. (L. garvieae, L. lactis and L. raffinolactis) strains and, to a lesser extent, also against some strains from the genera Lactobacillus and Leuconostoc (Supplementary Table S2).
Mutants resistant to GarA-C contain mutations in the manABCD operon
To identify the receptor(s) for GarA, GarB, and GarC we obtained two groups of bacteriocin-resistant L. garvieae IBB3403 mutants. The first group comprised spontaneously arising resistant strains selected against increasing bacteriocin concentration following a standard procedure12,35–37. Fifteen GarA-resistant mutants were obtained (MS1011-MS1014, MS1016-MS1018, MS1027-MS1029, MS1031-MS1033, MS1035 and MS1036; Supplementary Table S1) by exposing wild-type L. garvieae IBB3403 to 12 μg/ml on BHI-agar plates. The obtained mutants were over 1024-fold less sensitive to GarA than the parental strain and also showed full resistance to GarB and GarC. Remarkably, subsequent genome sequencing of seven randomly selected spontaneous mutants (MS1027-MS1029, MS1032, MS1033, MS1035, MS1036) revealed the presence of single mutations exclusively in the manABCD operon encoding the Man-PTS system. Direct sequencing of the manABCD operon in the remaining eight mutants unveiled single mutations in manC (MS1012, MS1018 and MS1033) or in manD (MS1011, MS1013, MS1014, MS1016, MS1017, MS1027-MS1029, MS1031, MS1032, MS1035 and MS1036). All the mutations were nonsense or frameshift ones, leading to premature termination of the manC or manD ORFs (Table 1). Notably, none of the resistant mutants had mutations in the manAB gene (Table 1), suggesting that the encoded polypeptide is not directly involved in the sensitivity to the bacteriocins.
Table 1.
L. garvieae IBB3403 mutants resistant to GarA, GarB, GarC and GarQ.
| Mutant strain | Mutation | Amino acid change | Resistance to [fold-increased relative to WT] | Position of affected amino acid(s) | Growth on mannose | |||
|---|---|---|---|---|---|---|---|---|
| GarA | GarB | GarC | GarQ | |||||
| GarA-resistant L. garvieae IBB3403 mutants | ||||||||
| MS1 | pGhost9::ISS1 integration at 714 in manC | Leu238 → fs | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS2, MS3 | pGhost9::ISS1 integration at 449 in manD | Val150 → fs | >1024 | >64 | >128 | >1024 | transmembrane | − |
| MS1011 | G283 → T in manD | Glu95 → STOP | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS1012 | C163 → T in manC | Gln55 → STOP | >1024 | >64 | >128 | >1024 | intracellular | − |
| MS1013, MS1017 | C401 → A in manD | Ser134 → STOP | >1024 | >64 | >128 | >1024 | transmembrane | − |
| MS1014, MS1028, cMS1032, MS1036 | AAT66 → GTA in manD | Met23 → STOP | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS1016 | G689 → A in manD | Trp230 → STOP | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS1018 | C359 → A in manC | Ser120 → STOP | >1024 | >64 | >128 | >1024 | transmembrane | − |
| MS1027 | insertion in manD at position 273 C | Ala91 → fs | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS1029, MS1035 | G259 → T in manD | Glu87 → STOP | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS1031 | insertion in manD at position 937 A | Gln313 → fs | >1024 | >64 | >128 | >1024 | extracellular | − |
| MS1033 | A247 → GG in manC | Met83 → fs | >1024 | >64 | >128 | >1024 | transmembrane | − |
| LGA2 | T176 → C in manC | Leu59 → Pro | 32 | 32 | 32 | 128 | intracellular | + |
| LGA3, LGA5 | G155 → T in manC | Gly52 → Val | 4 | 64 | 16 | 4 | transmembrane | + |
| LGA6, LGA13 | GTT insertion at 570–571 in manC | Val insertion at 190–191 | 8 | 32 | 64 | 4 | transmembrane | + |
| LGA10, LGA14 | C173 → A in manD | Ala58 → Asp | 2 | 4 | 4 | 2 | extracellular (N-terminus) | + |
| GarB-resistant L. garvieae IBB3403 mutants | ||||||||
| LGB1-LGB5, LGB7-LGB10, LGA8 | TTGTTGGTAACGGTGTTGCTGGT788 → GTGTTGCTGGT in manD | 262AsnValValGly265 deletion | 2 | >64 | 8 | 4 | extracellular (region γ+) | + |
| LGB6 | C937 → A in manD | Gln313 → Lys | 0 | >64 | 2 | 2 | extracellular | + |
| GarC-resistant L. garvieae IBB3403 mutants | ||||||||
| LGC1, LGC12, LGC19 | G102 → A in manD | Met34 → Ile | 0 | 0 | >128 | 0 | extracellular (N-terminus) | + |
| LGC3-LGC6, LGC9, LGC11, LGC20 | C607 → T in manD | Arg203 → Cys | 0 | >64 | >128 | 2 | extracellular | + |
| LGC8 | T676 → G in manD | Tyr226 → Asp | 8 | >64 | >128 | 16 | extracellular (region γ) | + |
| LGC13 | C317 → T in manC | Ala106 → Val | 2 | >64 | >128 | 4 | transmembrane | + |
| LGC15 | C398 → T in manD, G943 → A in manD | Ala133 → Val, Val315 → Met | 2 | >64 | >128 | 4 | transmembrane, extracellular | + |
| LGC16 | G608 → T in manD | Arg203 → Leu | 0 | >64 | >128 | 0 | extracellular | + |
| LGC18 | G563 → T in manC | Gly188 → Val | 2 | >64 | >128 | 4 | transmembrane | + |
| GarQ-resistant L. garvieae IBB3403 mutants | ||||||||
| PW202 | C299 → A in manC | Pro100 → His | 4 | 0 | 8 | >1024 | transmembrane | + |
| PW203 | C368 → T in manD | Thr123 → Ile | 0 | >64 | 0 | >1024 | extracellular (N-terminus) | + |
| PW204 | C331 → T in manD | Pro111 → Ser | 0 | >64 | 0 | >1024 | extracellular (N-terminus) | + |
| LGN1 | G902 → T in manD | Gly301 → Val | 8 | >64 | 32 | >1024 | extracellular (region γ) | + |
| LGN2 | C398 → T in manD | Ala133 → Val | 0 | 4 | 16 | 16 | transmembrane | + |
| LGN4 | G767 → T in manD | Trp256 → Leu | 0 | 4 | 8 | 16 | extracellular (region γ+) | + |
| LGN9 | C305 → T in manC | Ala102 → Val | 0 | >64 | 8 | 16 | transmembrane | + |
The second type of mutants were obtained by random integration of the pGhost9::ISS132. To identify the mutated sites in the resulting GarA-resistant mutants, we sequenced regions flanking the integration site of the plasmid. Three integration mutants were obtained (L. garvieae MS1–MS3; Supplementary Table S1) exhibiting MICGarA values over 1024-fold higher than the wild-type L. garvieae IBB3403 (0.024 µg/ml). The mutants showed full resistance to GarB and GarC, indicating cross-resistance between these bacteriocins. The DNA regions flanking the plasmid integration site in these mutants were successfully cloned, sequenced, and the obtained sequences were compared with the wild-type L. garvieae IBB3403 genome. Also in these strains, the pGhost9:ISS1 insertions occurred at two locations in the operon encoding the Man-PTS system, one between positions 714–715 in the manC gene (L. garvieae MS1) and one between positions 449–450 in the manD gene (L. garvieae MS2 and MS3; Table 1; Supplementary Table S1).
Man-PTS subunits IIC and IID are necessary for GarA-C activity
In order to examine whether the resistance to GarA, GarB and GarC was directly related to the man operon and not to any additional mutations, we deleted the operon in the sensitive L. garvieae IBB3403. Additionally, to evaluate the role of individual Man-PTS membrane subunits in the sensitivity to bacteriocins, we deleted the manC and/or manD genes. All these deletion mutants (L. garvieae B548a, B549a, B550a and B551a; Table S1 in the supplementary file) had MICGarA values over 1024-fold higher than the wild-type strain, and, all exhibited full resistance to GarB and GarC (Fig. 1). As GarA and GarC but not GarB exhibited also activity against L. lactis strains, we performed additional studies considering this species only with two first bacteriocins. Tested L. lactis B464 strain, which has the mannose-specific PTS operon (ptnABCD) deleted4, was insensitive to GarC but not to GarA (Fig. 1), indicating that in this species the Man-PTS system is required for sensitivity to GarC only.
Figure 1.

Sensitivity of L. garvieae IBB3403 and L. lactis IL1403 strains to GarA, GarB and GarC.
To assess the individual role of Man-PTS subunits in mediating bacteriocin sensitivity, we introduced respective genes in different combinations into the manABCD-deleted L. garvieae B548a strain. Since high expression of genes encoding membrane proteins is often toxic to the host cell, we applied a two-plasmid nisin-controlled gene expression (NICE) system allowing for strict control of protein production33,34. We used pNZ8037 plasmid with a nisin-responsive promoter for cloning and expressed it in manABCD-deleted L. garvieae B552a with the pNZ950 plasmid carrying nisK and nisR genes encoding membrane-located histidine kinase NisK and intracellular response regulator NisR, respectively. Unfortunately, even using this system we were unable to express the cloned genes due to plasmid instability. To overcome this problem, we employed the L. lactis B464 strain with ptnABCD deletion, which had been shown to support expression of man-PTS genes from the NICE system4. Introduction of manC or manD genes individually into L. lactis B464 (to give respectively L. lactis B559a or B560a; Table S1 in the supplementary file) had no impact on the sensitivity of L. lactis B464 to GarA, GarB and GarC. Only introduction of the entire manABCD operon or the manCD genes together (respectively L. lactis B557a and B558a; Table S1 in the supplementary file) produced clones sensitive to the bacteriocins (Fig. 1). Altogether, the results showed unequivocally that both the IIC and IID subunits of L. garvieae Man-PTS are required and sufficient for sensitivity to GarA-C.
GarA-C differ from other Man-PTS-binding bacteriocins
Pediocins, lactococcins and GarQ have previously been shown to use Man-PTS as a receptor4,12. To assess the relatedness of GarA, GarB and GarC to those bacteriocins, we compared their amino acid sequences. Neither the leader nor the mature peptides of GarA, GarB and GarC were similar to those of subclass IIa bacteriocins (pediocins)38 (Fig. 2A). In contrast, the leader peptides of GarA-C were highly similar to each other and also to the leader peptides of other subclass IId bacteriocins (LcnA, LcnB and GarQ) on their entire length. In the mature peptides similarity was very weak among GarA-C and virtually absent with LcnA, LcnB and GarQ (Fig. 2B), except for 13 N-terminal amino acids 92% identical between GarA and GarB. The predicted secondary structures of GarA-C comprised one long (17 aa; GarA) or two shorter (GarB and GarC) α-helices at the N-terminus and unstructured C-terminal parts (Fig. 3). However, a comparison of their template-based 3D structure models revealed little overall similarity (Fig. 3). Moreover, GarA was predicted to interact with the membrane through its long α-helix parallel to the membrane surface, while the interaction of GarB and GarC was predicted to occur through the unstructured fragments (Fig. 3). These results suggest that initial electrostatic interaction between cationic bacteriocin and negatively charged bacterial cell membrane may differ between GarA-C. This interaction between cell membrane and N-terminal α-helix of GarA may be also responsible for the observed bacteriocin minimal activity against L. lactis strains and some Carnobacterium, Enterococcus, Lactobacillus, Leuconostoc and Pediococcus strains.
Figure 2.

Multiple sequence alignment of the amino acid sequences of signal peptides and mature peptides of garvicin A, B, C and other Man-PTS-targeting bacteriocins: (A) subclass IIa bacteriocins, (B) subclass IId bacteriocins or channel-forming proteins: (C) Ton-B dependent receptor (Ton-B) and (D) voltage-gated chloride channel (Cl channel). Consensus amino acids are in red, partial consensus amino acids are in blue. Amino acids conserved between GarA, GarB, GarC and subclass IIa, subclass IId bacteriocins or transport proteins are highlighted by grey background. Conserved amino acids residues and underlined. Amino acids probably involved in the ligand-binding (C) and formation of Cl− selectivity filter (D) are highlighted by yellow background. The UniProt accession numbers are P38580 for carnobacteriocin B2 (CbnB2), P38579 for carnobacteriocin BM1 (CbnBM1), P0A311 for curvacin A (CurA), Q47784 for enterocin A (EntA), O30434 for enterocin P (EntP), C9B989 for enterocin SE-K4 (EntSE-K4), H2B2W4 for GarA, H2AM33 for GarB, H2AM30 for GarC, H6U5Y1 for GarQ, P0A313 for LcnA, P35518 for LcnB, P34034 for leucocin A (LeuA), H2EST2 for leucocin C (LeuC), P38577 for mesentericin Y105 (MesY), P29430 for pediocin PA-1 (PedPA-1), M1GJ1 for penocin A (PenA), Q93FV7 for plantaricin 423 (Pla423) and P35618 for sakacin P (SakP).
Figure 3.
Predicted secondary and tertiary structures of GarA, GarB and GarC. H, S and C indicate helix, strand and coil, respectively. Confidence score range from 0 to 9 and represents certainty of the secondary structure prediction. C- and TM-scores estimate global accuracy of the 3D structure model. C-score in the range from −5 to 2 and TM-score > −1.5 indicates a model with correct global topology. Root mean square distance (RMSD) is the average distance of pairs of residues between model and template.
In order to get a deeper insight into the phylogeny of the garvicins and thus their possible mechanism of action, we performed a wide homology search using the NCBI BLAST network service. BLASTp showed that the N-terminal 13 amino acids of GarA and GarB are respectively 85% and 77% identical to a region of TonB-dependent receptor (accession no. WP_091746097.1). The similarity region is a part of the ligand-gated channel and is localized adjacent to the conserved amino acid residues responsible for the ligand binding (Fig. 2C). The same N-terminal 12 amino acids of GarA and GarB are also respectively 83% and 92% identical to a region of the voltage-gated chloride channel protein (accession no. WP_058617448.1). This region is a part of the transmembrane α-helix adjacent to the conserved amino acid residues responsible for chloride ion binding and taking part in the formation of the membrane channel39,40 (Fig. 2D). Similarity between garvicins and intermembrane fragments of channel forming proteins suggests that studies bacteriocins may act by forming a pore that leads to uncontrolled leakage of intracellular solutes and consequent cell death.
GarA-C target a specific extracellular loop of subunit IID
In order to identify the Man-PTSs features responsible for sensitivity to GarA, GarB and GarC, we compared the amino acid sequences of IIC and IID form sensitive and resistant species. The IIC subunits from L. garvieae strains showed high similarity to those from the other species, especially L. lactis (data not shown). Also the IID subunits showed high conservation, but with notable exception of a stretch of 51 amino acids present only in L. garvieae (Fig. 4). As the additional sequence lies in the extracellular region γ13, we propose to call the part of extended region γ, which contains the additional 51 amino acids, as region γ+. A homology search showed that region γ+ is unique to L. garvieae strains. To test whether it may indeed be responsible for the sensitivity of L. garvieae strains to garvicins A, B and C, we deleted in frame an internal part of manD encoding the additional 51 amino acids (γ+) from the garvicin-sensitive L. lactis strain B558a, carrying manCD in trans and with ptnABCD deleted, which gave in L. lactis B561a (supplementary Table S1). Deletion of γ+ conferred partial resistance to GarA and full resistance to GarB and GarC (Fig. 1), without affecting the mannose transport function. This indicates that region γ+ of subunit IID is indispensable for sensitivity to GarB and GarC, and, to a lesser extent, also GarA.
Figure 4.
Multiple sequence alignment of the amino acid sequences of Man-PTS subunits IID from various bacterial species. Extracellular and intracellular regions are marked in red and green, respectively. Region γ is underlined, region γ+ is boxed. Asterisks, double dots and single dots indicate fully, strongly and weakly conserved residues, respectively. The accession numbers are WP_003134976.1 for L. garvieae DCC43, WP_081164986.1 for L. garvieae A1, WP_046400791.1 for L. garvieae Lg-ilsanpaik-gs201105, WP_042218841.1 for L. garvieae NBRC100934, WP_017368922.1 for L. garvieae 8831, ETD04540.1 for L. garvieae TRF1, WP_074750596.1 for L. garvieae M79, WP_004258904.1 for L. garvieae Lg2, WP_017370845.1 for L. garvieae Tac2, NP_267864.1 for L. lactis IL1403, YP_004888576.1 for L. plantarum WCFS1, WP_003640910.1 for L. plantarum NC8, WP_005685034.1 for L. rhamnosus LOCK 0900 L. rhamnosus LOCK 0908 and L. rhamnosus GG, WP_003568236.1 for L. casei LOCK 0919, NP_463631.1 for L. monocytogenes EGD-e.
Hybrid Man-PTS system can serve as GarA receptor
As the protein sequences of the Man-PTS IIC subunits of L. garvieae and L. lactis were highly similar, we tested whether they can substitute each other to confer sensitivity to GarA and GarB. Therefore, we expressed L. garvieae genes manC or manD in the GarA- and GarB-resistant L. lactis NZ9000, which harbors the entire ptn operon and nisRK genes on its chromosome. L. lactis carrying manC (B563a) remained resistant to GarA and GarB, while L. lactis carrying manD (B564a) became sensitive to GarA but remained resistant to GarB (Fig. 1; Table S1 in the supplementary file). This indicates that a hybrid Man-PTS system consisting of L. lactis IIC and L. garvieae IID subunits can serve as a GarA receptor and that the site required for the antimicrobial activity of GarA is localized in the L. garvieae IID subunit. On the other hand, both IIC and IID subunits from L. garvieae are required for GarB activity.
GarA-C cause mutations at distinct sites of Man-PTS
The results presented above suggested that GarA, GarB and GarC may interact with Man-PTS by using different binding patterns. To pinpoint specific amino acids on IICD necessary for the Man-PTS interaction with individual garvicins, we determined the sensitivity to GarA, GarB and GarC of GarQ-resistant and man+ (mannose-positive phenotype; Table 1) L. garvieae IBB3403 missense mutants harboring single amino acid substitutions in the transmembrane domains of IIC (PW202 and LGN9) and transmembrane or extracellular domains of IID (PW203, PW204, LGN1, LGN2, LGN4) obtained in a previous study12 (Supplementary Table S1). In that study we established that spontaneous mutants with nonsense or frameshift mutations in the manABCD operon are unable to ferment mannose (man− phenotype; Table 1) due to premature termination or a change of Man-PTS structure depriving it of its sugar-transporting function. On the other hand, maintained ability to utilize mannose (man+ phenotype) by missense mutants indicates that the mutations, although leading to GarQ resistance, had no negative effect on the transmembrane structure of Man-PTS and that the amino acid(s) changed were likely involved in the GarQ - receptor interaction. The mutations turned out to affect also the sensitivity to other garvicins. Crucially for the present study, the effects were different for different garvicins. Thus, the PW202 and LGN1 mutants had, respectively, a 4-fold and 8-fold higher MIC value towards GarA than the wild-type strain, while the other mutants remained fully sensitive to GarA (Table 1). In the case of GarB, the MIC was at least 64-fold higher for PW203, PW204 and LGN1, and only 4-fold higher for LGN2 and LGN4, than that of the wild type (0.78 µg/ml). PW202 remained fully sensitive to GarB (Table 1). For GarC the MIC values were 32-fold for LGN1, 16-fold for LGN2, and 8-fold higher than the wild type (0.39 µg/ml) for PW202, LGN4 and LGN9. The other mutants remained fully sensitive to GarC (Table 1). These results convincingly show that distinct Man-PTS mutations differently affect its interaction with individual garvicins.
To identify other Man-PTS regions or specific amino acids targeted by GarA, GarB or GarC we obtained additional spontaneous bacteriocin-resistant mutants with a preserved Man-PTS functionality (man+ phenotype; Table 1), using the described method12. Wild-type L. garvieae IBB3403 was cultivated on CDM-agar containing mannose as the sole carbon source supplemented with GarA, GarB or GarC. Eight GarA-resistant man+ mutants were obtained (LGA2, LGA3, LGA5; LGA6, LGA8, LGA10, LGA13 and LGA14; Table S1 in the supplementary file). Sequencing of their man-PTS operon revealed five independent mutations. Gly52 → Val substitution (LGA3, LGA5) in the second transmembrane domain of subunit IIC reduced GarA-sensitivity 32-fold, Leu59 → Pro substitution (LGA2) in the intracellular region of IIC – 4-fold and Ala58 → Asp substitution (LGA10, LGA14) in the N-terminus of the IID – 2-fold (Table 1; Fig. 5). Insertion of Val between positions 190 and 191 in the sixth transmembrane domain of IIC (LGA6, LGA13) reduced GarA-sensitivity 8-fold, and deletion of AsnValValGly from positions 262–265 in region γ+ of subunit IID (LGA8) – 2-fold (Table 1; Fig. 5). All these GarA-resistant mutants exhibited also between 4-fold and 64-fold higher resistance to GarB and GarC, and between 2-fold and 128-fold higher resistance to GarQ (Table 1; Fig. 5).
Figure 5.
Predicted topology of L. garvieae IBB3403 Man-PTS subunits IIC and IID.
Ten GarB-resistant mutants were obtained (LGB1-LGB10; Table S1 in the supplementary file) containing only two mutations. Deletion of AsnValValGly from subunit IID, the same as that in the GarA-selected mutant (LGA8) clearly represented a hot spot as it was found in nine GarB-resistant mutants (LGB1-LGB5, LGB7-LGB10). This deletion decreased the sensitivity to GarB 64-fold compared with the wild type, 8-fold to GarC, 4-fold to GarQ, and 2-fold to GarA (same as for the LGA8 mutant). The remaining mutant (LGB6) also had a mutation in manD resulting in the Gln313 → Lys substitution in the extracellular loop of IID (Fig. 5). It was over 64-fold less sensitive to GarB and 2-fold to GarQ, and was fully sensitive to GarA (Table 1; Fig. 5).
On man-CDM-GarC plates fifteen mutants were obtained (LGC1, LGC3-LGC6, LGC8, LGC9, LGC11-LGC13, LC15, LGC16, LGC18-LGC20) which were over 128-fold less sensitive to GarC than the parental L. garvieae IBB3403 (Table S1 in the supplementary file). They contained eight mutations, six in manD and two in manC. In most of the mutants the extracellular loop of the IID was affected by the following substitutions: Arg203 → Cys (LGC3-LGC6, LGC9, LC11, LGC20), Arg203 → Leu (LGC16), Tyr226 → Asp (LGC8), or Val315 → Met (LGC15). Other mutations in IID were in the N-terminal part and in the first transmembrane domain and comprised, respectively, Met34 → Ile (LGC1, LGC12, LGC19) and Ala133 → Val (LGC15) substitutions (Table 1; Fig. 5). Only two mutants had mutations in the fourth and sixth transmembrane domain of subunit IIC: Ala106 → Val (LGC13) and Gly188 → Val (LGC18), respectively (Table 1; Fig. 5). Most of the GarC-resistant mutants were also resistant, to varying degrees, to the other garvicins tested, especially to GarB, for which thirteen strains had the MIC 64-fold higher than the wild type (Table 1).
Altogether, 33 independent resistant mutants were obtained, carrying 13 different mutations (Table 1; Fig. 5). Several features of interest could be observed. The mutants exhibited varying degrees of resistance (between 2-fold and 128-fold higher relative to wild-type) to the selected garvicins and also varying degrees of cross-resistance. Mutations in manD gene were significantly more frequent than in manC gene, extracellular loop of IID being the most common region affected. Deletion of amino acids 262AsnValValGly265 in the γ+ region was particularly frequent, as it occurred independently ten times. These features clearly confirm our earlier conclusion that γ+ region of subunit IID is a major site of interaction with GarA-C and different regions of subunits IIC and IID are critical for the interactions with different garvicins.
Amino acids involved in the sensitivity to GarA-C are in the channel of IIC and in the extracellular parts of IID
To determine the location of the amino acids altered by the resistance-conferring mutations in the folded IIC and IID subunits we built their template-based 3D models and compared them with the 2D topographic predictions. The two structure predictions coincided with each other fairly well (Figs 5 and 6). In IIC differences were minor and concerned the localization of the N-terminal fragment and the presence of an additional C-terminal transmembrane region. Importantly, the central part of the protein where all the mutations were found had a similar location in the two models (Figs 5 and 6A). Both models predict a transmembrane location of IIC, and the 3D top view exposes a channel for the transport of sugars. The channel is formed by six α-helices and most of the amino acid residues substituted in the garvicin-resistant mutants potentially engaged in garvicin binding (Pro100, Ala102, Ala106 and Gly188) are localized within it (Fig. 6A).
Figure 6.
Predicted tertiary structure of L. garvieae IBB3403 Man-PTS subunits IIC (A) and IID (B). Amino acids changed by mutations, signal peptide and region γ+ are in green, grey and yellow, respectively. Lipid bilayer is represented by red (outer bilayer) and blue (internal bilayer) layers of spheres. C- and TM-scores estimate global accuracy of the 3D structure model. C-score in the range from −5 to 2 and TM-score > −1.5 indicates a model with correct global topology. RMSD is the average distance of pairs of residues between model and template.
In contrast to IIC, the 3D model of subunit IID does not confirm its transmembrane localization predicted by the topological model but instead indicates that is a monotopic membrane protein only anchored in the outside part of lipid bilayer, that suggests that it can be a first target for bacteriocin binding. Nearly all IID is exposed to the milieu except for amino acids 171–178 and 320–365 (C-terminus), which in the 2D model are part of an intracellular domain and form the third and fourth transmembrane helices, respectively (Figs 5 and 6B). All the amino acids altered by mutations in IID are in its extracellular part (Fig. 6B).
Discussion
Some L. garvieae strains are pathogenic and cause lactococcosis in marine or freshwater fish41, mastitis in cows42, and pneumonia in pigs43. Recently, L. garvieae has also been considered to be a human pathogen as it was isolated from patients with diverticulitis, peritonitis44, endocarditis45, spondylodiscitis46, and acute acalculous cholecystitis47. In this study we focused on three bacteriocins, GarA, GarB and GarC, encoded by plasmids from L. garvieae 21881 isolated from the blood of a patient suffering from septicemia48. We confirmed GarA activity against L. garvieae15 and revealed for the first time GarB activity exclusively against L. garvieae and GarC – against Lactococcus spp. All three bacteriocins showed no significant activity against any other lactic acid bacteria tested or diverse pathogenic species, which makes them useful for selective treatment of infections caused by pathogenic L. garvieae strains.
At present, the most commonly used method for the identification of bacteriocin receptors or other proteins involved in their action, is genome sequencing. It requires generation of spontaneous resistant mutants followed by whole genome sequencing and identification of mutated genes responsible for the reduced sensitivity12,35–37. In this study, we also applied an integrative plasmid pGhost9::ISS132 to generate bacteriocin-resistant mutants. We have previously used this approach to identify the gene ccpA49 and several other genes involved in cellobiose and lactose metabolism50 in L. lactis IL1403. However, this approach has not been applied to date to search for genes involved in the sensitivity to bacteriocins (e.g., potential receptor genes). Sequencing of the DNA regions surrounding the pGhost9::ISS1 integration sites in the genomes of resistant L. garvieae IBB3403 mutants revealed genes encoding Man-PTS, indicating that it likely is the receptor of the bacteriocins. We confirmed the involvement of these genes by using genome sequencing of spontaneous garvicin-resistant mutants (Table 1). Of the three genes encoding Man-PTS subunits, mutations were found exclusively in manC or manD and not in manAB, indicating that the latter is not required for sensitivity to GarA, GarB or GarC. Those results also showed that pGhost9::ISS1 integration can be used as a cheaper alternative to whole genome sequencing in searching for bacteriocin receptors.
Deletion of individual man genes in L. garvieae IBB3403 and subsequent complementation studies confirmed an involvement of Man-PTS subunits IIC and IID in the sensitivity to GarA, GarB and GarC. Similarly, deletion of ptnABCD in L. lactis IL1403 confirmed its involvement in the sensitivity to GarC. An attempt to complement the manABCD deletion using nisin-inducible pNZ9530 and pNZ8037 plasmids was unsuccessful probably due to incompatibility between them and the native L. garvieae IBB3403 plasmids. We therefore decided to use the garvicin-resistant, plasmid-free ∆ptnABCD L. lactis B4644 as the host for complementation studies. Introduction of the entire manABCD operon resulted in a strain sensitivity to the bacteriocins studied. In parallel, introduction of separately cloned manC and manD coding for IIC and IID confirmed that both these Man-PTS transmembrane subunits are indispensable for GarA, GarB and GarC activity (Fig. 1).
It has been demonstrated earlier that all subclass IIa bacteriocins and subclass IId LcnA, LcnB and GarQ use Man-PTS as the receptor on target cells4,12. Although GarA, GarB and GarC target the same receptor as the other Man-PTS-targeting bacteriocins, a comparison of their activity spectra, amino acid sequences (Fig. 2A,B) and predicted secondary and tertiary structures (Fig. 3) suggested that various bacteriocins may bind differently to their targets. A comparative analysis of the amino acid sequences of subunits IIC and IID from several garvicin-sensitive and garvicin-resistant species revealed high conservation of subunit IIC and the presence of an additional region γ+ unique to IID of L. garvieae (Fig. 4) likely responsible for the GarA and GarB activity, which is also limited to this species. Moreover, prediction of the IID transmembrane structure showed its external localization. Deletion of the γ+ region resulted in full resistance to GarB and partial resistance to GarA suggesting its key role in the interaction with GarB and a lesser significance in GarA binding. Interestingly, the deletion of the γ+ region also resulted in full resistance to GarC, although, besides L. garvieae, it is also active against L. lactis, which lacks region γ+. This suggests that GarC uses different interaction patterns in different species or that the γ+ deletion resulted in a Man-PTS structure change that prevented its binding.
The results discussed above indicated differences in the binding patterns of GarA, GarB and GarC which likely reflected specific interactions between a given bacteriocin and individual amino acids in Man-PTS IICD. Further confirmation of this notion comes from the fact that IIC and IID from L. garvieae only could serve as a receptor for GarB, whereas GarA recognized the IIC subunit from both L. lactis and L. garvieae (Fig. 1). Testing of the GarA, GarB and GarC activity against a panel of L. garvieae IBB3403 IIC or IID mutants selected as partially resistant to one of the three garvicins (Table 1) allowed the identification of 18 amino acids, six in IIC and twelve in IID, likely involved in specific interactions with the bacteriocins (Fig. 5). Most of those in IIC localized to the sugar-transporting channel and all in IID were extracellular (Fig. 6). The distribution of these amino acids in Man-PTS subunits suggests their diverse functions, probably some directly in the bacteriocin binding and others participating indirectly. The surface location of IID predisposes it to the role of a docking receptor, in which the protruding region γ+ and N-terminal part would serve for the initial contact of a bacteriocin with Man-PTS. The bacteriocin binding could induce IID conformational changes forcing its IIC partner to open the channel. Then, the interior of the open channel of IIC would offer a secondary binding site for the bacteriocin, which would cause a lethal fully open channel structure eventually leading to the cell death. This notion is further supported by the finding that the highly conserved N-terminal parts of garvicins A and B are significantly similar to the transmembrane segments of some bacterial transporters such as TonB and chloride channels (Fig. 2C,D). These proteins take part in the uptake of iron and nickel complexes, vitamin B12 and carbohydrates, and serve as colicin, microcin and bacteriophage receptors (TonB-dependent transporter) or allow passive diffusion of Cl−, the Cl−/H+ exchange, water and salt transport, pH and cell volume regulation, and stabilization of the membrane potential (voltage-gated chloride channel protein)39,40. It is feasible that the N-terminal fragments of GarA and GarB could act in a similar manner by docking into the IIC channel to form a stably open pore increasing the membrane permeability. A similar sequence of bacteriocin binding has already been suggested for GarQ12, but here the picture becomes more detailed with the support of the modeled structures of IID as the surface docking site and IIC as the entry channel.
The Man-PTS amino acids altered in the mutants with reduced sensitivity to garvicins are apparently of different levels of importance. Some of them were essential for one or two garvicins and caused high resistance levels when mutated, while others had a lesser effect, i.e., they produced low resistance levels when mutated. This indicates a possibility of diverse binding strength between receptor-bacteriocin particular amino acids: an indispensable role in garvicins binding of amino acids, which substitutions led to high resistance levels (from 32x for GarA to 1024x for GarQ) and supporting role of amino acids that substitutions resulted in low resistance of mutants obtained (e.g., only 2–8-fold higher resistance of mutants in comparison with wild-type strain). These observations provide a further clue indicating that individual garvicins use different binding patterns. Nevertheless, one cannot at present exclude the possibility that in fact the altered amino acids are not directly involved in bacteriocin binding but instead are important for the Man-PTS structure, changes of which prevent bacteriocin binding without compromising the mannose transport function (man+ phenotype of the mutants).
So far, no tertiary structure of a Man-PTS subunit has been reported, which made it difficult to interpret the obtained results in light of the bacteriocin - Man-PTS interactions. We therefore resorted to homology modeling to predict the structures of the two subunits relevant to the present study. Importantly, the overall distribution of transmembrane and extracellular regions corresponded well with the predicted membrane topology of these proteins (Figs 5 and 6). The models confirmed the transmembrane localization of IIC and predicted an unexpected cell-surface localization of subunit IID (Fig. 6). This subunit was earlier proposed to be a transmembrane protein forming a heterotetramer or higher multimer6. A cell-surface exposed IID subunit, as predicted here, would greatly facilitate bacteriocin binding via some of the following amino acids: Met34, Ala58, Pro111, Thr123, Ala133, Arg203, Tyr226, Trp256, AsnValValGly262–265, Gly301, Gln313 and Val315, all having an extracellular location and found to be important for bacteriocin sensitivity.
According to the present study, GarA at high concentrations exhibited low activity against L. lactis and some strains from the genera Carnobacterium, Enterococcus, Lactobacillus, Leuconostoc and Pediococcus. Also GarC was minimally active against some strains from the genera Lactobacillus and Leuconostoc. Importantly, a minimal GarA activity was also observed after mutation or deletion of the Man-PTS-encoding genes in both L. garvieae and L. lactis (Fig. 1) suggesting that it is not dependent on Man-PTS. As such, it was not the subject of this study. It is possible that at high concentration, after initial unspecific electrostatic interaction between GarA N-terminal α-helix and membrane surface, bacteriocin aggregates and its α-helix penetrates the membrane and form pores without specific receptor. Similarly, it has already been shown that the cyclic bacteriocin garvicin ML exhibits non-specific antimicrobial activity at high concentrations, while at lower concentrations it requires a specific membrane receptor for action51. Thus, further studies with different GarA and GarC concentrations are required to evaluate their mode of action at high concentrations52–69.
In summary, this study provides a proof-of-principle for a convenient alternative to whole genome sequencing for the identification of genes involved in bacterial sensitivity to bacteriocins. Results obtained using both these methods indicate that in L. garviaeae Man-PTS subunits IIC and IID act as receptors for GarA, GarB and GarC, three distinct bacteriocins encoded by plasmids of L. garviaeae 21881 isolated from a clinical case of septicemia. We suggest here that their bactericidal effect, directed mainly against L. garvieae, relies on garvicin binding to specific amino acids of IICD result in IIC channel opening and cell death. The amino acid residues critical for the garvicin action were identified by analyzing resistant mutants, and their location in the extracellular regions of the surface protein IID and in the transmembrane channel of the IIC permease was determined with the help of predicted topology and 3D structure of the two Man-PTS subunits. Hundreds of bacteriocins have been identified so far with different antimicrobial spectra, which is commonly believed to indicate that they recognize distinct receptors on target cells. Here, however, we provide evidence that the different structures and inhibition spectra of bacteriocins do not necessarily mean that they recognize different receptors. We show that a single receptor, the mannose-specific PTS, can serve as a target for a number of non-homologous bacteriocins with greatly different activity spectra. As we expect that bacteriocins binding Man-PTS constitute a much larger family than the four investigated here, our future studies will focus on a search for other bacteriocins targeting the membrane subunits of Man-PTS. Their detailed investigation will allow us to build a full picture of the bacteriocin - Man-PTS interactions and could eventually justify proposing a separate group of bacteriocins besides the currently recognized IIa-IId.
Electronic supplementary material
Acknowledgements
This work was supported by grant 2013/08/M/NZ9/01025 from the National Science Centre (Poland).
Author Contributions
A.T. - acquisition of data, inhibitory spectrum assays, the generation and functional analyses of spontaneous and other mutants resistant to GarA-C, genomes sequencing, bioinformatic analyses, paper writing. D.B.D. - conception of the work, paper revising. T.A.P. - project leadership, conception of the work, bioinformatic analyses, interpretation of data, paper writing and revising.
Data Accessibility Statement
The authors declare that all data generated or analyzed during this study are included in this article.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Supplementary information accompanies this paper at 10.1038/s41598-018-34087-2.
References
- 1.Postma PW, Lengeler JW, Jacobson GR. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 1993;57:543–594. doi: 10.1128/mr.57.3.543-594.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Saier MH, Hvorup RN, Barabote RD. Evolution of the bacterial phosphotransferase system: from carriers and enzymes to group translocators. Biochem. Soc. Trans. 2005;33:220–224. doi: 10.1042/BST0330220. [DOI] [PubMed] [Google Scholar]
- 3.Saier MH. The bacterial phosphotransferase system: new frontiers 50 years after its discovery. J. Mol. Microbiol. Biotechnol. 2015;25:73–78. doi: 10.1159/000381215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Diep DB, Skaugen M, Salehian Z, Holo H, Nes IF. Common mechanisms of target cell recognition and immunity for class II bacteriocins. Proc. Natl. Acad. Sci. 2007;104:2384–2389. doi: 10.1073/pnas.0608775104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Esquinas-Rychen M, Erni B. Facilitation of bacteriophage lambda DNA injection by inner membrane proteins of the bacterial phosphoenol-pyruvate: carbohydrate phosphotransferase system (PTS) J. Mol. Microbiol. Biotechnol. 2001;3:361–370. [PubMed] [Google Scholar]
- 6.Kjos M, et al. Target recognition, resistance, immunity and genome mining of class II bacteriocins from gram-positive bacteria. Microbiol. Read. Engl. 2011;157:3256–3267. doi: 10.1099/mic.0.052571-0. [DOI] [PubMed] [Google Scholar]
- 7.Dalet K, Cenatiempo Y, Cossart P, Héchard Y. & European Listeria Genome Consortium. A sigma(54)-dependent PTS permease of the mannose family is responsible for sensitivity of Listeria monocytogenes to mesentericin Y105. Microbiol. Read. Engl. 2001;147:3263–3269. doi: 10.1099/00221287-147-12-3263. [DOI] [PubMed] [Google Scholar]
- 8.Gravesen A, et al. High-level resistance to class IIa bacteriocins is associated with one general mechanism in Listeria monocytogenes. Microbiol. Read. Engl. 2002;148:2361–2369. doi: 10.1099/00221287-148-8-2361. [DOI] [PubMed] [Google Scholar]
- 9.Héchard Y, Pelletier C, Cenatiempo Y, Frère J. Analysis of sigma(54)-dependent genes in Enterococcus faecalis: a mannose PTS permease (EII(Man)) is involved in sensitivity to a bacteriocin, mesentericin Y105. Microbiol. Read. Engl. 2001;147:1575–1580. doi: 10.1099/00221287-147-6-1575. [DOI] [PubMed] [Google Scholar]
- 10.Ramnath M, Beukes M, Tamura K, Hastings JW. Absence of a putative mannose-specific phosphotransferase system enzyme IIAB component in a leucocin A-resistant strain of Listeria monocytogenes, as shown by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Appl. Environ. Microbiol. 2000;66:3098–3101. doi: 10.1128/AEM.66.7.3098-3101.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ramnath M, Arous S, Gravesen A, Hastings JW, Héchard Y. Expression of mptC of Listeria monocytogenes induces sensitivity to class IIa bacteriocins in Lactococcus lactis. Microbiol. Read. Engl. 2004;150:2663–2668. doi: 10.1099/mic.0.27002-0. [DOI] [PubMed] [Google Scholar]
- 12.Tymoszewska A, Diep DB, Wirtek P, Aleksandrzak-Piekarczyk T. The Non-Lantibiotic Bacteriocin Garvicin Q Targets Man-PTS in a Broad Spectrum of Sensitive Bacterial Genera. Sci. Rep. 2017;7:8359. doi: 10.1038/s41598-017-09102-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kjos M, Nes IF, Diep DB. Class II one-peptide bacteriocins target a phylogenetically defined subgroup of mannose phosphotransferase systems on sensitive cells. Microbiol. Read. Engl. 2009;155:2949–2961. doi: 10.1099/mic.0.030015-0. [DOI] [PubMed] [Google Scholar]
- 14.Kjos M, Salehian Z, Nes IF, Diep DB. An extracellular loop of the mannose phosphotransferase system component IIC is responsible for specific targeting by class IIa bacteriocins. J. Bacteriol. 2010;192:5906–5913. doi: 10.1128/JB.00777-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Maldonado-Barragán A, et al. Garvicin A, a novel class IId bacteriocin from Lactococcus garvieae that inhibits septum formation in L. garvieae strains. Appl. Environ. Microbiol. 2013;79:4336–4346. doi: 10.1128/AEM.00830-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Raya R, Bardowski J, Andersen PS, Ehrlich SD, Chopin A. Multiple transcriptional control of the Lactococcus lactis trp operon. J. Bacteriol. 1998;180:3174–3180. doi: 10.1128/jb.180.12.3174-3180.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gasteiger E, et al. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003;31:3784–3788. doi: 10.1093/nar/gkg563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16:10881–10890. doi: 10.1093/nar/16.22.10881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.McWilliam H, et al. Analysis tool web services from the EMBL-EBI. Nucleic Acids Res. 2013;41:W597–600. doi: 10.1093/nar/gkt376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Marchler-Bauer A, et al. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res. 2011;39:D225–229. doi: 10.1093/nar/gkq1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Marchler-Bauer A, et al. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 2015;43:D222–226. doi: 10.1093/nar/gku1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Marchler-Bauer A, et al. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45:D200–D203. doi: 10.1093/nar/gkw1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Marchler-Bauer A, Bryant SH. CD-Search: protein domain annotations on the fly. Nucleic Acids Res. 2004;32:W327–W331. doi: 10.1093/nar/gkh454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Tusnády GE, Simon I. Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J. Mol. Biol. 1998;283:489–506. doi: 10.1006/jmbi.1998.2107. [DOI] [PubMed] [Google Scholar]
- 25.Tusnády GE, Simon I. The HMMTOP transmembrane topology prediction server. Bioinforma. Oxf. Engl. 2001;17:849–850. doi: 10.1093/bioinformatics/17.9.849. [DOI] [PubMed] [Google Scholar]
- 26.Petersen TN, Brunak S, Heijne Gvon, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods. 2011;8:785. doi: 10.1038/nmeth.1701. [DOI] [PubMed] [Google Scholar]
- 27.Omasits U, Ahrens CH, Müller S, Wollscheid B. Protter: interactive protein feature visualization and integration with experimental proteomic data. Bioinforma. Oxf. Engl. 2014;30:884–886. doi: 10.1093/bioinformatics/btt607. [DOI] [PubMed] [Google Scholar]
- 28.Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat. Protoc. 2010;5:725–738. doi: 10.1038/nprot.2010.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yang J, et al. The I-TASSER Suite: protein structure and function prediction. Nat. Methods. 2015;12:7–8. doi: 10.1038/nmeth.3213. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zhang Y. I-TASSER server for protein 3D structure prediction. BMC Bioinformatics. 2008;9:40. doi: 10.1186/1471-2105-9-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Lomize MA, Pogozheva ID, Joo H, Mosberg HI, Lomize AL. OPM database and PPM web server: resources for positioning of proteins in membranes. Nucleic Acids Res. 2012;40:D370–D376. doi: 10.1093/nar/gkr703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Maguin E, Prévost H, Ehrlich SD, Gruss A. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 1996;178:931–935. doi: 10.1128/jb.178.3.931-935.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.de Ruyter PG, Kuipers OP, de Vos WM. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol. 1996;62:3662–3667. doi: 10.1128/aem.62.10.3662-3667.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kleerebezem M, Beerthuyzen MM, Vaughan EE, Vos WMde, Kuipers OP. Controlled gene expression systems for lactic acid bacteria: transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus spp. Appl. Environ. Microbiol. 1997;63:4581–4584. doi: 10.1128/aem.63.11.4581-4584.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kjos M, et al. Sensitivity to the two-peptide bacteriocin lactococcin G is dependent on UppP, an enzyme involved in cell-wall synthesis. Mol. Microbiol. 2014;92:1177–1187. doi: 10.1111/mmi.12632. [DOI] [PubMed] [Google Scholar]
- 36.Oppegård C, Kjos M, Veening J-W, Nissen-Meyer J, Kristensen T. A putative amino acid transporter determines sensitivity to the two-peptide bacteriocin plantaricin JK. MicrobiologyOpen. 2016;5:700–708. doi: 10.1002/mbo3.363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Uzelac G, et al. A Zn-dependent metallopeptidase is responsible for sensitivity to LsbB, a class II leaderless bacteriocin of Lactococcus lactis subsp. lactis BGMN1-5. J. Bacteriol. 2013;195:5614–5621. doi: 10.1128/JB.00859-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Cui Y, et al. Class IIa bacteriocins: diversity and new developments. Int. J. Mol. Sci. 2012;13:16668–16707. doi: 10.3390/ijms131216668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Dutzler R, Campbell EB, Cadene M, Chait BT, MacKinnon R. X-ray structure of a ClC chloride channel at 3.0 Å reveals the molecular basis of anion selectivity. Nature. 2002;415:287–294. doi: 10.1038/415287a. [DOI] [PubMed] [Google Scholar]
- 40.Tarek M. Prerequisites to proton transport in the bacterial ClC-ec1 Cl−/H + exchanger. Proc. Natl. Acad. Sci. USA. 2014;111:1668–1669. doi: 10.1073/pnas.1323186111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Haghighi Karsidani S, Soltani M, Nikbakhat-Brojeni G, Ghasemi M, Skall H. Molecular epidemiology of zoonotic streptococcosis/lactococcosis in rainbow trout (Oncorhynchus mykiss) aquaculture in Iran. Iran. J. Microbiol. 2010;2:198–209. [PMC free article] [PubMed] [Google Scholar]
- 42.Sedlacek, I. & Benda, P. Isolation of Lactococcus garvieae species from bovine mastitis. Vet. Med. (Praha) (1998).
- 43.Tejedor JL, et al. A genetic comparison of pig, cow and trout isolates of Lactococcus garvieae by PFGE analysis. Lett. Appl. Microbiol. 2011;53:614–619. doi: 10.1111/j.1472-765X.2011.03153.x. [DOI] [PubMed] [Google Scholar]
- 44.Wang C-YC, et al. Lactococcus garvieae infections in humans: possible association with aquaculture outbreaks. Int. J. Clin. Pract. 2007;61:68–73. doi: 10.1111/j.1742-1241.2006.00855.x. [DOI] [PubMed] [Google Scholar]
- 45.Li W-K, Chen Y-S, Wann S-R, Liu Y-C, Tsai H-C. Lactococcus garvieae endocarditis with initial presentation of acute cerebral infarction in a healthy immunocompetent man. Intern. Med. Tokyo Jpn. 2008;47:1143–1146. doi: 10.2169/internalmedicine.47.0795. [DOI] [PubMed] [Google Scholar]
- 46.Chan JFW, et al. Primary infective spondylodiscitis caused by Lactococcus garvieae and a review of human L. garvieae infections. Infection. 2011;39:259–264. doi: 10.1007/s15010-011-0094-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kim JH, et al. First report of human acute acalculous cholecystitis caused by the fish pathogen Lactococcus garvieae. J. Clin. Microbiol. 2013;51:712–714. doi: 10.1128/JCM.02369-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Aguado-Urda M, et al. Genome sequence of Lactococcus garvieae 21881, isolated in a case of human septicemia. J. Bacteriol. 2011;193:4033–4034. doi: 10.1128/JB.05090-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Aleksandrzak T, Kowalczyk M, Kok J, Bardowski J. Regulation of carbon catabolism in Lactococcus lactis. Food Biotechnol. 2000;17:61–66. [Google Scholar]
- 50.Aleksandrzak-Piekarczyk T, Kok J, Renault P, Bardowski J. Alternative lactose catabolic pathway in Lactococcus lactis IL1403. Appl. Environ. Microbiol. 2005;71:6060–6069. doi: 10.1128/AEM.71.10.6060-6069.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Gabrielsen C, Brede DA, Nes IF, Diep DB. Circular Bacteriocins: Biosynthesis and Mode of Action. Appl. Environ. Microbiol. 2014;80:6854–6862. doi: 10.1128/AEM.02284-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Nicolas P, et al. Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science. 2012;335:1103–1106. doi: 10.1126/science.1206848. [DOI] [PubMed] [Google Scholar]
- 53.Wyszyńska A, Raczko A, Lis M, Jagusztyn-Krynicka EK. Oral immunization of chickens with avirulent Salmonella vaccine strain carrying C. jejuni 72Dz/92 cjaA gene elicits specific humoral immune response associated with protection against challenge with wild-type Campylobacter. Vaccine. 2004;22:1379–1389. doi: 10.1016/j.vaccine.2003.11.001. [DOI] [PubMed] [Google Scholar]
- 54.Grabowska AD, et al. Campylobacter jejuni dsb gene expression is regulated by iron in a Fur-dependent manner and by a translational coupling mechanism. BMC Microbiol. 2011;11:166. doi: 10.1186/1471-2180-11-166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Korlath JA, Osterholm MT, Judy LA, Forfang JC, Robinson RA. A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J. Infect. Dis. 1985;152:592–596. doi: 10.1093/infdis/152.3.592. [DOI] [PubMed] [Google Scholar]
- 56.Fonzi WA, Irwin MY. Isogenic strain construction and gene mapping in Candida albicans. Genetics. 1993;134:717–728. doi: 10.1093/genetics/134.3.717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Leenhouts K, et al. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol. Gen. Genet. MGG. 1996;253:217–224. doi: 10.1007/s004380050315. [DOI] [PubMed] [Google Scholar]
- 58.Gibson, T. J. Studies on the Epstein-Barr virus genome. (Cambridge University, 1984).
- 59.Koryszewska-Bagińska, A., Aleksandrzak-Piekarczyk, T. & Bardowski, J. Complete genome sequence of the probiotic strain Lactobacillus casei (formerly Lactobacillus paracasei) LOCK919. Genome Announc. 1 (2013). [DOI] [PMC free article] [PubMed]
- 60.Axelsson L, et al. Genome sequence of the naturally plasmid-free Lactobacillus plantarum strain NC8 (CCUG 61730) J. Bacteriol. 2012;194:2391–2392. doi: 10.1128/JB.00141-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Kleerebezem M, et al. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. USA. 2003;100:1990–1995. doi: 10.1073/pnas.0337704100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Aleksandrzak-Piekarczyk, T., Koryszewska-Baginska, A. & Bardowski, J. Genome sequence of the probiotic strain Lactobacillus rhamnosus (formerly Lactobacillus casei) LOCK900. Genome Announc. 1 (2013). [DOI] [PMC free article] [PubMed]
- 63.Koryszewska-Baginska, A., Bardowski, J. & Aleksandrzak-Piekarczyk, T. Genome sequence of the probiotic strain Lactobacillus rhamnosus (formerly Lactobacillus casei) LOCK908. Genome Announc. 2 (2014). [DOI] [PMC free article] [PubMed]
- 64.Morita H, et al. Complete genome sequence of the probiotic Lactobacillus rhamnosus ATCC 53103. J. Bacteriol. 2009;191:7630–7631. doi: 10.1128/JB.01287-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Kobierecka P, et al. Lactic acid bacteria as a surface display platform for Campylobacter jejuni antigens. J. Mol. Microbiol. Biotechnol. 2015;25:1–10. doi: 10.1159/000368780. [DOI] [PubMed] [Google Scholar]
- 66.Kuipers OP, de Ruyter PGGA, Kleerebezem M, de Vos WM. Quorum sensing-controlled gene expression in lactic acid bacteria. J. Biotechnol. 1998;64:15–21. doi: 10.1016/S0168-1656(98)00100-X. [DOI] [Google Scholar]
- 67.Bolotin A, et al. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 2001;11:731–753. doi: 10.1101/gr.GR-1697R. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Glaser P, et al. Comparative genomics of Listeria species. Science. 2001;294:849–852. doi: 10.1126/science.1063447. [DOI] [PubMed] [Google Scholar]
- 69.Chumley FG, Menzel R, Roth JR. Hfr formation directed by Tn10. Genetics. 1979;91:639–655. doi: 10.1093/genetics/91.4.639. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The authors declare that all data generated or analyzed during this study are included in this article.




