Abstract
Aphids are excellent experimental models for a variety of biological questions ranging from the evolution of symbioses and the development of polyphenisms to questions surrounding insect's interactions with their host plants. Genomic resources are available for several aphid species, and with advances in the next-generation sequencing, transcriptomic studies are being extended to non-model organisms that lack genomes. Furthermore, aphid cultures can be collected from the field and reared in the laboratory for the use in organismal and molecular experiments to bridge the gap between ecological and genetic studies. Last, many aphids can be maintained in the laboratory on their preferred host plants in perpetual, parthenogenic life cycles allowing for comparisons of asexually reproducing genotypes. Aphis nerii, the milkweed-oleander aphid, provides one such model to study insect interactions with toxic plants using both organismal and molecular experiments. Methods for the generation and maintenance of the plant and aphid cultures in the greenhouse and laboratory, DNA and RNA extractions, microsatellite analysis, de novo transcriptome assembly and annotation, transcriptome differential expression analysis, and qPCR verification of differentially expressed genes are outlined and discussed here.
Keywords: Genetics, Issue 138, Aphid, greenhouse, milkweed, microsatellite, RNAseq, qPCR, Plant-insect interaction
Introduction
Aphids are small, hemimetabolous insects that colonize on diverse plant families worldwide. They are distinctive for several features, most notably their complex life cycles involving cyclical parthenogenesis and discrete polyphenisms, and their obligate nutritional symbioses with bacterial or yeast endosymbionts that supply nutrients missing from their diet of plant sap1. While most aphids are host plant specialists, some generalist species are important crop pests, inflicting considerable economic damage on crops either directly or via the pathogens and viruses they vector2. The publication of the first aphid genome in 2010, the pea aphid Acyrthosiphon pisum3, marked an important milestone in the study of aphid biology because it provided the genomic resources for addressing questions about the insect's adaptations to the herbivorous lifestyles, including those that might lead to a better control strategies4. Since that time, additional genomic resources have accumulated with the publication of an annotated genome for the soybean aphid Aphis glycines5, and publicly-available whole genome resources for another three-aphid species (Myzus cerasi (black cherry aphid), Myzus persicae (peach-potato aphid), Rhopalosiphum padi (bird cherry-oat aphid)6. Valuable de novo transcriptomic resources are available as well for a number of other aphid species (e.g.,Aphis gossypii (cotton aphid)7, Sitobion avenae (grain aphid)8, Cinara pinitabulaeformis (pine aphid)9, Aphis nerii (milkweed-oleander aphid)10).
Aphids have also made lasting contributions to our understanding of the plant-insect interactions and the ecology of the life on plants11. One area where aphids have made particularly important contributions is in our understanding of the chemical ecology of the host plant interactions. Herbivorous insects express diverse adaptations for overcoming plant defenses, and some even co-opt plant defenses for their own benefit12,13,14. For example, the milkweed-oleander aphid, Aphis nerii, is a bright yellow, invasive aphid found in temperate and tropical regions worldwide that colonizes on plants in the milkweed family (Apocynaceae). Plants in the family Apocynaceae have evolved diverse chemical defenses, including milky latex and cardiac glycosides known as cardenolides, that bind the cation carrier Na,K-ATPase and are effective deterrents to generalist herbivores15,16. Milkweed specialists express various modes of resistance to cardenolides, and some selectively or passively accumulate or modify cardenolides in their tissues as a means to deter predation or for other benefits17. A. nerii is thought to sequester cardenolides in this way, although the mechanisms and functional benefits remain unclear10,18.
Given the genomic resources at hand, A. nerii provides an excellent experimental model for the study of the molecular and genetic mechanisms involved in the chemo-ecological interactions between toxic host plants and their specialist herbivores. It is worth noting that, while some of the earliest studies of A. nerii focused on sequestration of cardenolides19, since that time, studies of A. nerii have provided insights into a broad set of evolutionary and ecological questions, including the genetic structure of invasive insects20 and the interplay between bottom-up and top-down regulation on the herbivore density21. A. nerii is thus a good candidate as an experimental model for an especially broad set of studies of the insect-plant interactions. Critical to the success of any study with A. nerii is the careful culture of aphid populations, which includes the culture of plants on which the aphids depend, as well as an efficient generation of high-quality -omic data. Our goal is to guide the reader through both. Outlined below are methods for the generation and maintenance of the plant and aphid cultures in the greenhouse and laboratory, DNA and RNA extractions, microsatellite analysis, de novo transcriptome assembly and annotation, transcriptome differential expression analysis, and qPCR verification of differentially expressed genes. While these methods are written for A. nerii, the general culturing, extraction, and analysis methods can extend to a variety of aphid species.
Protocol
1. Plant Cultures
Purchase seeds from any commercial vendor or collect from mature plants in the field. NOTE: This protocol is suitable for most commercially available milkweed species (e.g., Asclepias incarnata, A. syriaca, A. curassavica, Gomphocarpus physocarpus). Some seeds may need to be cold-stratified, and instructions from the seed supplier should be checked.
- Plant seeds in a fine germinating soil (60–70% fine peat moss, perlite, vermiculite, limestone).
- Fill a standard seedling tray with germination mix soil; ensuring that the soil reaches the top of the wells. In each well, make an indentation to create a hole in the soil about a 3 cm deep.
- Place one seed in each hole and water very well with a watering can such that the soil covers the seeds and is saturated.
- Grow seeds in a greenhouse (see conditions below, 1.5). Water regularly, daily to every-other-day; enough to maintain the soil moisture to a moderate level.
- When the seedlings have grown their first set of full leaves, re-pot seedlings in a general potting mix (50–60% peat moss, bark, and limestone) (Figure 1A).
- Use 4-inch round pots that fit with a tight seal with the cup cages. Fill with general potting soil up to about 5 cm below the rim.
- Create a hole in the soil deep enough to reach the bottom of the pot.
- With the hand, gently scoop the mature seedling from its well and place it deep inside the hole in the 4 inch pot. Cover the seedling with the soil. Water very well.
- Grow plants in the greenhouse and water regularly, daily to every other day; enough to maintain moderate soil moisture.
- Greenhouse conditions.
- Set the greenhouse thermostats to maintain daytime temperatures between 18–28 °C and nighttime temperatures between 16–22 °C using the manufacturer's instructions.
- During winter months when the days are shorter, supplement the daylight with 600 W high-pressure sodium bulbs (12 h, 8 am – 8 pm).
- Control unwanted pests (e.g., thrips, aphids) with a foliar organic soap solution, however, use these products with caution.
- Make the soap solution according to the manufacturer's recommendation and apply using a spray bottle.
- Leave the soap on the plants for 4–24 h. Gently rinse the plants with water to remove the soap 4–24 h post-application and rinse them with water a second time prior to use with laboratory aphid cultures.
Culture the average aphid population on plants that have grown at least 3–4 sets of full leaves and are at least 10 cm tall (Figure 1B).

2. Aphid Cultures
- Start the laboratory aphid populations from an existing lab isoclonal population or start from the field-collected aphids following the directions below.
- When starting a laboratory population from an existing lab isoclonal population, transfer aphids as described in 2.3.1–2.3.3.
- When starting the new isoclonal, field-collected aphid populations and place a single, reproducing, adult aphid on a suitable host plant as mentioned in Step 1.6. NOTE: Populations may be started from winged (alate) or unwinged (apterous) adults.
- Manually inspect plants from the greenhouse for unwanted pests prior to the use with laboratory aphids. Freeze any plants with unwanted aphids. If desired, use an ethanol vacuum flask to remove thrips or other pests. NOTE: Be sure to rinse plants that have been treated with soap prior to use as described in Step 1.5.2.
- Safely transfer a single adult aphid using a paintbrush or a mouth pipette created with 3/16" ID x 1/4" OD plastic tubing, a 1,000 µL pipette tip, and a 2,00 µL pipette tip (Figure 2A).
- Securely cover plants with aphids with a cup cage created with a plastic cup with the top cut off, covered with a fine mesh and secured with tape (Figure 2B).
- Place aphid-infested plants in a tray and keep in a controlled environmental chamber (16L:8D, 22 °C, 70% humidity).
- To maintain the stock populations, transfer aphids to fresh, new plants weekly (2.2.1–2.2.3).
- Safely transfer 1–3 2nd or 3rd instar nymphs and 1 adult-aged aphids using a mouth pipette (Figures 2A, 3). NOTE: Stocks are best maintained by transferring unwinged individuals.
- Securely cover aphid-infested plants with a cup cage created with a plastic cup with the top cut off, covered with a fine mesh and secured with tape.
- Place plants in a tray and keep aphids in an environmental chamber (16L:8D, 22 °C, 70% humidity).
- Alternatively, if desired and if the host plant is of decent quality, use an ethanol vacuum flask to reduce populations leaving only one reproducing adult and two to three 2nd or 3rd instar nymphs.
- To create same age populations for the use in experiments, place up to 5 adults (preferably unwinged) from the stock population onto a new host plant.
- Remove the adults 24 h later.
- About 5–7 days later, once the F1 offspring have matured to adulthood, place up to 5 unwinged F1 adults on a new host plant. Remove the adults 24 h later.
- Once the F2 population has matured to adulthood, this population is ready to be used in experiments. NOTE: This process ensures that the experimental population is roughly the same age and are born of roughly same age mothers.
Confirm the genotypic differences between field-caught isoclonal lines using microsatellite genotyping (described below, Sections 3 & 4).

3. DNA Extraction
- Preparation
- Use sterile techniques to prepare 1 L lysis buffer (0.1 M NaCl, 0.2 M sucrose, 0.1 M Tris (pH 9.1), 0.05 M EDTA, 0.05% SDS).
- Warm the heating block or water bath to 65 °C.
- Tissue homogenization and lysis
- Place the aphid near the bottom of a sterile, 1.5 mL microcentrifuge tube.
- Place the sterile pestle in the tube with the aphid and immerse the bottom of the tube in liquid nitrogen. NOTE: Optimal tissue disintegration is achieved when the aphid is positioned between the pestle and side of the tube.
- Grind the aphid with the pestle to initially lyse cells.
- For a single adult aphid, use 200 µL (split into 2 x 100 µL aliquots) of the lysis buffer. Add the first aliquot to grind and resuspend the crushed aphid until the sample is visibly disintegrated, then use the second aliquot to wash off the pestle.
- Incubate the crushed aphids in lysis buffer at 65 °C in the water bath or heat block for 30 min.
- DNA precipitation
- While the tube is warm, add 14 µL of 8 M KOAc. Invert the tube to mix.Store the sample on ice for 30 min. Note: The protocol can be paused here, and samples can be stored at -20 °C up to 24 h.
- Centrifuge at 13,000 x g for 15 min at room temperature. Transfer the supernatant to new 1.5 mL tube with a pipette. Be careful not to remove any of the pelleted debris.
- To improve DNA pellet visualization, add 2 µL glycogen (20 µg/mL) to the supernatant. If the sample size is large enough, omit this step.
- Add 200 µL of cold 100% molecular-grade ethanol to the supernatant. Invert tubes to mix and incubate at room temperature for at least 15 min. NOTE: The protocol can be paused here, and samples can be stored at -20 °C up to 24 h.
- Centrifuge at 13,000 x g for 15 min at room temperature. Remove ethanol by pipetting.
- DNA wash and elution
- Add 200 µL of cold 70% molecular-grade ethanol. Then flick the tube to resuspend and wash the pellet.
- Centrifuge at 13,000 x g for 5 min. While visualizing the pellet, carefully remove the ethanol by pipetting and add 200 µL of cold 100% molecular-grade ethanol.
- Centrifuge at 13,000 x g for 5 min. While visualizing the pellet, carefully remove ethanol by pipetting. NOTE: Repeat the 100-70-100 ethanol wash if necessary.
- Air dry the pellets for 5–10 min with the tube laying horizontally open on a tissue paper.
- Resuspend the DNA pellet in 80 µL of low TE (10 mM Tris-HCl, 0.1 mM EDTA).
- Quantify the resuspended DNA using a spectrophotometer.
- Store at 4 °C.
4. Microsatellite PCR and Sequencing for Aphid Genotyping
Order the appropriate F and R primers for microsatellite sequencing (Table 120). NOTE: Reverse primer sequences should be modified with 5'-6-FAM or 5'-5-HEX fluorescent labels to allow for multiplexed samples for microsatellite sequencing.
- Perform PCR with single aphid DNA samples (described in Section 3) and fluorescently labeled microsatellite primers.
- Mix PCR reactions according to the manufacturer's protocol (0.2 µM each F/R primer, 2.5 mM MgCl2, 50–200 ng DNA template).
- Use the following thermocycler settings: initial denaturation at 94 °C for 4 min, 35 cycles of 94 °C for 30 s, 58 °C for 35 s, 72 °C for 45 s, and a final elongation step at 72 °C for 10 min.
Combine PCR samples with different fluorescent tags to reduce the number of samples sequenced and sequence the microsatellite samples at a genotyping facility.
Analyze the .fsa raw sample files using microsatellite analysis software.
5. RNA Extraction
Collect aphids' samples for RNA extraction in 1.5 mL RNase/ DNase-free tubes and immediate freeze in liquid nitrogen. NOTE: If the following steps are not performed immediately, the samples can be stored at -80 °C.
- Tissue homogenization
- With the sterile pestle in the tube with aphid, freeze in liquid nitrogen for 10–15 seconds, until the sample stop sizzling. Crush the aphid well with the pestle as described in step 3.2. NOTE: Optimal tissue disintegration is achieved when the aphid is positioned between the pestle and side of the tube.
- In the fume hood, add 800 µL of guanidinium thiocyanate-phenol-chloroform extraction reagent to the sample (1–5 adult aphids). Homogenize samples with the pestle and dispose of the pestle.
- Phase separation NOTE: All steps should be performed in a fume hood.
- Incubate the homogenized samples for 5 min at room temperature. Add 160 µL of chloroform to sample. Shake vigorously by hand for 15 s.
- Incubate for 2-3 min at room temperature. Centrifuge for 15 min at 12,000 x g at 4 °C. NOTE: Following centrifugation, the mixture separates into 3 layers: a lower, red phenol-chloroform phase, an interphase and a colorless upper aqueous phase. The RNA remains exclusively in the aqueous phase. The volume of the aqueous will be ~480 µL.
- RNA precipitation
- In a fume hood, transfer the aqueous phase to a fresh, RNase-free tube. Do not disturb the intermediate phase.
- Precipitate the RNA by adding 400 µL of isopropanol and incubate the sample at -20 °C for 10 min. NOTE: The protocol can be paused here, and samples can be stored at -20 °C up to 24 h.
- Centrifuge the sample for 10 min at 12,000 x g at 4 °C.
- RNA wash and elution
- Remove the supernatant; watch for the RNA pellet.
- Wash the RNA pellet with 1 mL of 75% ethanol in DEPC-treated water. Mix by slow vortexing. Centrifuge for 5 min at 7,500 x g at 4 °C.
- Repeat steps 5.5.1–5.5.2 to help remove phenol contaminants.
- Remove the supernatant and air dry the pellet for 5-10 min with tube laying horizontally open on a sterile bench. Do not let the RNA pellet dry completely.
- Dissolve the RNA pellet in 30 µL of RNase-free or DEPC-treated water. Gently pipette up and down to mix. Incubate at 55–60 °C for 10–15 min.
6. RNAseq De Novo Transcriptome Assembly, Annotation, and Differential Expression Analysis
- Analyze RNA sample concentration and quality using a chip-based capillary electrophoretic system. NOTE: A chip-based capillary electrophoresis system is the preferable method of choice than analyzing with a spectrophotometer because it provides a more accurate and sensitive measure of RNA concentration and quality.
- If samples are of suitable quality (≥ 250 ng total, RIN (RNA Integrity Number) ≥ 5), perform RNA sequencing. NOTE: Importantly, because this sequencing data will be used for both expression profiling and de novo transcriptome assembly, more read depth will result in a higher quality transcriptome. For a reasonably comprehensive assembly using Illumina sequencing technology, 100–200 million 100 bp, paired end reads would be a recommended starting point. Total mRNA library preparation and RNA sequencing were performed by a sequencing facility.
Check the quality of reads using Fast QC22.
Combine all sample reads and assemble the transcriptome de novo using Trinity23,24 (Trimmomatic quality filtering enabled).
- Refine the assembly
- Use Transdecoder25 to identify open reading frames (ORFs) that are a minimum of 100 amino acids in length.
- Remove bacterial transcripts (any translated sequence whose best BLAST hit was to a bacterial gene with a bit score of over 300 and a minimum amino acid sequence identity of 50%).
- Collapse any complete, translated ORFs that are at least 99% identical at the amino acid level using CD-HIT30.
- Collapse the remaining, incomplete ORFs that are at least 95% identical at the nucleotide level using CD-HIT30.
- Assign the remaining nucleotide sequences with unique, species-specific identifiers (e.g., APHNE 0001).
Assess the completeness of the refined assembly, using BUSCO (http://busco.ezlab.org/) and the Arthropoda gene dataset31.
- Transcriptome annotation
- Third, annotate the transcriptome using BLASTP against the coding sequences of selected insects with published, annotated genomes.
- Last, annotate the transcriptome using BLASTP against the pea aphid protein database only.
- Use Trinotate to generate GO annotations from UniProt accessions.
- Use Trinotate to organize all the annotation results into a SQLite database and generate an annotation report.
- Differential expression analysis NOTE: Using the refined transcriptome as a reference, align and quantify each library separately.
- Use Trimmomatic to quality-filter and trim the original read files32. Note: If performing this step after a Trinity assembly, one may instead use the Trimmomatic output from that step.
- Perform local alignments for each sample using Bowtie233.
- Extract the read counts from each sample individually using SAMtools34.
- Calculate the differential expression between samples of interest using DESeq2 with the default parameters and a parametric fit35.
7. qPCR Verification of Differentially Expressed Genes
NOTE: If users are interested in differentially expressed genes from their RNAseq experiments, the following protocol can be used to verify patterns of differential expression.
Generate RNA samples as described above (step 5).
Quantitate RNA extractions using a spectrophotometer to check for the quality and obtain the concentration.
Synthesize cDNA samples using a commercially available kit as per the manufacturer's recommendation.
- Determine the primer efficiencies for genes of interest to ensure accurate two-fold PCR amplification.
- Based on original RNA concentrations, perform serial dilutions (101) to obtain 3 cDNA concentrations.
- Using a quantitative PCR master mix, mix triplicate qPCR reactions according to the manufacturer's protocol using three primer concentrations (e.g., 100 nM, 200 nM, 300 nM) with three serially diluted cDNA concentrations (e.g., 0.1 ng/µL, 10 ng/µL, 100 ng/µL).
- For each target gene, calculate the slope (m) of the line created using the mean Ct values for each sample as the dependent variables and the log (cDNA concentration) as the independent variables (three points total).
- Use the following equation to calculate the primer efficiency (E) where m is the slope calculated in 7.4.3: E = 10^(-1/m) NOTE: Primer efficiencies between 90-110% are suitable for analyses. This process ensures equal amplification of all genes included in the calculations.
Use the ΔΔCt method with a housekeeping gene to quantify the differential expression for genes of interest36.
Representative Results
Plant cultures: Seeds will take approximately two to four weeks, depending on the season, to grow large enough to be re-potted (Figure 1A). Re-potted seedlings will take another two to four weeks to grow to an optimal size for aphid cultures (Figure 1B).
Aphid cultures: Adult A. nerii are distinguished by some darkened cauda and may be unwinged (apterous, Figure 3A, B) or winged (alate, Figure 3C, D). Developing wing pads become visible when nymphs reach the third instar (Figure 3E, F). Stock cultures are best maintained by transferring one to three mid-instar and one adult-aged unwinged aphids; this ensures a healthy, mixed age population. Populations to be used for experiments should be cultured using unwinged aphids as described above (2.4). One A. nerii adult can produce 3-10 offspring per day, dependent on the host plant and age of the aphid10.

DNA and RNA extractions: Single, adult A. nerii will yield approximately 100–200 ng/µL DNA (80 µL elution; Figure 4A) and 150–300 ng/µL RNA (30 µL elution; Figure 4B). Representative microsatellite peaks are shown in Figure 5. Representative relative expression of a candidate gene under three conditions (control, Treatment 1, Treatment 2) are calculated in Table 2 and shown in Figure 6.



Figure 1: Representative plants for aphid cultures. (A) Seedlings can be re-potted after they have developed their first full set of true leaves. (B) Plants can be used for aphid cultures when they have developed 3-4 sets of true leaves. Please click here to view a larger version of this figure.
Figure 2: Examples of tools used for culturing aphids. (A) Mouth pipettes can be created using 3/16" ID x 1/4" OD plastic tubing, a 1,000 µL pipette tip, and a 200 µL pipette tip. (B, C) Use cup cages (clear plastic cups with the top cut off and secured with fine mesh) to securely fit over the top of 4 in. pots used for aphid cultures. This allows for ample light and ventilation to create a suitable environment for the aphids and plant, and keeps the aphids contained. Please click here to view a larger version of this figure.
Figure 3: Representative adult and nymph Aphis nerii. (A, B) Apterous (unwinged) adult A. nerii are identified by darkened cauda at their posterior end. (C, D) Alate (winged) adults are identified by fully developed wings and darkened cauda at their posterior. (E, F) Developing A. nerii nymphs go through four instar stages and developing wing pads become apparent during the third instar stage. Please click here to view a larger version of this figure.
Figure 4: Representative gels. (A) DNA extractions (1kb ladder). Seven A. nerii DNA extractions are visualized in lanes 3-9. Negative control is in lane 10. (B) RNA extractions. Eleven A. nerii RNA extractions are visualized in lanes 3-13. Please click here to view a larger version of this figure.
Figure 5: Representative microsatellite peaks. 6-FAM-tagged peaks are visualized in blue. LIZ-500 ladder is shown in orange. Please click here to view a larger version of this figure.
Figure 6: qPCR verification of a differentially expressed gene. Representative mRNA relative quantity (RQ) expression (calculated using the ΔΔCt method, Table 2) shown for a candidate gene of interest under three conditions: control, treatment 1, treatment 2. Graph shows decreased expression of candidate gene under treatments 1 and 2 compared to the control (Table 2). Please click here to view a larger version of this figure.
| Primer Name | Direction | Sequence (5'-3') |
| Ago24_F | forward | TTTTCCCGGCACACCGAGT |
| Ago24_R | reverse | GCCAAACTTTACACCCCGC |
| Ago 53_F | forward | TGACGAACGTGGTTAGTCGT |
| Ago 53_R | reverse | GGCATAACGTCCTAGTCACA |
| Ago 59_F | forward | GCGAGTGGTATTCGCTTAGT |
| Ago 59_R | reverse | GTTACCCTCGACGATTGCGT |
| Ago 66_F | forward | TCGGTTTGGCAACGTCGGGC |
| Ago 66_R | reverse | GACTAGGGAGATGCCGGCGA |
| Ago 69_F | forward | CGACTCAGCCCCGAGATTT |
| Ago 69_R | reverse | ATACAAGCAAACATAGACGGAA |
| Ago 84_F | forward | GACAGTGGTGAGGTTTCAA |
| Ago 84_R | reverse | ACTGGCGTTACCTTGTCTA |
| Ago 89_F | forward | GAACAGTGCTCGCAGTCTAT |
| Ago 89_R | reverse | GACAGCGTAAACATCGCGGT |
| Ago 126_F | forward | GGTACATTCGTGTCGATTT |
| Ago 126_R | reverse | TAAACGAAAAAACCACGTAC |
Table 1: Microsatellite primer sequences used to genotype Aphis nerii 20 .
| Target | Sample | Ct Mean | Ct Std. Dev | ΔCt | avg. ΔCt | ΔΔCt | RQ=2^(-ΔΔCt) | RQ SEM |
| ef1a | 1.1 | 22.59 | 0 | |||||
| ef1a | 1.2 | 20.31 | 0 | |||||
| ef1a | 1.3 | 20.36 | 0.226 | |||||
| ef1a | 1.4 | 20.27 | 0.036 | |||||
| ef1a | 1.5 | 20.55 | 0.003 | |||||
| ef1a | 1.6 | 20.52 | 0.245 | |||||
| ef1a | 2.1 | 20.49 | 0.082 | |||||
| ef1a | 2.2 | 19.86 | 0.033 | |||||
| ef1a | 2.3 | 20.19 | 0.037 | |||||
| ef1a | 2.4 | 19.67 | 0.058 | |||||
| ef1a | 2.5 | 20.25 | 0.188 | |||||
| ef1a | 2.6 | 18.16 | 0.089 | |||||
| ef1a | 3.1 | 20.93 | 0.157 | |||||
| ef1a | 3.2 | 20.22 | 0.003 | |||||
| ef1a | 3.3 | 20.44 | 0.039 | |||||
| ef1a | 3.4 | 20.91 | 0.559 | |||||
| ef1a | 3.5 | 20.63 | 0.017 | |||||
| ef1a | 3.6 | 20.3 | 0.135 | |||||
| gene of interest | 1.1 | 24.6 | 0.173 | 2.01 | 0 | 1 | ||
| gene of interest | 1.2 | 24.25 | 0.019 | 3.94 | 2.975 | 0 | 1 | 0 |
| gene of interest | 1.3 | 24.79 | 0.04 | 4.43 | 0 | 1 | ||
| gene of interest | 1.4 | 25.23 | 0.285 | 4.96 | 4.695 | 0 | 1 | 0 |
| gene of interest | 1.5 | 24.6 | 0.103 | 4.05 | 0 | 1 | ||
| gene of interest | 1.6 | 25.08 | 0.033 | 4.56 | 4.305 | 0 | 1 | 0 |
| gene of interest | 2.1 | 27.52 | 0.155 | 7.03 | 5.019033762 | 0.03084042 | ||
| gene of interest | 2.2 | 27.23 | 0.061 | 7.37 | 7.2 | 3.428355679 | 0.092888533 | 0.031024057 |
| gene of interest | 2.3 | 27.18 | 0.058 | 6.99 | 2.56158174 | 0.169389724 | ||
| gene of interest | 2.4 | 27.45 | 0 | 7.78 | 7.385 | 2.820764967 | 0.141535419 | 0.013927153 |
| gene of interest | 2.5 | 27.44 | 0.032 | 7.19 | 3.138956897 | 0.113521944 | ||
| gene of interest | 2.6 | 28 | 0 | 9.84 | 8.515 | 5.284272079 | 0.025661119 | 0.043930413 |
| gene of interest | 3.1 | 27.23 | 0.143 | 6.3 | 4.292437371 | 0.051032588 | ||
| gene of interest | 3.2 | 27.05 | 0.088 | 6.83 | 6.565 | 2.891234282 | 0.134788164 | 0.041877788 |
| gene of interest | 3.3 | 27.45 | 0.109 | 7.01 | 2.578145722 | 0.167456035 | ||
| gene of interest | 3.4 | 27.58 | 0.019 | 6.67 | 6.84 | 1.709038085 | 0.305863936 | 0.069203951 |
| gene of interest | 3.5 | 27.06 | 0.067 | 6.43 | 2.384498984 | 0.191511246 | ||
| gene of interest | 3.6 | 27.36 | 0 | 7.06 | 6.745 | 2.513723938 | 0.175103043 | 0.008204101 |
Table 2: Calculations for qPCR ΔΔCt verification of candidate gene. Candidate gene expression is calculated relative to ef1a (Figure 6). Samples 1.1-1.6 represent six biological replicates under the control treatment; samples 2.1-2.6 represent six biological replicates under Treatment 1; samples 3.1-3.6 represent six biological replicates under Treatment 2. Ct Std. Dev. is calculated from three technical replicates.
Discussion
It has long been recognized that the aposematic A. nerii can provide insights into the patterns and mechanisms of resistance to plant defenses and particularly chemical sequestration18,37. A number of genomic resources have recently emerged for A. nerii10, offering new opportunities for ecological and functional genomic studies that use A. nerii as a model. We outline basic protocols in aphid and plant culture, and molecular/genomic techniques, with the assumption that future work on this species will likely involve studies that utilize genomic and functional ecological approaches. Many open questions remain about the mechanisms and significance of cardenolide detoxification and sequestration in A. nerii. Techniques such as RNAi for expression knockdown or gene editing approaches will prove valuable in this regard.
One of the challenges in culturing aphids is in their prodigious capacities for the reproduction and dispersal. These traits, which directly relate to why they are serious crop pests, means that aphid cultures require almost daily attention, as well as extreme care if isogenic lines are required for experiments. The techniques described above, including those for generating data for the analysis of gene expression, while similar to general protocols for aphid rearing and molecular analysis, provide a specific step-by-step guide to generating sufficient biological material for A. nerii for a diverse set of molecular and ecological applications.
To this end, if functional or ecological genomic studies are on the horizon for A. nerii, these will need to be coupled with live cultures to fully capitalize on the experimental opportunities they offer. Insect herbivores live in complex communities on their host plants, and both intraspecific interactions38,39 as well as interspecific interactions40 shape the ultimate response of A. nerii to their host plants. The host plants, A. nerii specialize on, represent a diverse set of plants that express divergent life history strategies15,21, underscoring the importance of coupling purely genomic or physiological approaches with experimental manipulations that account for naturally-occurring variation in A. nerii communities. The methods outlined here are starting points for a functional and ecological genomic perspective on A. nerii and its interactions with toxic host plants.
Disclosures
The authors have nothing to disclose.
Acknowledgments
We would like to thank Michelle Moon (Vanderbilt University) for assistance with photography. Vanderbilt University provided support to PA and SSLB is supported by DGE-1445197.
References
- Brisson JA, Stern DL. The pea aphid, Acyrthosiphon pisum.: an emerging genomic model system for ecological, developmental and evolutionary studies. BioEssays. 2006;28:747–755. doi: 10.1002/bies.20436. [DOI] [PubMed] [Google Scholar]
- Dixon AFG. Aphid Ecology: An Optimization Approach. Netherlands: Springer; 1985. [Google Scholar]
- Consortium TIAG. Genome Sequence of the Pea Aphid Acyrthosiphon pisum. PLoS Biology. 2010. p. 1000313. [DOI] [PMC free article] [PubMed]
- Srinivasan DG, Brisson JA. Aphids: A Model for Polyphenism and Epigenetics. Genetics Research International. 2012;2012:1–12. doi: 10.1155/2012/431531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wenger JA, et al. Whole genome sequence of the soybean aphid, Aphis glycines. Insect Biochememistry and Molecular Biology. 2017. pp. 1–10. [DOI] [PubMed]
- Aphidbase. Genouest.org. 2018. Available from: bipaa.genouest.org/is/aphidbase/
- Li Z-Q, et al. Ecological adaption analysis of the cotton aphid (Aphis gossypii) in different phenotypes by transcriptome comparison. PLoS ONE. 2013;8:83180. doi: 10.1371/journal.pone.0083180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang D, Liu Q, Jones HD, Bruce T, Xia L. Comparative transcriptomic analyses revealed divergences of two agriculturally important aphid species. BMC Genomics. 2014;15(1):1023–1024. doi: 10.1186/1471-2164-15-1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu S, et al. De novo characterization of the pine aphid Cinara pinitabulaeformis Zhang et Zhang transcriptome and analysis of genes relevant to pesticides. PLoS ONE. 2017;12:0178496–0178517. doi: 10.1371/journal.pone.0178496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Birnbaum SSL, Rinker DC, Gerardo NM, Abbot P. Transcriptional profile and differential fitness in a specialist milkweed insect across host plants varying in toxicity. Molecular Ecology. 2017. [DOI] [PubMed]
- Dixon AFG. Insect Herbivore-Host Dynamics. Cambridge: Cambridge University Press; 2005. [Google Scholar]
- Goggin FL. Plant-aphid interactions: molecular and ecological perspectives. Current Opinion in Plant Biology. 2007;10:399–408. doi: 10.1016/j.pbi.2007.06.004. [DOI] [PubMed] [Google Scholar]
- Will T, Furch A, Zimmermann MR. How phloem-feeding insects face the challenge of phloem-located defenses. Frontiers in Plant Science. 2013;4:1–12. doi: 10.3389/fpls.2013.00336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Webster B. The role of olfaction in aphid host location. Physiological Entomology. 2012;37:10–18. [Google Scholar]
- Agrawal AA, Petschenka G, Bingham RA, Weber MG, Rasmann S. Toxic cardenolides: chemical ecology and coevolution of specialized plant-herbivore interactions. New Phytologist. 2012;194:28–45. doi: 10.1111/j.1469-8137.2011.04049.x. [DOI] [PubMed] [Google Scholar]
- Dobler S, Petschenka G, Pankoke H. Coping with toxic plant compounds- the insect's perspective on iridoid glycosides and cardenolides. Phytochemistry. 2011;72:1593–1604. doi: 10.1016/j.phytochem.2011.04.015. [DOI] [PubMed] [Google Scholar]
- Opitz SEW, Müller C. Plant chemistry and insect sequestration. Chemoecology. 2009;19:117–154. [Google Scholar]
- Birnbaum SSL, Abbot P. Insect adaptations toward plant toxins in milkweed-herbivores systems - a review. Entomologia Experimentalis et Applicata. 2018;58:579–610. [Google Scholar]
- Rothschild M, von Euw J, Reichstein T. Cardiac glycosides in the oleander aphid, Aphis nerii. Journal of Insect Physiology. 1970;16:1141–1145. doi: 10.1016/0022-1910(70)90203-9. [DOI] [PubMed] [Google Scholar]
- Harrison JS, Mondor EB. Evidence for an invasive aphid 'superclone': extremely low genetic diversity in oleander aphid (Aphis nerii) populations in the southern United States. PLoS ONE. 2011;6:17524. doi: 10.1371/journal.pone.0017524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mooney KA, Halitschke R, Kessler A, Agrawal AA. Evolutionary trade-offs in plants mediate the strength of trophic cascades. Science. 2010;327:1642–1644. doi: 10.1126/science.1184814. [DOI] [PubMed] [Google Scholar]
- Andrews S. FastQC: a quality control tool for high throughput sequence data. Bioinformatics. 2010. Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc.
- Grabherr MG, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology. 2011;29:644–652. doi: 10.1038/nbt.1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Haas BJ, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature Protocols. 2013;8:1494–1512. doi: 10.1038/nprot.2013.084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Transdecoder. 2018. Available from: http://transdecoder.sf.net.
- Finn RD, et al. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Research. 2016;44:279–285. doi: 10.1093/nar/gkv1344. Database Issue. [DOI] [PMC free article] [PubMed] [Google Scholar]
- The UniProt Consortium. UniProt: the universal protein knowledgebase. Nucleic Acids Research. 2017;45:158–169. doi: 10.1093/nar/gky092. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johnson M, et al. NCBI BLAST: a better web interface. Nucleic Acids Research. 2008;1(36):5–9. doi: 10.1093/nar/gkn201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hmmer.org. 2018. Available from: http://hmmer.org.
- Fu L, Niu B, Zhu Z, Wu S, Li W. CD-HIT: accelerated for clustering the next generation sequencing data. Bioinformatics. 2012;28(23):3150–3152. doi: 10.1093/bioinformatics/bts565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simão FA, Waterhouse RM, Ioannidis P, Kriventseva EV, Zdobnov EM. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 2015;31:3210–3212. doi: 10.1093/bioinformatics/btv351. [DOI] [PubMed] [Google Scholar]
- Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012;9:357–359. doi: 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li H, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15:31. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rieu I, Powers SJ. Real-time quantitative RT-PCR: design, calculations, and statistics. Plant Cell. 2009;21:1031–1033. doi: 10.1105/tpc.109.066001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Malcolm SB. Chemical defence in chewing and sucking insect herbivores: plant-derived cardenolides in the monarch butterfly and oleander aphid. Chemoecology. 1990;1:12–21. [Google Scholar]
- Agrawal AA, Underwood N, Stinchcombe JR. Intraspecific variation in the strength of density dependence in aphid populations. Ecological Entomology. 2004;29:521–526. [Google Scholar]
- Zehnder CB, Hunter MD. A comparison of maternal effects and current environment on vital rates of Aphis nerii, the milkweed-oleander aphid. Ecological Entomology. 2007;32:172–180. [Google Scholar]
- Hartbauer M. Collective defense of Aphis nerii and Uroleucon hypochoeridis (Homoptera, Aphididae) against natural enemies. PLoS ONE. 2010;5:10417. doi: 10.1371/journal.pone.0010417. [DOI] [PMC free article] [PubMed] [Google Scholar]
