Methanotrophs have long been considered promising strains for biologically reducing methane from the environment and converting it into valuable products, because they can oxidize methane at ambient temperatures and pressures. Although several methodologies and tools for the genetic manipulation of methanotrophs have been developed, their mutagenic efficiency remains lower than that of tractable strains such as Escherichia coli. Therefore, further improvements are still desired. The significance of our study is that we increased the efficiency of counterselection in M. capsulatus (Bath) by employing pheS*, which was newly constructed as a counterselectable marker. This will allow for the efficient production of gene-disrupted and gene-integrated mutants of M. capsulatus (Bath). We anticipate that this counterselection system will be utilized widely by the methanotroph research community, leading to improved productivity of methane-based bioproduction and new insights into methanotrophy.
KEYWORDS: counterselection, Methylococcus capsulatus, methanotroph, pheS
ABSTRACT
Methylococcus capsulatus (Bath) is a representative gammaproteobacterial methanotroph that has been studied extensively in diverse research fields. The sacB gene, which encodes levansucrase, causing cell death in the presence of sucrose, is widely used as a counterselectable marker for disruption of a target gene in Gram-negative bacteria. However, sacB is not applicable to all Gram-negative bacteria, and its efficiency for the counterselection of M. capsulatus (Bath) is low. Here, we report the construction of an alternative counterselectable marker, pheS*, by introduction of two point mutations (A306G and T252A) into the pheS gene from M. capsulatus (Bath), which encodes the α-subunit of phenylalanyl-tRNA synthetase. The transformant harboring pheS* on an expression plasmid showed sensitivity to 10 mM p-chloro-phenylalanine, whereas the transformant harboring an empty plasmid showed no sensitivity, indicating the availability of pheS* as a counterselectable marker in M. capsulatus (Bath). To validate the utility of the pheS* marker in counterselection, we attempted to obtain an unmarked mutant of xoxF, a gene encoding the major subunit of Xox methanol dehydrogenase, which we failed to obtain by counterselection using the sacB marker. PCR, immunodetection using an anti-XoxF antiserum, and a cell growth assay in the absence of calcium demonstrated successful disruption of the xoxF gene in M. capsulatus (Bath). The difference in counterselection efficiencies of the markers indicated that pheS* is more suitable than sacB for counterselection in M. capsulatus (Bath). This study provides a new genetic tool enabling efficient counterselection in M. capsulatus (Bath).
IMPORTANCE Methanotrophs have long been considered promising strains for biologically reducing methane from the environment and converting it into valuable products, because they can oxidize methane at ambient temperatures and pressures. Although several methodologies and tools for the genetic manipulation of methanotrophs have been developed, their mutagenic efficiency remains lower than that of tractable strains such as Escherichia coli. Therefore, further improvements are still desired. The significance of our study is that we increased the efficiency of counterselection in M. capsulatus (Bath) by employing pheS*, which was newly constructed as a counterselectable marker. This will allow for the efficient production of gene-disrupted and gene-integrated mutants of M. capsulatus (Bath). We anticipate that this counterselection system will be utilized widely by the methanotroph research community, leading to improved productivity of methane-based bioproduction and new insights into methanotrophy.
INTRODUCTION
The atmospheric concentration of the greenhouse gas methane is the second highest after carbon dioxide (CO2), and methane has a global warming potential of 25 CO2 equivalents (1). To mitigate global warming, it is important to reduce the levels of atmospheric methane. Environmental methane has attracted attention as a chemical feedstock because it exists as a main component of natural gas, shale gas, and biogas (2). Despite the high stability and low reactivity of the C-H bond in methane, methanotrophs can activate it through methane monooxygenase and utilize methane as a sole carbon and energy source. Therefore, methanotrophs have long been considered promising strains for biologically reducing methane and converting it into valuable products. Proteobacterial methanotrophs can be broadly divided into type I and type II, composed of gammaproteobacteria and alphaproteobacteria, respectively. Representatives of each type, namely, Methylococcus capsulatus (Bath) and Methylosinus trichosporium OB3b, have been studied extensively for methane-based bioproduction such as single-cell protein, polyhydroxybutyrate, vitamin, lipid, lactic acid, isoprene, succinic acid, and methanol production (3–6). Because the productivity of most of these processes remains low, efforts to improve them have been undertaken. Recent advances in metabolic engineering, synthetic biology, and genome-editing technologies have been anticipated to improve the productivity of methane-based bioproduction (7). Although genetic tools and electroporation techniques have been developed recently for both types of methanotrophs (8–12), the efficiency of genetic manipulation is still low compared to that for tractable host strains such as Escherichia coli (5). Further improvement of these tools and techniques is required for the efficient genetic manipulation of methanotrophs.
In counterselection for gene disruption in methanotrophs, the sacB gene is employed as the only available marker (8, 9, 12–16). Levansucrase, encoded by the sacB gene, converts sucrose into levan, which accumulates in the periplasmic space, thereby causing cell death in Gram-negative bacteria (17). However, sacB is not universal for all Gram-negative bacteria, resulting in the need for an alternative counterselectable marker (18). Mutated pheS (pheS*), rpsL, thyA, and tdk are used frequently as alternative counterselectable markers (17, 19). The use of the counterselectable markers rpsL, thyA, and tdk depends on the host genotype; a host strain requires resistance to streptomycin for the use of rpsL, resistance to trimethoprim for the use of thyA, and resistance to a toxic nucleoside analog such as 5-fluoro-2′-deoxyuridine for the use of tdk. In contrast, pheS* is a host genotype-independent counterselectable marker that requires no resistance in a host strain.
The pheS gene encodes the highly conserved α-subunit of phenylalanyl-tRNA synthetase. A counterselection system using pheS* was first developed in E. coli (20). As PheS from E. coli with an A294G substitution shows low substrate specificity, PheS* incorporates p-chloro-phenylalanine (p-Cl-Phe) into proteins during translation, thereby causing cell death. Furthermore, Miyazaki recently reported that substitution of T251 in PheS from E. coli with alanine or serine increased the efficiency of counterselection (21). Although individual pheS* genes have been constructed and used for counterselection in various bacteria (18, 22–25), counterselection using pheS* has not been carried out in methanotrophs.
In this study, we aimed to develop an efficient gene disruption method for M. capsulatus (Bath) using pheS* as a counterselectable marker. Then, we validated the efficiency of this novel method with the conventional sacB method by constructing disruptant strains targeting the xoxF gene (Table 1), a structural gene encoding one of the two isozymes of methanol dehydrogenase (MDH).
TABLE 1.
Bacterial strains and plasmids used in this study
Strain or plasmid | Descriptiona | Reference or source |
---|---|---|
Methylococcus capsulatus (Bath) | ||
Wild type | Wild-type strain | 26 |
SC-SacB | Single-crossover mutant constructed by integration of pJQYS1 in flanking region of xoxF of M. capsulatus (Bath) | This study |
SC-PheS* | Single-crossover mutant constructed by integration of pJQYS2 in flanking region of xoxF of M. capsulatus (Bath) | This study |
ΔxoxF | Unmarked mutant of xoxF (MCA0299) | This study |
Bath (empty) | Transformant of M. capsulatus (Bath) harboring pJN105 (vector control) | This study |
Bath (pPheS*) | Transformant of M. capsulatus (Bath) harboring pPheS* | This study |
Escherichia coli | ||
XL10-Gold | Host for routine cloning | Agilent |
WM6026 | Donor strain for conjugation | 46 |
Plasmids | ||
pJQ200sk | Suicide plasmid; Gmr, SacB | 45 |
pUC57-pheS* | pUC57 harboring pheS* | This study |
pJQY3 | Suicide plasmid produced by substitution of sacB in pJQ200sk with pheS* | This study |
pJQYS1 | DNA fragment containing upstream and downstream regions of xoxF ligated into BamHI site of pJQ200sk | This study |
pJQYS2 | DNA fragment containing upstream and downstream regions of xoxF ligated into BamHI site of pJQY3 | This study |
pJN105 | Broad-host-range plasmid; Gmr, araC-PBAD promoter | 44 |
pPheS* | pJN105 carrying pheS* derived from M. capsulatus (Bath) under control of araC-PBAD promoter | This study |
Gmr, gentamicin resistance.
RESULTS
Low efficiency of counterselection using sacB in M. capsulatus (Bath).
In this study, the xoxF gene, which encodes the structural protein MDH, was selected as a model gene to verify the efficiency of the gene disruption methods. Like other methanotrophs, M. capsulatus (Bath) possesses 2 different MDHs, namely, Mxa MDH and Xox MDH (26). Thus, inactivation of a single MDH is not lethal to methanotrophs. Moreover, the phenotype of an MDH mutant can be predicted because the MDHs are dependent on different metal elements for enzymatic activity (15, 27–30); Mxa MDH requires calcium, whereas Xox MDH requires a rare earth element. Because calcium ion is found in the crystal structure of Mxa MDH from M. capsulatus (Bath) (31), its ΔxoxF mutant was assumed to show a calcium-dependent phenotype.
First, we attempted to construct a mutant of xoxF with a typical plasmid-based method, using the sacB gene as a counterselectable marker (Fig. 1). To prepare the suicide plasmid pJQYS1, the upstream and downstream regions of the xoxF gene were cloned into pJQ200sk, which is the same plasmid as used previously for counterselection in M. capsulatus (Bath) (13). Plasmid integration into the target site was confirmed by PCR using the Scr-F and Scr-R primers in a single-crossover mutant (SC-SacB) grown on a gentamicin plate (Fig. 2A). The Scr-F and Scr-R primers anneal to the outside and the inside, respectively, of the flanking regions of the xoxF gene used as homologous sites for recombination (Table 2). Although 1,897-bp and 10,655-bp DNA bands were expected to appear, the shorter fragment was amplified predominantly. The SC-SacB mutant was then plated on a sucrose plate for counterselection. From the resultant colonies on the sucrose plate, we attempted to select double-crossover mutants by PCR using the primers Scr-F and Scr-R2, but we were unable to obtain an expected mutant. To confirm the emergence of double-crossover mutants, colonies grown on the sucrose plate were transferred to a gentamicin plate. All of the tested colonies showed resistance to gentamicin, indicating that no double-crossover mutants were generated (Table 3). This low efficiency of counterselection suggested that selection pressure from sucrose was not lethal to the SC-SacB mutant. To confirm selection pressure from sucrose in the SC-SacB mutant, serial dilutions of the cell suspension were spotted on a sucrose plate (Fig. 2B). There was no clear difference in cell growth between wild-type and SC-SacB mutant colonies. When the SC-SacB mutant was cultivated on a sucrose plate, we observed a difference in appearance between wild-type and SC-SacB mutant colonies; SC-SacB colonies appeared to be lysed (Fig. 2C). Because the sucrose concentration was assumed not to be sufficiently high enough to cause cell death of the SC-SacB mutant, the concentration was increased to 10% (wt/vol). However, this high sucrose concentration inhibited the growth of wild-type colonies (data not shown). These results implied that SacB was unlikely to function effectively as a counterselectable marker in the SC-SacB mutant.
FIG 1.
Schematic representation of plasmid-based counterselection. The suicide plasmids, antibiotic resistance marker (ARM), and counterselectable marker (CRM) used in this study are indicated in parentheses. Gmr, gentamicin resistance gene. Half arrows indicate primers (P1, Scr-F; P2, Scr-R; P3, Scr-F2). The nucleotide sequences of these primers are shown in Table 2. Suc, sucrose; WT, wild type.
FIG 2.
Counterselection using sacB in Methylococcus capsulatus (Bath). (A) PCR confirmation of plasmid integration. PCR was performed using the primers Scr-F and Scr-R. The nucleotide sequences of these primers are shown in Table 2. From the genome sequence information for M. capsulatus (Bath), the lengths of PCR amplicons from the wild type (WT) and SC-SacB are expected to be 3,633 bp and 1,897 bp plus 10,655 bp, respectively. The PCR amplicon from SC-SacB indicates plasmid integration into the flanking chromosomal region of xoxF. (B) Sucrose sensitivity of a plasmid-integrated mutant of M. capsulatus. Cell suspensions of the wild type and the plasmid-integrated mutant (SC-SacB) were serially diluted 1:10. Each serial dilution was spotted onto an NMS agar plate containing 5% sucrose. (C) Different appearances of wild-type and SC-SacB colonies on an NMS agar plate containing 5% sucrose.
TABLE 2.
Primers used in this study
Primer name | Sequence (5′ to 3′) |
---|---|
xoxF-upstF | CGAATTCCTGCAGCCCGGGGGATCCAGTTCCATGCTTTCCTCG |
xoxF-upstR | CCAGACCTTCAACTTGCGATGAGCCAGC |
xoxF-dwstF | ATCGCAAGTTGAAGGTCTGGGTGCGGTG |
xoxF-dwstR | CGGCCGCTCTAGAACTAGTGGATCCGGCTTGTTGTGATAGACCAG |
PheS-F | CTAGCTAGAGGATCGATCCTCTGCAGTTGACAGCTAGC |
PheS-R | TTGCGTTTTTACAGCTGTCGTCAGAAGGGTTTGAACTG |
iPCR-pJQR | AGGATCGATCCTCTAGCTAGA |
iPCR-pJQF | CGACAGCTGTAAAAACGCAAAAGAAAATGCCGA |
pPheS-F | ACCCGTTTTTTTGGGCTAGCCTGCAGTTGACAGCTAGC |
pPheS-R | GTGGATCCCCCGGGCTGCAGTCAGAAGGGTTTGAACTG |
Scr-F | GTTGCAAGACCGTTGAGATAGCGTTCCTCG |
Scr-R | AGCCGTCGAACATGGCGATC |
Scr-R2 | CAGCGGGACGTGATATTTCCTCAGCAGAGC |
TABLE 3.
Comparison of the mutagenic efficiency of different counterselectable markers
Marker | Selectiona | No. of mutantsb |
Efficiency (%) | |
---|---|---|---|---|
Double-crossover mutant | Unexpected mutant | |||
sacB | Gm, Suc | 0 (Gms, Sucr) | 60 (Gmr, Sucr) | 0 |
pheS* | Gm, Cl-Phe | 19 (Gms, Cl-Pher) | 41 (Gmr, Cl-Pher) | 31.7 |
Gm, gentamicin; Suc, sucrose; Cl-Phe, p-chloro-phenylalanine.
Sixty colonies were randomly selected to test for resistance (r) or sensitivity (s) to each chemical.
Construction of a pheS* marker for counterselection in M. capsulatus (Bath).
Instead of the sacB marker, we attempted to employ a pheS* marker, which has been established as a counterselectable marker in various bacteria (18, 22–25), for counterselection in M. capsulatus (Bath). The amino acid sequence of PheS from M. capsulatus (Bath) was aligned with those from E. coli and other representative methanotrophs (Fig. 3). PheS from M. capsulatus (Bath) possesses conserved alanine (A306) and tyrosine (T252) residues, corresponding to A294 and T251, respectively, in PheS from E. coli. To construct PheS* available for counterselection in M. capsulatus (Bath), we added two point mutations (A306G and T252A) to PheS from M. capsulatus (Bath). In the case of counterselection using pheS*, there is concern regarding homologous recombination between the pheS* cassette and the chromosomal copy of pheS, which reduces the efficiency of counterselection. Xie et al. reported that silent mutations downstream of the pheS* point mutation site could prevent such homologous recombination (23). Based on that report, we introduced silent mutations into pheS* from M. capsulatus (Bath) when constructing it by artificial gene synthesis (see Fig. S1 in the supplemental material).
FIG 3.
Sequence alignment of PheS orthologs derived from Escherichia coli and representative methanotrophs. Red boxes indicate the conserved residues, corresponding to tyrosine at position 251 and alanine at position 294 in E. coli. The T251A and A294G substitutions are known to reduce the substrate specificity of PheS and allow incorporation of p-Cl-Phe into proteins during translation, thereby causing cell death.
To determine whether the constructed pheS* caused cell death of M. capsulatus (Bath) in the presence of p-Cl-Phe, we examined the p-Cl-Phe sensitivity of the transformant, Bath (pPheS*), harboring the pheS* gene under the control of the arabinose-inducible promoter on the expression plasmid. Bath (pPheS*) and Bath (empty), a vector control, were spotted onto nitrate mineral salt (NMS) plates containing different concentrations of p-Cl-Phe (Fig. 4). In the presence of arabinose (0.5% [wt/vol]), Bath (pPheS*) did not show impaired growth on the 5 mM p-Cl-Phe plate but growth inhibition of Bath (pPheS*) was observed on NMS plates containing >10 mM p-Cl-Phe, implying that pheS* functions as a counterselectable marker in M. capsulatus (Bath). The cell growth of Bath (pPheS*) was highly repressed on the 15 mM p-Cl-Phe plate, but Bath (empty) also showed growth inhibition. In the absence of arabinose, Bath (pPheS*) showed resistance to p-Cl-Phe due to the lack of pheS* expression (Fig. S2). These results suggest that the pheS* system can work as a counterselectable marker in M. capsulatus (Bath) and 10 mM p-Cl-Phe should be used for counterselection.
FIG 4.
p-Cl-Phe sensitivity of Methylococcus capsulatus (Bath) transformants. Cell cultures of transformants harboring the empty vector, i.e., Bath (empty), and harboring pPheS*, i.e., Bath (pPheS*), were serially diluted 1:10. Each serial dilution was spotted onto agar plates containing p-Cl-Phe at different concentrations and 0.5% (wt/vol) arabinose.
Validation of the utility of the constructed pheS* as a counterselectable marker in M. capsulatus (Bath).
To validate the utility of the constructed pheS* gene, we attempted to construct an xoxF mutant, which we were unable to generate by counterselection using sacB. To prepare the suicide plasmid pJQYS2, the sacB gene on the pJQ200sk plasmid was substituted with the constructed pheS* gene, and then the flanking region of the xoxF gene was cloned into it. On this new suicide plasmid, the J23119 promoter was employed to drive constitutive expression of the pheS* gene. Plasmid integration into the target site was confirmed by PCR using Scr-F and Scr-R in the single-crossover mutant (SC-PheS*) grown on a gentamicin plate (Fig. 5A). Although 1,897-bp and 9,872-bp DNA bands were expected to appear, the shorter fragment was amplified predominantly, as when the SC-SacB mutant was examined for plasmid integration. As expected, SC-PheS* showed growth inhibition in the presence of 10 mM p-Cl-Phe (Fig. 5B). To select double-crossover mutants, a cell suspension of SC-PheS was spread on an NMS plate containing 10 mM p-Cl-Phe. Colonies grown on the p-Cl-Phe-plate were transferred to a gentamicin plate in order to examine whether double-crossover mutants were obtained. Although no gentamicin-sensitive colonies were obtained by counterselection using sacB, 19 of the 60 tested colonies showed sensitivity to gentamicin, indicating the emergence of double-crossover mutants (Table 3). Alteration of the marker drastically increased the efficiency of counterselection. Some of the gentamicin-sensitive mutants possibly reverted to the wild-type genotype (Fig. 1). Unmarked ΔxoxF mutants were selected from the gentamicin-sensitive colonies by PCR using the primers Scr-F and Scr-R2, which anneal to the outside of the flanking regions of the xoxF gene used as homologous sites. The length of the PCR amplicon from ΔxoxF mutant colonies was shorter than that from wild-type colonies (Fig. 5C). Furthermore, immunodetection using anti-XoxF and anti-MxaF antisera demonstrated the lack of xoxF expression and the presence of mxaF expression in the ΔxoxF mutant (Fig. 5D). These results indicate successful excision of the xoxF gene together with the region derived from the integrated plasmid.
FIG 5.
Counterselection using pheS* in Methylococcus capsulatus (Bath). (A) PCR confirmation of plasmid integration. PCR was performed using the primers Scr-F and Scr-R. The nucleotide sequences of these primers are shown in Table 2. From the genome sequence information for M. capsulatus (Bath), the lengths of PCR amplicons from the wild type (WT) and SC-PheS* are expected to be 3,633 bp and 1,897 bp plus 9,872 bp, respectively. The PCR amplicon from SC-PheS* indicates plasmid integration into the flanking chromosomal region of xoxF. (B) p-Cl-Phe sensitivity of SC-PheS*. Cell suspensions of the wild type and SC-PheS* were serially diluted 1:10. Each serial dilution was spotted onto an NMS agar plate containing 10 mM p-Cl-Phe. (C) PCR confirmation of xoxF disruption. PCR was performed using the primers Scr-F and Scr-R2. The nucleotide sequences of these primers are shown in Table 2. From the genome sequence information for M. capsulatus (Bath), the lengths of PCR amplicons from the wild type and the ΔxoxF mutant are expected to be 3,989 bp and 2,253 bp, respectively. (D) Immunodetection of XoxF and MxaF using specific antisera.
We confirmed the physiological modification of the ΔxoxF mutant by growth experiments. Mxa MDH and Xox MDH require calcium and a rare earth element (such as cerium), respectively, for enzymatic activity (15, 27–30). When Xox MDH is inactive, M. capsulatus (Bath) depends on Mxa MDH for methanol oxidation. Thus, the ΔxoxF mutant was assumed not to grow in the absence of calcium. After the wild type and the ΔxoxF mutant of M. capsulatus (Bath) were cultivated in the presence of calcium, the cells were transferred to NMS medium containing either 0 μM calcium and 20 μM cerium or 20 μM calcium and 20 μM cerium. As expected, the ΔxoxF mutant barely grew in the absence of calcium, whereas wild-type M. capsulatus (Bath) grew regardless of the presence or absence of calcium (Fig. 6). This calcium-dependent cell growth indicates the successful disruption of xoxF in M. capsulatus (Bath).
FIG 6.
Growth of the wild type (WT) and the ΔxoxF mutant in NMS medium containing either 0 μM calcium and 20 μM cerium or 20 μM calcium and 20 μM cerium. Closed squares represent cell growth in NMS medium containing 20 μM calcium and 20 μM cerium; open squares represent cell growth in NMS medium containing 0 μM calcium and 20 μM cerium. The experiments were conducted in triplicate. Error bars indicate standard deviations (n = 3). OD600, optical density at 600 nm.
DISCUSSION
In this study, we constructed a counterselectable pheS* marker by introducing two point mutations (A306G and T252A) into the pheS gene from M. capsulatus (Bath). Unlike other counterselectable markers, the pheS* marker has a risk of homologous recombination with the chromosomal copy of pheS, which reduces the efficiency of counterselection. To avoid this, we added silent mutations downstream of the pheS* point mutation site, following the report by Xie et al. (23) (see Fig. S1 in the supplemental material). As a result, the constructed pheS* marker enabled more efficient counterselection than did the conventional sacB marker. In addition, we clarified the inefficiency of counterselection using sacB in M. capsulatus (Bath). Although the sacB gene is the most commonly used counterselectable marker for Gram-negative bacteria, only a few reports have described application of the sacB method to produce disruptants of M. capsulatus (Bath) (13, 14). This is probably due to the inefficiency of the sacB system in M. capsulatus (Bath), as observed in this study. From the difference in appearance between wild-type and SC-SacB mutant colonies (Fig. 2C), we assumed that SacB functioned in the SC-SacB mutant, resulting in the accumulation of levan in the periplasm, but the level of levan accumulation was not sufficient to cause cell death for efficient counterselection. This implies that counterselection using sacB in M. capsulatus (Bath) would require screening of many sucrose-resistant colonies in order to obtain a double-crossover mutant. In contrast, counterselection using pheS* in M. capsulatus (Bath) enables a double-crossover mutant to be obtained from fewer p-Cl-Phe-resistant colonies. The results of this study demonstrate that pheS* is more suitable than sacB as a counterselectable marker in M. capsulatus (Bath). M. capsulatus (Bath) has been studied extensively not only in methane-based bioproduction (4–6) but also in a broad range of fields, including copper-dependent physiological processes (32–37), outer membrane proteins associated with extracellular electron transfer (32, 37, 38), and probiotics for treatment of mammalian diseases (39, 40). The establishment of an efficient counterselection system using pheS* will facilitate such studies.
The pheS* method described here can be applicable to other methanotrophs, in addition to M. capsulatus (Bath). The alignment shown in Fig. 3 displays the conservation of 2 important residues for the construction of a counterselectable marker in other methanotrophs. Pairwise sequence alignment using the EMBOSS Needle program revealed that PheS from M. capsulatus (Bath) shares a high level of sequence similarity with orthologs from other methanotrophs, especially representative type I methanotrophs whose genetic manipulation has been reported (Table 4) (5). PheS* can be used as a counterselectable marker even in nonnative host strains when PheS* shares a high level of sequence similarity with a host-derived PheS. For instance, Argov et al. employed the PheS* marker derived from Bacillus subtilis for counterselection in Listeria monocytogenes (22); pairwise sequence alignment showed 83.1% similarity (69.4% identity) between PheS from B. subtilis and that from L. monocytogenes. Due to the high levels of sequence similarity/identity, the pheS* gene constructed in this study might be available for a wide range of type I methanotrophs, including Methylomicrobium buryatense 5GB1C, Methylomonas sp. strain LW13, and Methylobacter tundripaludum 21/22.
TABLE 4.
Similarity and identity of PheS in representative methanotrophs
Methanotroph | Type | Similarity (%)a | Identity (%)a | GenBank accession no. |
---|---|---|---|---|
Methylobacter tundripaludum 21/22 | I | 83.7 | 73.9 | WP_031437875.1 |
Methylomicrobium buryatense 5G | I | 84.8 | 72.1 | WP_017840103.1 |
Methylomonas sp. LW13 | I | 82.4 | 69.5 | WP_033158015.1 |
Methylocella silvestris BL2 | II | 60.9 | 47 | ACK50391.1 |
Methylocystis sp. SC2 | II | 61.6 | 47.4 | CCJ08353.1 |
Methylosinus trichosporium OB3b | II | 65.0 | 50.1 | ATQ70420.1 |
Similarity and identity with PheS of Methylococcus capsulatus (Bath) were calculated with the Needle program.
MATERIALS AND METHODS
Bacterial strains, plasmids, and growth conditions.
The bacterial strains used in this study are listed in Table 1. M. capsulatus (Bath) and its derivative mutants were grown for 3 to 4 days at 42°C on NMS medium (41) supplemented with 1 μM CuSO4 and 20% (vol/vol) methane, with shaking. For the calcium dependency test, M. capsulatus (Bath) and its derivative mutants were cultured in a calcium-free inorganic medium composed of 5 mM NaNO3, 2 mM KH2PO4, 1 mM MgCl2, 0.1 mM Na2SO4, 20 mM HEPES, 10 μM CuCl2, and 10 ml/liter each of a trace element solution (CaCl2 was omitted) and a vitamin solution (42). Methane (20% [vol/vol]) and CaCl2 and/or CeCl2 (final concentration of 20 μM each) were supplemented after autoclaving. E. coli strains were grown at 37°C in Luria-Bertani medium, with shaking. Gentamicin (10 μg/ml) and 600 μM 2,6-diaminopimelic acid (DAP) were added to the medium when required. Arabinose was added to a final concentration of 0.5% (wt/vol) for gene expression under the control of the PBAD promoter. Transformation of M. capsulatus (Bath) with a broad-host-range plasmid, such as pJN105 or pPheS*, was performed following the method described by Ishikawa et al. (43).
Sequence analysis.
Multiple sequence alignments were made using ClustalW (http://www.clustal.org/clustal2) and Jalview (http://www.jalview.org). Pairwise sequence alignment was performed using the EMBOSS Needle program (http://www.ebi.ac.uk/Tools/psa/emboss_needle) to calculate identity and similarity values.
Plasmid construction.
The primers used in this study are listed in Table 2. The pheS* gene cassette, including a J23119 promoter, ribosome binding site (RBS), and mutated pheS (pheS*) gene, was artificially synthesized and cloned into pUC57, generating pUC57-pheS* (Genewiz, Saitama, Japan); the RBS originated from the wild-type pheS of M. capsulatus (Bath). For the construction of a pheS* expression plasmid, a pheS* gene cassette without the J23119 promoter was amplified from pUC57-pheS* by PCR using the primer set pPheS-F/pPheS-R and was cloned into the EcoRI site of pJN105 (44) with the NEBuilder HiFi DNA assembly system (New England BioLabs), generating pPheS*. For the construction of a suicide plasmid carrying pheS* as a counterselectable marker, a pheS* gene fragment amplified from pUC57-pheS* by PCR using the primer set PheS-F/PheS-R and a plasmid backbone amplified from pJQ200sk (45) by inverse PCR using the primer set iPCR-pJQF/iPCR-pJQR were ligated by the NEBuilder HiFi DNA assembly system, generating pJQY3.
Construction of a deletion mutant of xoxF in M. capsulatus (Bath).
To obtain a deletion mutant of the xoxF gene in M. capsulatus (Bath), DNA fragments including the 1-kb upstream and 1-kb downstream regions of xoxF were cloned into the BamHI sites of pJQ200sk and pJQY3, generating pJQYS1 and pJQYS2, respectively; the primer sets xoxF-upstF/xoxF-upstR and xoxF-dwstF/xoxF-dwstR and the NEBuilder HiFi DNA assembly system were used. M. capsulatus (Bath) was mated for 24 h at 37°C with E. coli WM6026 (46) harboring pJQYS1 or pJQYS2, on an NMS agar plate containing 600 μM DAP and supplied with methane vapor. The cells were collected in 500 μl NMS medium, plated on an NMS agar plate containing gentamicin (10 μg/ml), supplied with methane vapor, and incubated at 37°C until colonies were generated. Chromosomal integration of the plasmid in the resulting colonies was confirmed by PCR using the primer set Scr-F/Scr-R; thus, the single-crossover mutants SC-SacB and SC-PheS were obtained. These single-crossover mutants were plated on an NMS agar plate containing 5% sucrose or 10 mM p-Cl-Phe and were incubated at 37°C, supplied with methane vapor. The resultant colonies, which were resistant to sucrose or p-Cl-Phe, were transferred, using toothpicks, to a gentamicin-NMS agar plate to select double-crossover mutants that showed sensitivity to gentamicin.
Immunodetection.
Anti-XoxF and anti-MxaF antisera were generated against synthesized peptides corresponding to residues 398 to 411 of XoxF and residues 25 to 38 of MxaF, respectively. Whole-cell lysates of M. capsulatus (Bath) and its ΔxoxF mutant were separated on a 10% (wt/vol) acrylamide gel and transferred to a polyvinylidene fluoride membrane following general protocols. The blotted membrane was blocked for 1 h at room temperature with a 5% (wt/vol) skim milk solution and then was treated for 1 h at room temperature with the anti-XoxF or anti-MxaF antiserum at a 1:2,000 dilution in phosphate-buffered saline (PBS) containing 0.05% (vol/vol) Tween 20 (Calbiochem) (PBS-T). XoxF and MxaF on the membrane were detected with a horseradish peroxidase-conjugated anti-rabbit IgG antibody (GE Healthcare), at a 1:10,000 dilution in PBS-T, and were visualized using Chemi-Lumi One Super (Nacalai Tesque).
Supplementary Material
ACKNOWLEDGMENTS
This work was supported by the Advanced Low Carbon Technology Research and Development Program of the Japan Science and Technology Agency.
We thank Motoko Takashino and Eriko Kawamoto for technical assistance.
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.01875-18.
REFERENCES
- 1.Forster P, Ramaswamy V, Artaxo P, Berntsen T, Betts R, Fahey DW, Haywood J, Lean J, Lowe DC, Myhre G, Nganga J, Prinn R, Raga G, Schultz M, Van Dorland R. 2007. Changes in atmospheric constituents and in radiative forcing, p 129–234. In Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB, Tignor M, Miller H (ed), Climate change 2007: the physical science basis: contribution of working group I to the fourth assessment report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, United Kingdom. [Google Scholar]
- 2.Fei Q, Guarnieri MT, Tao L, Laurens LM, Dowe N, Pienkos PT. 2014. Bioconversion of natural gas to liquid fuel: opportunities and challenges. Biotechnol Adv 32:596–614. doi: 10.1016/j.biotechadv.2014.03.011. [DOI] [PubMed] [Google Scholar]
- 3.Strong PJ, Kalyuzhnaya M, Silverman J, Clarke WP. 2016. A methanotroph-based biorefinery: potential scenarios for generating multiple products from a single fermentation. Bioresour Technol 215:314–323. doi: 10.1016/j.biortech.2016.04.099. [DOI] [PubMed] [Google Scholar]
- 4.Hwang IY, Nguyen AD, Nguyen TT, Nguyen LT, Lee OK, Lee EY. 2018. Biological conversion of methane to chemicals and fuels: technical challenges and issues. Appl Microbiol Biotechnol 102:3071–3080. doi: 10.1007/s00253-018-8842-7. [DOI] [PubMed] [Google Scholar]
- 5.Lee OK, Hur DH, Nguyen DTN, Lee EY. 2016. Metabolic engineering of methanotrophs and its application to production of chemicals and biofuels from methane. Biofuel Bioprod Biorefin 10:848–863. doi: 10.1002/bbb.1678. [DOI] [Google Scholar]
- 6.Cantera S, Munoz R, Lebrero R, Lopez JC, Rodriguez Y, Garcia-Encina PA. 2018. Technologies for the bioconversion of methane into more valuable products. Curr Opin Biotechnol 50:128–135. doi: 10.1016/j.copbio.2017.12.021. [DOI] [PubMed] [Google Scholar]
- 7.Clomburg JM, Crumbley AM, Gonzalez R. 2017. Industrial biomanufacturing: the future of chemical production. Science 355:aag0804. doi: 10.1126/science.aag0804. [DOI] [PubMed] [Google Scholar]
- 8.Yan X, Chu F, Puri AW, Fu Y, Lidstrom ME. 2016. Electroporation-based genetic manipulation in type I methanotrophs. Appl Environ Microbiol 82:2062–2069. doi: 10.1128/AEM.03724-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, Lidstrom ME. 2015. Genetic tools for the industrially promising methanotroph Methylomicrobium buryatense. Appl Environ Microbiol 81:1775–1781. doi: 10.1128/AEM.03795-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Crombie A, Murrell JC. 2011. Development of a system for genetic manipulation of the facultative methanotroph Methylocella silvestris BL2. Methods Enzymol 495:119–133. doi: 10.1016/B978-0-12-386905-0.00008-5. [DOI] [PubMed] [Google Scholar]
- 11.Baani M, Liesack W. 2008. Two isozymes of particulate methane monooxygenase with different methane oxidation kinetics are found in Methylocystis sp. strain SC2. Proc Natl Acad Sci U S A 105:10203–10208. doi: 10.1073/pnas.0702643105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Sharpe PL, Dicosimo D, Bosak MD, Knoke K, Tao L, Cheng Q, Ye RW. 2007. Use of transposon promoter-probe vectors in the metabolic engineering of the obligate methanotroph Methylomonas sp. strain 16a for enhanced C40 carotenoid synthesis. Appl Environ Microbiol 73:1721–1728. doi: 10.1128/AEM.01332-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Welander PV, Summons RE. 2012. Discovery, taxonomic distribution, and phenotypic characterization of a gene required for 3-methylhopanoid production. Proc Natl Acad Sci U S A 109:12905–12910. doi: 10.1073/pnas.1208255109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Csaki R, Bodrossy L, Klem J, Murrell JC, Kovacs KL. 2003. Genes involved in the copper-dependent regulation of soluble methane monooxygenase of Methylococcus capsulatus (Bath): cloning, sequencing and mutational analysis. Microbiology 149:1785–1795. doi: 10.1099/mic.0.26061-0. [DOI] [PubMed] [Google Scholar]
- 15.Farhan Ul Haque M, Gu W, DiSpirito AA, Semrau JD. 2015. Marker exchange mutagenesis of mxaF, encoding the large subunit of the Mxa methanol dehydrogenase, in Methylosinus trichosporium OB3b. Appl Environ Microbiol 82:1549–1555. doi: 10.1128/AEM.03615-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nguyen AD, Hwang IY, Lee OK, Kim D, Kalyuzhnaya MG, Mariyana R, Hadiyati S, Kim MS, Lee EY. 2018. Systematic metabolic engineering of Methylomicrobium alcaliphilum 20Z for 2,3-butanediol production from methane. Metab Eng 47:323–333. doi: 10.1016/j.ymben.2018.04.010. [DOI] [PubMed] [Google Scholar]
- 17.Reyrat JM, Pelicic V, Gicquel B, Rappuoli R. 1998. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis. Infect Immun 66:4011–4017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Barrett AR, Kang Y, Inamasu KS, Son MS, Vukovich JM, Hoang TT. 2008. Genetic tools for allelic replacement in Burkholderia species. Appl Environ Microbiol 74:4498–4508. doi: 10.1128/AEM.00531-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Metzgar D, Bacher JM, Pezo V, Reader J, Doring V, Schimmel P, Marliere P, de Crecy-Lagard V. 2004. Acinetobacter sp. ADP1: an ideal model organism for genetic analysis and genome engineering. Nucleic Acids Res 32:5780–5790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kast P. 1994. pKSS: a second-generation general purpose cloning vector for efficient positive selection of recombinant clones. Gene 138:109–114. doi: 10.1016/0378-1119(94)90790-0. [DOI] [PubMed] [Google Scholar]
- 21.Miyazaki K. 2015. Molecular engineering of a PheS counterselection marker for improved operating efficiency in Escherichia coli. Biotechniques 58:86–88. doi: 10.2144/000114257. [DOI] [PubMed] [Google Scholar]
- 22.Argov T, Rabinovich L, Sigal N, Herskovits AA. 2017. An effective counterselection system for Listeria monocytogenes and its use to characterize the monocin genomic region of strain 10403S. Appl Environ Microbiol 83:e02927-16. doi: 10.1128/AEM.02927-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Xie Z, Okinaga T, Qi F, Zhang Z, Merritt J. 2011. Cloning-independent and counterselectable markerless mutagenesis system in Streptococcus mutans. Appl Environ Microbiol 77:8025–8033. doi: 10.1128/AEM.06362-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kino Y, Nakayama-Imaohji H, Fujita M, Tada A, Yoneda S, Murakami K, Hashimoto M, Hayashi T, Okazaki K, Kuwahara T. 2016. Counterselection employing mutated pheS for markerless genetic deletion in Bacteroides species. Anaerobe 42:81–88. doi: 10.1016/j.anaerobe.2016.09.004. [DOI] [PubMed] [Google Scholar]
- 25.Zhou C, Shi L, Ye B, Feng H, Zhang J, Zhang R, Yan X. 2017. pheS*, an effective host-genotype-independent counter-selectable marker for marker-free chromosome deletion in Bacillus amyloliquefaciens. Appl Microbiol Biotechnol 101:217–227. doi: 10.1007/s00253-016-7906-9. [DOI] [PubMed] [Google Scholar]
- 26.Ward N, Larsen O, Sakwa J, Bruseth L, Khouri H, Durkin AS, Dimitrov G, Jiang LX, Scanlan D, Kang KH, Lewis M, Nelson KE, Methe B, Wu M, Heidelberg JF, Paulsen IT, Fouts D, Ravel J, Tettelin H, Ren QH, Read T, DeBoy RT, Seshadri R, Salzberg SL, Jensen HB, Birkeland NK, Nelson WC, Dodson RJ, Grindhaug SH, Holt I, Eidhammer I, Jonasen I, Vanaken S, Utterback T, Feldblyum TV, Fraser CM, Lillehaug JR, Eisen JA. 2004. Genomic insights into methanotrophy: the complete genome sequence of Methylococcus capsulatus (Bath). PLoS Biol 2:1616–1628. doi: 10.1371/journal.pbio.0020303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pol A, Barends TR, Dietl A, Khadem AF, Eygensteyn J, Jetten MS, Op den Camp HJ. 2014. Rare earth metals are essential for methanotrophic life in volcanic mudpots. Environ Microbiol 16:255–264. doi: 10.1111/1462-2920.12249. [DOI] [PubMed] [Google Scholar]
- 28.Keltjens JT, Pol A, Reimann J, Op den Camp HJ. 2014. PQQ-dependent methanol dehydrogenases: rare-earth elements make a difference. Appl Microbiol Biotechnol 98:6163–6183. doi: 10.1007/s00253-014-5766-8. [DOI] [PubMed] [Google Scholar]
- 29.Nakagawa T, Mitsui R, Tani A, Sasa K, Tashiro S, Iwama T, Hayakawa T, Kawai K. 2012. A catalytic role of XoxF1 as La3+-dependent methanol dehydrogenase in Methylobacterium extorquens strain AM1. PLoS One 7:e50480. doi: 10.1371/journal.pone.0050480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Hibi Y, Asai K, Arafuka H, Hamajima M, Iwama T, Kawai K. 2011. Molecular structure of La3+-induced methanol dehydrogenase-like protein in Methylobacterium radiotolerans. J Biosci Bioeng 111:547–549. doi: 10.1016/j.jbiosc.2010.12.017. [DOI] [PubMed] [Google Scholar]
- 31.Culpepper MA, Rosenzweig AC. 2014. Structure and protein-protein interactions of methanol dehydrogenase from Methylococcus capsulatus (Bath). Biochemistry 53:6211–6219. doi: 10.1021/bi500850j. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Larsen O, Karlsen OA. 2016. Transcriptomic profiling of Methylococcus capsulatus (Bath) during growth with two different methane monooxygenases. Microbiologyopen 5:254–267. doi: 10.1002/mbo3.324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kao WC, Chen YR, Yi EC, Lee H, Tian Q, Wu KM, Tsai SF, Yu SS, Chen YJ, Aebersold R, Chan SI. 2004. Quantitative proteomic analysis of metabolic regulation by copper ions in Methylococcus capsulatus (Bath). J Biol Chem 279:51554–51560. doi: 10.1074/jbc.M408013200. [DOI] [PubMed] [Google Scholar]
- 34.Nielsen AK, Gerdes K, Murrell JC. 1997. Copper-dependent reciprocal transcriptional regulation of methane monooxygenase genes in Methylococcus capsulatus and Methylosinus trichosporium. Mol Microbiol 25:399–409. doi: 10.1046/j.1365-2958.1997.4801846.x. [DOI] [PubMed] [Google Scholar]
- 35.Ve T, Mathisen K, Helland R, Karlsen OA, Fjellbirkeland A, Rohr AK, Andersson KK, Pedersen RB, Lillehaug JR, Jensen HB. 2012. The Methylococcus capsulatus (Bath) secreted protein, MopE*, binds both reduced and oxidized copper. PLoS One 7:e43146. doi: 10.1371/journal.pone.0043146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Karlsen OA, Larsen O, Jensen HB. 2011. The copper responding surfaceome of Methylococcus capsulatus Bath. FEMS Microbiol Lett 323:97–104. doi: 10.1111/j.1574-6968.2011.02365.x. [DOI] [PubMed] [Google Scholar]
- 37.Karlsen OA, Kindingstad L, Angelskar SM, Bruseth LJ, Straume D, Puntervoll P, Fjellbirkeland A, Lillehaug JR, Jensen HB. 2005. Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath): a member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins. FEBS J 272:6324–6335. doi: 10.1111/j.1742-4658.2005.05020.x. [DOI] [PubMed] [Google Scholar]
- 38.Karlsen OA, Lillehaug JR, Jensen HB. 2008. The presence of multiple c-type cytochromes at the surface of the methanotrophic bacterium Methylococcus capsulatus (Bath) is regulated by copper. Mol Microbiol 70:15–26. doi: 10.1111/j.1365-2958.2008.06380.x. [DOI] [PubMed] [Google Scholar]
- 39.Kleiveland CR, Hult LT, Spetalen S, Kaldhusdal M, Christofferesen TE, Bengtsson O, Romarheim OH, Jacobsen M, Lea T. 2013. The noncommensal bacterium Methylococcus capsulatus (Bath) ameliorates dextran sulfate (sodium salt)-induced ulcerative colitis by influencing mechanisms essential for maintenance of the colonic barrier function. Appl Environ Microbiol 79:48–56. doi: 10.1128/AEM.02464-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Indrelid S, Kleiveland C, Holst R, Jacobsen M, Lea T. 2017. The soil bacterium Methylococcus capsulatus Bath interacts with human dendritic cells to modulate immune function. Front Microbiol 8:320. doi: 10.3389/fmicb.2017.00320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Whittenbury R, Phillips KC, Wilkinson JF. 1970. Enrichment, isolation and some properties of methane-utilizing bacteria. J Gen Microbiol 61:205–218. doi: 10.1099/00221287-61-2-205. [DOI] [PubMed] [Google Scholar]
- 42.Kato S, Goya E, Tanaka M, Kitagawa W, Kikuchi Y, Asano K, Kamagata Y. 2016. Enrichment and isolation of Flavobacterium strains with tolerance to high concentrations of cesium ion. Sci Rep 6:20041. doi: 10.1038/srep20041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ishikawa M, Tanaka Y, Suzuki R, Kimura K, Tanaka K, Kamiya K, Ito H, Kato S, Kamachi T, Hori K, Nakanishi S. 2017. Real-time monitoring of intracellular redox changes in Methylococcus capsulatus (Bath) for efficient bioconversion of methane to methanol. Bioresour Technol 241:1157–1161. doi: 10.1016/j.biortech.2017.05.107. [DOI] [PubMed] [Google Scholar]
- 44.Newman JR, Fuqua C. 1999. Broad-host-range expression vectors that carry the l-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227:197–203. doi: 10.1016/S0378-1119(98)00601-5. [DOI] [PubMed] [Google Scholar]
- 45.Quandt J, Hynes MF. 1993. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 127:15–21. doi: 10.1016/0378-1119(93)90611-6. [DOI] [PubMed] [Google Scholar]
- 46.Blodgett JA, Thomas PM, Li G, Velasquez JE, van der Donk WA, Kelleher NL, Metcalf WW. 2007. Unusual transformations in the biosynthesis of the antibiotic phosphinothricin tripeptide. Nat Chem Biol 3:480–485. doi: 10.1038/nchembio.2007.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.