Abstract
From April 2016 to March 2017, a number of 99 isolates of Escherichia coli were collected from three types of wastewater including urban wastewater (33 isolates), livestock slaughterhouse wastewater (33 isolates) and poultry slaughterhouse wastewater (33 isolate). The specimens were cultured on microbiological media. The bacterial identification was performed by morphological and biochemical tests. Polymerase chain reaction (PCR) method was carried out to detect 2 virulence genes (traT, and fimH) and 4 antibiotic resistance genes (blaTEM, CTX, SHV, and tetA). The data showed that the prevalence rate of traT, fimH,blaCTX, blaTEM,blaSHV, tetA genes were 89.9%, 91.9%, 79.8%, 40.4%, 6.1%, and 91.9%, respectively.
Keywords: Escherichia coli, Wastewater, Virulence genes, Resistance genes, Antibiotic resistance
Specifications table
| Subject area | Environmental Sciences |
| More specific subject area | Microbiology |
| Type of data | Tables and Figures |
| How data was acquired | From April 2016 to March 2017, a total of 99 non-duplicate isolates of Escherichia coli were recovered from three type sewage including poultry wastewater (33 isolates), urban sewage (33 isolates), and livestock slaughterhouse wastewater (33 isolates) in Gonabad, northeast of Iran. The specimens were cultured on microbiological media. All bacterial isolates identified and confirmed as Escherichia coli by morphological and biochemical tests. The bacterial cells were cultured overnight on Mueller-Hinton agar. The whole genomic DNA was extracted from single colonies using boiling method and used as a template for PCR amplification |
| Data format | Raw, analyzed |
| Experimental factors | Prototype strain Escherichia coli ATCC 25922 was applied as quality control strain throughout this research. DNA ladder (50 bp size range) was used to detect the size of the expected bands. |
| Experimental features | Whole genomic DNA was extracted from single colonies using boiling method and used as a template for PCR amplification. |
| Data source location | Gonabad County, Khorasan Razavi Province, Iran |
| Data accessibility | Data are included in this article |
Value of the data
-
•
The data can be useful to operators of water and wastewater treatment plants for better microbial contamination control and the need to be aware of the prevalent amount of pathogenic E. coli genes.
-
•
The data can be used to show that the prevalence of pathogenic E. coli genes in different environment of urban wastewater, livestock slaughterhouse wastewater and poultry slaughterhouse wastewater are various and treatment of them must be done by different methods.
-
•
The gene of E. coli strain isolated from urban wastewater, livestock slaughterhouse wastewater and poultry slaughterhouse wastewater are different, and the prevalence of fimH and tetA genes were much higher than other genes in three types of wastewater.
-
•
The data can be used to show that high prevalence of virulence traits was observed in urban wastewater and need to be considered as a health-alarming situation.
-
•
The prevalence of antibiotic resistance genes of pathogenic E. coli in urban wastewater was much higher than E.coli bacteria present in livestock slaughterhouse wastewater and poultry slaughterhouse wastewater, respectively.
1. Data
The prevalence rate of traT, fimH, blaCTX, blaTEM, blaSHV, and tetA genes in poultry slaughterhouse wastewater isolate bacteria were 81.8%, 84.8%, 72.7%, 45.5%, 3%, and 87.9% respectively. The prevalence rate of traT, fimH, blaCTX, blaTEM, blaSHV, and tetA genes in urban wastewater isolate bacteria were 93.9%, 93.9%, 87.9%, 39.4%, 6.1%, and 100%, respectively. The prevalence rate of traT, fimH, blaCTX, blaTEM, blaSHV, and tetA genes in livestock slaughterhouse wastewater isolate bacteria were 93.9%, 97%, 78.8%, 36.4%, 9.1% and 87.9%, respectively, see Table 1. The prevalence rate of traT gene in isolates from urban wastewater and livestock slaughterhouse wastewater was 93.9% and the prevalence rate of fimH gene in the isolates from urban wastewater and livestock slaughterhouse wastewater were 93.9% and 97%, respectively.The prevalence of resistance gene was belonged to tetA gene. The SHV gene has the least prevalence among all isolates.
Table 1.
Frequency of studied genes among strains isolated from different wastewater sources.
| Source | Virulence genes % |
Resistance genes % |
||||
|---|---|---|---|---|---|---|
| traT | fimH | blaCTX | blaTEM | blaSHV | tetA | |
| Poultry sewage (number = 33) | 27 | 28 | 24 | 15 | 1 | 29 |
| 81.8% | 84.8% | 72.7% | 45.5% | 3% | 87.9% | |
| Urban sewage (number = 33) | 31 | 31 | 29 | 13 | 2 | 33 |
| 93.9% | 93.9% | 87.9% | 39.4% | 6.1% | 100% | |
| Livestock slaughter house sewage (number = 33) | 31 | 32 | 26 | 12 | 3 | 29 |
| 93.9% | 97% | 78.8% | 36.4% | 9.1% | 87.9% | |
| Total (number = 99) | 89 | 91 | 79 | 40 | 6 | 91 |
| 89.9% | 91.9% | 79.8% | 40.4% | 6.1% | 91.9% | |
2. Experimental design, materials and methods
2.1. Sample collection
For the prepared the dataset of this article from April 2016 to March 2017, a number of 99 non-duplicate isolates of Escherichia coli were recovered from three types of wastewater including poultry slaughterhouse wastewater (33 isolates), urban wastewater (33 isolates), and livestock slaughterhouse wastewater (33 isolate) located in Gonabad, Iran.
2.2. Bacterial identification
Wastewater samples (250 ml) were collected aseptically in sterile glass bottles [1], [2]. Specimens were sent to the clinical microbiology laboratory within 1 h of specimen collection. The collected specimens were cultured on MacConkey and incubated for 24 h at 35 °C ± 2 [3], [4]. Primary bacterial identification was performed by standard diagnostic tests. Briefly, the overnight pure growth of the organisms on MacConkey agar plates was checked on the basis of Gram staining,colonial morphology and lactose fermentation [5], [6]. The isolated colonies were final identified by oxidase, catalase, motility, triple sugar iron agar (TSI) inoculation, citrate utilization, indole, and H2S production. The pure bacterial colonies were inoculated onto medium containing 1.5 ml of sterile Tryptic Soy broth (TSB) mixed with glycerol (20%) and stored at −20 °C for further investigation [7,8].
2.3. Detection of virulence and resistance genes by polymerase chain reaction (PCR)
For detection of virulence and resistance genes at first the bacterial cells were culture overnight on Mueller-Hinton agar. After than boiling and the PCR methods were used for detection and distribution of virulence genes and antibiotic resistance genes E. coli isolates, Table 2 [9], [10].
Table 2.
Nucleotide sequences of primers and conditions used to amplify species specific, virulence markers and antibiotic resistance genes in E.coli isolates by PCR.
| Virulence factor | Target gene | Primer name | Sequence (5′ to 3′) | Length (bp) | Annealing temperature (°C) | Amplicon size (pb) | References |
|---|---|---|---|---|---|---|---|
| traT | traT | traT-F | GGTGTGGTGCGATGAGCACAG | 21 | 60 | 290 | [11] |
| traT-R | CACGGTTCAGCCATCCCTGAG | 21 | |||||
| fimH | fimH | fimH-F | CATTCGCCTGTAAAACCGCC | 20 | 60 | 207 | [12] |
| fimH-R | ATAACACGCCGCCATAAGCC | 20 | |||||
| blaCTX | blaCTX | blaCTX-F | TTTGCGATGTGCAGTACCAGTAA | 23 | 55 | 544 | [12] |
| blaCTX-R | CGATATCGTTGGTGGTGCCATA | 23 | |||||
| tetA | tetA | tetA-F | TTGGCATTCTGCATTCACTC | 20 | 60 | 494 | [9] |
| tetA-R | GTATAGCTTGCCGGAAGTCG | 20 | |||||
| blaTEM | blaTEM | TEM-F | ATAAAATTCTTGAAGACGAAA | 19 | 50 | 1150 | [13] |
| TEM-R | GACAGTTACCAATGCTTAATCA | 19 | |||||
| blaSHV | blaSHV | SHV-F | CACTCAAGGATGTATTGTG | 19 | 50 | 885 | [10] |
| SHV-R | TTAGCGTTGCCAGTGCTCG | 19 |
Acknowledgment
This project was scientific supported by Gonabad University of Medical Sciences, Gonabad, Iran (MSc thesis) Team. The authors are grateful to the Deputy of Research & Technology and Dept. of Environmental Health Engineering for logistical and technical support.
Footnotes
Transparency data associated with this article can be found in the online version at https://doi.org/10.1016/j.dib.2018.08.167.
Transparency document. Supplementary material
Supplementary material
.
References
- 1.Ashbolt N.J. Microbial contamination of drinking water and human health from community water systems. Curr. Environ. health Rep. 2015;2:95–106. doi: 10.1007/s40572-014-0037-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Farnleitner A.H., Savio D., Sommer R., Reischer G., Kirschner A., Zerobin W. Integrated strategy to guide health-related microbial quality management at alpine karstic drinking water resources. Karst Groundw. Contam. Public Health. 2018:185–199. [Google Scholar]
- 3.Biswal B.K., Mazza A., Masson L., Gehr R., Frigon D. Impact of wastewater treatment processes on antimicrobial resistance genes and their co-occurrence with virulence genes in Escherichia coli. Water Res. 2014;50:245–253. doi: 10.1016/j.watres.2013.11.047. [DOI] [PubMed] [Google Scholar]
- 4.Figueras M., Borrego J.J. New perspectives in monitoring drinking water microbial quality. Int. J. Environ. Res. public health. 2010;7:4179–4202. doi: 10.3390/ijerph7124179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Rabbia V., Bello-Toledo H., Jiménez S., Quezada M., Domínguez M., Vergara L. Antibiotic resistance in Escherichia coli strains isolated from Antarctic bird feces, water from inside a wastewater treatment plant, and seawater samples collected in the Antarctic Treaty area. Polar Sci. 2016;10:123–131. [Google Scholar]
- 6.Marinescu F., MDarutescu L., Savini I., Lazar V. Antibiotic resistance markers among Gram-negative isolates from wastewater and receiving rivers in South Romania. Roman. Biotechnol. Let. 2015;20:10055–10069. [Google Scholar]
- 7.Brennan R.E. Editor antibiotic resistance of Escherichia Coli ISolated from A Stream near Two Wastewater Treatment Facilities in Edmond, Oklahoma. Proc. Okla. Acad. Sci. 2015;92:59–64. [Google Scholar]
- 8.Alam M.Z., Aqil F., Ahmad I., Ahmad S. Incidence and transferability of antibiotic resistance in the enteric bacteria isolated from hospital wastewater. Microbiol. Braz. 2013;44:799–806. doi: 10.1590/s1517-83822013000300021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Adesoji A.T., Ogunjobi A.A., Olatoye I.O., DR Prevalence of tetracyCline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria. Ann. Clin. Microbiol. Antimicrob. 2015;14:35. doi: 10.1186/s12941-015-0093-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nematolahi S., Mosadegh A., Mardaneh, B J. Identification of ESBL-producing and blaSHV gene Harboring Enterobacter spp. Isolated from Bloodstream Infections of Hospitalized Patients During 10 Years in South of Iran (Shiraz) ISMJ. 2016;19:536–548. [Google Scholar]
- 11.Takahashi A., Kanamaru S., Kurazono H., Kunishima Y., Tsukamoto T., Ogawa O. Escherichia coli isolates associated with uncomplicated and complicated cystitis and asymptomatic bacteriuria possess similar phylogenies, virulence genes, and O-serogroup profiles. J. Clinical microbiology, 2006;44:4589–4592. doi: 10.1128/JCM.02070-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Edelstein M., Pimkin M., Palagin I., Edelstein I., Stratchounski L. Prevalence and molecular epidemiology of CTX-M extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. J. Antimicrobial agents and chemotherapy, 2003;47:3724–3732. doi: 10.1128/AAC.47.12.3724-3732.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Weill F-X., Demartin M., Tandé D., Espié E., Rakotoarivony I., Grimont PA. SHV-12-like extended-spectrum-β-lactamase-producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants adopted from Mali. J. Clinical microbiology, 2004;42:2432–2437. doi: 10.1128/JCM.42.6.2432-2437.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary material