Skip to main content
Cancer Biotherapy & Radiopharmaceuticals logoLink to Cancer Biotherapy & Radiopharmaceuticals
. 2018 Oct 18;33(8):363. doi: 10.1089/cbr.2018.29005.correx

Correction to: Cancer Biother Radiopharm 2014;29(8):303–309. DOI: 10.1089/cbr.2014.1653 and Cancer Biother Radiopharm 2014;29(10):451–456. DOI: 10.1089/cbr.2014.1698

PMCID: PMC6214635  PMID: 31329732

The same error was discovered in two different papers published in the CBR 29/8 October and CBR 29/10 December 2014 issues of Cancer Biotherapy and Radiopharmaceuticals. The articles being corrected are:

10.1089/cbr.2014.1653: si-RNA-Mediated Silencing of ADRBK1 Gene Attenuates Breast Cancer Cell Proliferation by Zhang C, Chen X, Li Y, Himaya SWA, Wu J, Shi X, Liu X, and Kim S. Cancer Biother Radiopharm 2014;29(8):303–309. DOI: 10.1089/cbr.2014.1653.

10.1089/cbr.2014.1698: Ribosomal Protein S15A Augments Human Osteosarcoma Cell Proliferation In Vitro by Zhang C, Zhang T, Song E, Himaya SWA, Chen X, and Zheng L. Cancer Biother Radiopharm 2014;29(10):451–456. DOI: 10.1089/cbr.2014.1698.

Holly Biotechnologies provided the wrong product specification regarding the siRNA expression vector, lentiviral packing vectors, and the constructed control shRNA plasmid when the authors purchased the shRNA used in these articles.

The incorrectly published shRNA sequence was: GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT

The actual—and correct—sequence in the control shRNA plasmid was: TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT

Holly Biotechnologies confirmed the wrong control shRNA sequence was only in the product specification. They also confirmed the plasmid was constructed with the correct control shRNA sequence. It did not have any influence on the experimental results.

The online versions of both articles have been corrected.

The authors apologize for this unfortunate circumstance.


Articles from Cancer Biotherapy & Radiopharmaceuticals are provided here courtesy of Mary Ann Liebert, Inc.

RESOURCES