Single Nucleotide Polymorphism Genotyping Analysis Shows That Vaccination Can Limit the Number and Diversity of Recombinant Progeny of Infectious Laryngotracheitis Viruses from the United States

Recombination allows alphaherpesviruses to evolve over time and become more virulent. Historically, characterization of viral vaccines in poultry have mainly focused on limiting clinical disease, rather than limiting virus replication, but such approaches can allow field viruses to persist and evolve in vaccinated populations. In this study, we vaccinated chickens with Gallid alphaherpesvirus 1 vaccines that are commercially available in the United States and then performed coinoculations with two field strains of virus to measure the ability of the vaccines to prevent field strains from replicating and recombining. We found that vaccination reduced viral replication, recombination, and diversity compared to those in unvaccinated chickens, although the extent to which this occurred differed between vaccines. We suggest that characterization of vaccines could include studies to examine the ability of vaccines to reduce viral recombination in order to limit the rise of new virulent field strains due to recombination, especially for those vaccines that are known not to prevent viral replication following challenge.

ABSTRACT

Infectious laryngotracheitis (ILTV; Gallid alphaherpesvirus 1) causes mild to severe respiratory disease in poultry worldwide. Recombination in this virus under natural (field) conditions was first described in 2012 and more recently has been studied under laboratory conditions. Previous studies have revealed that natural recombination is widespread in ILTV and have also demonstrated that recombination between two attenuated ILTV vaccine strains generated highly virulent viruses that produced widespread disease within poultry flocks in Australia. In the United States, natural ILTV recombination has also been detected, but not as frequently as in Australia. To better understand recombination in ILTV strains originating from the United States, we developed a TaqMan single nucleotide polymorphism (SNP) genotyping assay to detect recombination between two virulent U.S. field strains of ILTV (63140 and 1874c5) under experimental in vivo conditions. We also tested the capacity of the Innovax-ILT vaccine (a recombinant vaccine using herpesvirus of turkeys as a vector) and the Trachivax vaccine (a conventionally attenuated chicken embryo origin vaccine) to reduce recombination. The Trachivax vaccine prevented ILTV replication, and therefore recombination, in the trachea after challenge. The Innovax-ILT vaccine allowed the challenge viruses to replicate and to recombine, but at a significantly lower rate than in an unvaccinated group of birds. Our results demonstrate that the TaqMan SNP genotyping assay is a useful tool to study recombination between these ILTV strains and also show that vaccination can limit the number and diversity of recombinant progeny viruses.

IMPORTANCE Recombination allows alphaherpesviruses to evolve over time and become more virulent. Historically, characterization of viral vaccines in poultry have mainly focused on limiting clinical disease, rather than limiting virus replication, but such approaches can allow field viruses to persist and evolve in vaccinated populations. In this study, we vaccinated chickens with Gallid alphaherpesvirus 1 vaccines that are commercially available in the United States and then performed coinoculations with two field strains of virus to measure the ability of the vaccines to prevent field strains from replicating and recombining. We found that vaccination reduced viral replication, recombination, and diversity compared to those in unvaccinated chickens, although the extent to which this occurred differed between vaccines. We suggest that characterization of vaccines could include studies to examine the ability of vaccines to reduce viral recombination in order to limit the rise of new virulent field strains due to recombination, especially for those vaccines that are known not to prevent viral replication following challenge.

INTRODUCTION

Infectious laryngotracheitis virus (ILTV; Gallid alphaherpesvirus 1) causes mild to severe respiratory tract disease in chickens that results in major economic losses in poultry industries throughout the world as a consequence of increased mortality, decreased weight gain, and decreased egg production (1). Live attenuated vaccines are widely used to help control disease caused by infection with ILTV in Asia (2–4), Australia (5–9), Europe (10) and the United States (11–14). These vaccines are generally effective in controlling clinical disease, and although some of these vaccines may not entirely prevent ILTV replication, as measured by viral tires after challenge (15), they have been used successfully to curtail outbreaks of the disease in the United States (1). However, genome analysis of U.S. isolates suggests that vaccine-derived virulent subpopulations allowed to persist in the field will give rise to vaccine revertants which can cause outbreaks of the disease; examples are genotype groups III (81658) and V (63140) (1). Attenuated vaccines also have other limitations (16), including the capacity to undergo recombination to generate new highly virulent viruses (9). This was first observed in Australian poultry when natural recombination between two attenuated vaccine strains of ILTV generated virulent, recombinant field viruses that spread to cause outbreaks of severe disease in commercial poultry flocks (9). Recombination has now been widely detected among ILTV field strains worldwide (5, 8, 9, 17).

Viruses can acquire genetic changes through several mechanisms, including point mutation and recombination, with the latter particularly important in many alphaherpesviruses (18–21). Viruses that belong to the order Herpesvirales have double-stranded linear DNA genomes and have complex viral DNA replication machinery, comprising a DNA polymerase with a highly efficient proofreading capacity, resulting in very low spontaneous mutation rates (22–24). Therefore, recombination is considered crucial for the evolution of some species of alphaherpesviruses (9, 25, 26). Specifically, intraspecific recombination has been extensively studied for a number of different alphaherpesviruses under in vitro conditions, including Human alphaherpesvirus 1 (27), Bovine alphaherpesvirus (28), Human alphaherpesvirus 3 (29), Felid alphaherpesvirus 1 (30), and Suid alphaherpesvirus 1 (31). Next-generation sequencing and analysis of the resultant sequences are powerful approaches to detecting and characterizing alphaherpesvirus recombination events and also allow recombination breakpoints to be identified. However, other approaches to detecting recombination in alphaherpesviruses, such as the use of single nucleotide polymorphism (SNP) genotyping assays, may be more appropriate for use in recombination experiments, particularly as a screening tool. Such assays can be more efficient and cost-effective than next-generation sequencing methods and more suitable for testing large numbers of viruses (28, 32).

Recombination between strains of ILTV has been recognized as a problem for poultry in Australia and has been detected in both natural (field) settings (5, 8, 9, 17) and laboratory settings (17, 32). Natural ILTV recombination has also been detected in United States, although fewer recombination events were detected in U.S. field strains than in Australian field strains (17). Recently, using full-genome sequence analysis of ILTV field strains from the United States, a natural recombination event was detected (1874c5 and J2 strains as parental strains) (17). In the study described here, we aimed to examine the potential for recombination in vivo under experimental conditions between two prevalent virulent field strains from the United States. Specifically, we developed a TaqMan SNP genotyping assay to detect ILTV recombinants arising after coinoculation with the two parental virulent field strains and then examined the recombinants that arose in unvaccinated and vaccinated birds in order to determine whether vaccination could be used as a tool to limit recombination in ILTV.

RESULTS

Growth and entry kinetics.

Growth and entry kinetics experiments were performed to determine in vitro characteristics of the 63140 and 1874c5 parental strains in LMH cells. These experiments were also performed to determine the suitability of LMH cells for the isolation and detection of viral progeny from the swabs collected from infected chickens. Significant differences were detected between the entry kinetics of the 63140 and 1874c5 viruses at 2.5, 7.5, and 30 min after inoculation (Fig. 1A). The multistep growth curves of the viruses were also significantly different at every time point postinfection (Fig. 1B). Statistics for each time point, for both entry and growth kinetics, are in Tables S3 and S4 in the supplemental material.

FIG 1.

Growth and entry kinetics of the 63140 and 1874c5 ILTV parental viruses. (A) Entry kinetics of the 63140 and 1874c5 strains. LMH cells were infected with virus, after which they were overlaid with methylcellulose medium and incubated at 37°C. Entry at different time points was calculated by comparing the number of plaques formed after inoculation at a specific time point to the number formed after an inoculation period of 60 min. This experiment was repeated 3 times, each in triplicate. Mean results are shown. Error bars represent SDs. (B) Growth kinetics of the 63140 and 1874c5 strains. LMH cells were inoculated in triplicate at a multiplicity of infection (MOI) of 0.002. At 24-h intervals, the virus genome concentration in the cell-free supernatant was determined by qPCR. Error bars indicate SDs, and asterisks indicate values that were significantly different (P < 0.05, Student's t test).

Bird survival, virus genome quantification, and virus isolation.

The survival rates in groups of birds that were mock vaccinated and then inoculated only with either 63140 or 1874c5 were 50% (5/10) in both groups (Fig. 2). The mock-vaccinated, coinoculated group had survival rates of 45.8% and 33.3% (11/24 and 8/24) at days 7 and 9, respectively (Fig. 2). All birds in the vaccinated groups survived throughout the experiment (Fig. 2). Although most mortalities occurred in the directly challenged birds, two mortalities were recorded for in-contact, unvaccinated birds, one in the mock-vaccinated group coinoculated with both parental viruses and one in the second in the mock-vaccinated group challenged with 1874c5.

FIG 2.

Survival rates in the different experimental groups, as described in Table 4. Mortalities were observed only in the mock-vaccinated groups that were challenged with 63140 or 1874c5, either alone or in combination (coinoculated). All other groups had a 100% survival rate from day 3 to day 9. The results from the group vaccinated with HVT and then coinfected with 63140 and 1874c5 is shown as an example of a 100% survival curve. The results from the other groups with 100% survival are not shown. Mock-Vx/Co-inoculation-Ch, mock-vaccinated, coinoculated group; HVT-Vx/Co-inoculation-Ch, HVT-vaccinated, coinoculated group.

In the groups of birds that were coinoculated with both viruses, higher concentrations of virus were detected by quantitative PCR (qPCR) in the tracheal swabs collected from birds in the mock-vaccinated group than in the swabs from birds in the groups vaccinated with the CEO and HVT vaccines at days 3, 5, and 7 after challenge (Fig. 3A, B, and C, respectively). No significant differences were detected between these groups at day 9 (Fig. 3D). In these groups, peak virus concentrations were detected earlier in the directly inoculated birds (day 3) than in the in-contact birds (day 5) (Fig. 3). At days 3, 5, and 7 after challenge, no significant differences in viral concentrations were detected between the mock-vaccinated coinoculated group and the groups that were mock vaccinated and then challenged with either 63140 or 1874c5 (Fig. 3A, B, and C, respectively). Significantly lower viral concentrations were detected at day 9 between the mock-vaccinated coinoculated group and the mock-vaccinated groups that were challenged with only 63140 or 1874c5 (Fig. 3D).

FIG 3.

Replication of ILTV in different groups of birds after challenge based on genome copy numbers in tracheal swabs as measured by qPCR on tracheal swabs. (A) Day 3 after challenge; (B) day 5 after challenge; (C) day 7 after challenge; (D) day 9 after challenge. Asterisks represent significant differences (P < 0.05, student t test) compared to the mock-vaccinated, coinoculated group.

The results from virus isolation were consistent with those obtained by qPCR analysis. Viruses could be isolated and plaque purified from the mock-vaccinated coinoculated group (individual birds A to R) and all in-contact birds (individual birds S to X). Viruses could be isolated and plaque purified from only 3 out of 18 directly coinoculated birds in the group vaccinated with herpesvirus of turkey (HVT) (individual birds Y, Z, and A.1) and could not be isolated from any of the in-contact chickens. Virus could not be isolated from swabs collected from birds in the groups vaccinated with chicken embryo origin vaccine (CEO). Thus, all subsequent investigations to characterize progeny viruses and examine viral diversity were restricted to the mock-vaccinated coinoculated and HVT-vaccinated coinoculated groups.

Characterization of progeny viruses using the SNP genotyping assay.

Up to 20 progeny viruses were isolated and plaque purified from each tracheal swab sample, yielding a total of 707 plaque-purified progeny viruses along the experiment from which DNA was extracted for characterization. Six SNPs across the length of each of the genomes of the progeny viruses were identified as originating from either the 63140 or 1874c5 genome using the SNP genotyping assay interface within the Stratagene Mx3000P qPCR software system, as previously described (Fig. 1). The genotyping assay identified 78 plaque-purified viruses as potentially mixtures, so these were discarded from further investigation. The remaining 629 plaque-purified viruses were identified as either recombinant or parental viruses. Recombinant viruses were detected in mock-vaccinated (see Fig. S1 in the supplemental material) and HVT-vaccinated (see Fig. S2) groups. In total, across all birds (directly inoculated and in-contact birds) the proportion of progeny viruses that were recombinants was significantly higher among viruses from the mock-vaccinated coinoculated group (36% [207/576]) (Tables 1 and 2) than among viruses from the HVT-vaccinated coinoculated group (20% [11/53]) (Table 3) (P < 0.034, Fisher's exact test). There was no significant difference between the proportion of progeny viruses that were recombinants in the directly coinoculated birds in the mock-vaccinated group (43% [128/428]) (Tables 1 and 2) and among the viruses from HVT-vaccinated group (20% [11/53]) (Table 3) (P = 0.199, Fisher's exact test). In the mock-vaccinated coinoculated group, 38 (59%) of the 64 possible genotype patterns were detected among the viral progeny (Tables 1 and 2). In the HVT-vaccinated coinoculated group, 8 (12.5%) of the 64 possible genotype patterns were detected among the viral progeny (Table 3). Some genotype patterns were detected more frequently than others at days 3, 5, and 7. Genotype pattern codes 6, 17, 18, and 26 were detected in the mock-vaccinated coinoculated group on all days (Tables 1 and 2), whereas in the HVT-vaccinated coinoculated group, viruses were detected only at day 3. At this time the most abundant recombinant genotype was genotype pattern code 3 (5.7% of total progeny viruses), but the 63140 parental strain dominated (79.2% of total progeny viruses). The 1874c5 parent strain was not detected in this group (Table 3).

TABLE 1.

Viruses detected in the mock-vaccinated, cochallenged group, including directly inoculated birds and in-contact birds^a

Collection time point	Genotype pattern code	Chicken(s) from which virus was isolated (no. of isolates)	Total no. of isolates (%)
Day 3	1	A (1), C (1), H (1), K (1), L (2), N (3)	9 (3.6)
	2	A (1), C (1), D (2), G (3), I (1), L (2), N (1)	11 (4.5)
	3	B (1), C (1), F (3), G (1), H (1), M (1), O (1)	9 (3.6)
	4	B (1), C (1)	2 (0.8)
	5	B (1)	1 (0.4)
	6	C (2), F (1), J (1)	4 (1.6)
	7	C (1)	1 (0.4)
	8	C (1)	1 (0.4)
	9	C (1)	1 (0.4)
	10	C (1), O (1)	2 (0.8)
	11	D (1)	1 (0.4)
	12	E (1), L (1)	2 (0.8)
	13	E (1), G (2), N (1)	4 (1.6)
	14	F (1), J (1), L (1), N (1)	4 (1.6)
	15	G (1)	1 (0.4)
	16	G (1)	1 (0.4)
	17	G (1), O (1)	2 (0.8)
	18	G (1), J (1)	2 (0.8)
	19	G (1), O (3)	4 (1.6)
	20	I (1), O (1)	2 (0.8)
	21	J (1), L (1)	2 (0.8)
	22	K (2)	2 (0.8)
	23	K (1)	1 (0.4)
	24	N (1)	1 (0.4)
	25	N (1)	1 (0.4)
	26	N (1), O (1)	2 (0.8)
	27	O (1)	1 (0.4)
	63140	A (15), B (8), C (6), D (14), E (13), F (7), G (5), H (15), I (16), J (9), K (14), L (11), M (14), N (6), O (3)	156 (63)
	1874c5	B (5), D (1), F (1), J (1), N (2), O (7)	17 (6.9)
Day 5	2	A (1), C (3), K (3), R (1)	8 (2.9)
	3	C (2), G (6), H (1), R (2), S (2), T (8)	21 (7.6)
	4	S (1)	1 (0.4)
	5	T (1)	1 (0.4)
	6	C (1), P (1), H (1), K (1), U (1)	5 (1.8)
	7	P (1), V (1)	2 (0.7)
	9	A (1), P (1), H (3)	5 (1.8)
	13	A (1), G (3), S (2)	6 (2.2)
	17	K (1)	1 (0.4)
	18	R (1), S (1)	2 (0.7)
	19	P (2), H (1), U (1), W (2)	6 (2.2)
	20	H (1), W (1)	2 (0.7)
	24	W (1)	1 (0.4)
	26	H (2), K (1)	3 (1.1)
	27	W (6)	6 (2.2)
	28	P (1)	1 (0.4)
	29	P (1)	1 (0.4)
	30	P (1), H (1)	2 (0.7)
	31	P (1), H (1)	2 (0.7)
	32	H (2)	2 (0.7)
	33	K (2)	2 (0.7)
	34	R (1)	1 (0.4)
	35	R (1)	1 (0.4)
	36	S (1)	1 (0.4)
	37	W (2)	2 (0.7)
	38	W (1)	1 (0.4)
	63140	A (15), C (14), D (17), P (7), G (10), H (7), Q (20), K (10), R (13), M (5), S (7), T (10), U (18), V (19), W (2)	174 (63)
	1874c5	P (4), K (2), R (1), M (2), S (2), T (1), W (5)	17 (6.1)
Day 7	6	T (1), X (14)	15 (29)
	17	V (5)	5 (9.6)
	18	T (11)	11 (21)
	26	T (1)	1 (1.9)
	36	V (15)	15 (29)
	63140	T (2), X (2)	4 (7.7)
	1874c5	T (1)	1 (1.9)

^aDirectly inoculated birds included individual birds A to R, and in-contact birds included individual birds S to X. Virus isolation from in-contact birds is bold and underlined.

TABLE 2.

Summary of collection days and total number and type of isolates in the mock-vaccinated, cochallenged group, including directly inoculated birds and in-contact birds

Collection time point and type of isolate	No. of isolates (%)a
	Whole group	Directly inoculated	In-contact
Day 3
Parental	173 (70)	173 (70)	0 (0)
Recombinant	74 (70)	74 (70)	0 (0)
Total	247 (100)	247 (100)	0 (0)
Day 5
Parental	191 (69)	127 (70)	64 (67)
Recombinant	86 (31)	54 (30)	32 (33)
Total	277 (100)	181 (65.3)	96 (35)
Day 7
Parental	5 (9.6)	0 (0)	5 (9.6)
Recombinant	47 (90.3)	0 (0)	47 (0.3)
Total	52 (100)	0 (0)	52 (100)

^aDirectly inoculated birds included individual birds A to R, and in-contact birds included individual birds S to X.

TABLE 3.

Viruses detected in the HVT-vaccinated, coinoculated group from directly inoculated birds (individual birds Y, Z, and A.1) on day 3^a

Genotype pattern code	Chicken (no. of isolates)	Total no. of isolates (% of whole group)
2	A.1 (1)	1 (1.9)
3	Z (1), A.1 (2)	3 (5.7)
12	A.1	1 (1.9)
26	A.1	1 (1.9)
36	Z (1), A.1 (1)	2 (3.8)
37	Z (1)	1 (1.9)
39	Z (1)	1 (1.9)
40	A.1	1 (1.9)
63140	Y (18), Z (14), A.1 (10)	42 (79.2)
1874c5	None	0 (0)

^aFor the parental viruses, 42 (79%) isolates were detected in the whole group and 42 (79%) were directly inoculated. For the recombinant viruses, 11 (21%) were detected in the whole group and 11 (21%) were directly inoculated. The total number of isolates was 53. Viruses could not be isolated from in-contact birds.

Viral-diversity analysis.

In the mock-vaccinated coinoculated group, there were no significant differences in the level of viral diversity, as assessed by the Renyi diversity profiles, between days 3, 5, and 7 (Fig. 4A). Separate analysis of the directly inoculated birds and in-contact birds in this group revealed a higher level of diversity at day 3 than at day 5 in the directly inoculated birds (Fig. 4B) but not in the in-contact birds (Fig. 4C). Overall, the level of viral diversity was higher in the mock-vaccinated coinoculated group than in the HVT-vaccinated coinoculated group (Fig. 4D).

FIG 4.

Detailed Renyi diversity profiles for progeny viruses isolated from the mock-vaccinated, coinoculated group and the HVT-vaccinated, coinoculated group. Levels of diversity are shown on the y axis and diversity measures on the x axis. Renyi profiles contain 11 diversity measurements, including richness (x axis value = 0), Hill values (x axis values = 0.25, 0.5, 4, 8, 16, 32, 64), Shannon-Weaver (x axis value = 1), 1/Simpson (x axis value = 2), and 1/Berger Parker (x axis value = infinite [INF]). One community can be regarded as more diverse than another if all its Renyi diversity measurements are higher (48). (A) Diversity of viral progeny in all birds (directly inoculated birds and in-contact birds) in the mock-vaccinated, coinoculated group; (B) separate analysis of the directly inoculated birds in the mock-vaccinated, coinoculated group; (C) separate analysis of the in-contact birds in the mock-vaccinated, coinoculated group; (D) diversity of viral progeny in all birds (directly inoculated birds and in-contact birds) in the HVT-vaccinated, coinoculated birds and in the mock-vaccinated, coinoculated birds.

DISCUSSION

We developed a specific SNP genotyping assay to study recombination between virulent U.S. ILTV field strains 63140 and 1874c5. These field strains share 97.6% sequence identity. Six of the 93 SNPs detected between these strains were selected as suitable for design of primers and fluorogenic (TaqMan) probes to differentiate viral recombinants within the viral progeny. Four of these SNPs were located in the unique long (UL) region (in the UL54, ORFE, UL36, and UL6 genes) and two within the unique short (US) region (in ORF1 and US9). Previous studies have shown that natural recombination occurs throughout the ILTV genome, including within the UL, internal repeat (IR), and US regions (5, 8). Recombination hot spots have been detected within the ICP4 gene in the IR region (17); however, none of the SNPs between the two parental viruses, 1874c5 and 63140, within the ICP4 gene were suitable for design of primers and probes. Therefore, recombination events in this region of the genome were not directly assessed in the present study.

Recombination events have been detected frequently in Australian ILTV field stains but have been less frequently detected in U.S. field strains (5, 17). The field strain 1874c5, used as one of the parent strains in the study described here, was recently recognized as a likely natural recombinant (17), so this parental strain was of particular interest in this study.

The in vitro characteristics of the 63140 and 1874c5 parental viruses were assessed in LMH cells in order to compare their rates of replication and entry kinetics. Synchronized entry and growth kinetics are important factors facilitating recombination in alphaherpesviruses (26). Results from this study suggest that differences in entry and growth kinetics may affect the generation of recombinants in vivo, as a lower proportion of progeny were found to be recombinants (∼29%) in unvaccinated, directly coinoculated birds. Previous in vivo coinoculation experiments with unvaccinated directly coinoculated chickens with Australian ILTV field strains, with very similar entry and growth kinetics, showed that a high proportion of the viral progeny were recombinants (∼65%). However, it must also be considered that the entry and growth kinetics viruses were examined in vitro using LMH cell culture, entry, and growth kinetics may differ when the viruses are grown in vivo, which could impact recombination.

Previous studies have shown that the levels of recombinant diversity after coinoculation of ILTV strains are highest at the peak of viral replication (17). In the present study, the highest level of viral diversity was detected in unvaccinated, directly coinoculated birds at day 3. Over the whole group (directly coinoculated birds and in-contact birds), a higher level of viral diversity was detected at day 5, coinciding with time point at which the highest tracheal concentrations of viruses were detected within the directly coinoculated birds and in-contact birds.

As the highest levels of viral diversity, the highest prevalence of recombinant progeny, and the peak levels of viral replication coincided in directly coinoculated birds in the mock-vaccinated group, it can be hypothesized that a reduced level of viral replication, mediated by vaccination, would affect not only the severity of clinical disease (15) but also the level of recombination and viral diversity. In the United States, clinical disease caused by ILTV is mainly controlled by vaccination with either conventional attenuated or recombinant virally vectored vaccines (1). In this study, we tested the attenuated CEO vaccine Trachivax and the recombinant HVT-LT Innovax. The CEO vaccine protected challenged birds, as measured by survival rates (Fig. 2), and prevented virus replication, as detected by qPCR (Fig. 3). There was insufficient viral replication in this group of birds to enable virus isolation and purification. These results were not unexpected, as this vaccine is known to induce good protection against disease and to prevent challenge virus replication and transmission (33, 34).

We also tested the HVT-vectored vaccine Innovax-ILT, which expresses two ILTV genes, those for US6 (glycoprotein D) and US7 (glycoprotein I) (35). The HVT vaccine protected birds against challenge, as measured by survival rates, and partially protected birds against viral replication following challenge, as determined by qPCR and virus isolation. The qPCR results from this study are consistent with previous studies showing that after challenge, viral replication in the tracheas of HVT-vaccinated birds is higher than in CEO-vaccinated chickens but lower than in unvaccinated birds (36). Virus isolation, purification, and characterization were possible for 3 of 18 directly inoculated birds. Of the viral progeny, 21% were recombinants, but none of the recombinants dominated as much as the parental strain 63140.

Our results show that both vaccines tested in this study could be used as tools to help control ILTV recombination but that any variation in the dose or delivery method that reduces vaccine efficacy, e.g., delivery by drinking water or in ovo (37), may increase the diversity of the progeny and the potential of generating recombinant viruses after coinoculation. In this study, it is notable that despite the detection of viral replication, the low level of recombinant progeny detected in the recombinant HVT-vaccinated and -coinoculated group of birds may be a reflection of the administration of double full dose (approximately 12,000 PFU) which emphasizes that at least a full dose of recombinant vaccines is necessary to reduce the potential of generating recombinant viruses after coinoculation. In order to achieve optimal control of ILTV under field conditions, it is important that other advantages and disadvantages of vaccines be considered in addition to their potential impact on ILTV recombination. It is possible that ILTV recombination occurs less frequently in the United States than in Australia, where recombination has given rise to new virulent ILTV strains that have caused severe disease (9). However, it should be noted that the level of recombination observed between the 63140 and 1874c5 field strains was still substantial and that other U.S. field strains may yield higher levels of recombination. Further studies to examine ILTV recombination in strains from different geographical regions are indicated, along with further studies to investigate the ability of different vaccines to control recombination.

MATERIALS AND METHODS

Viruses.

The virulent 1874c5 and 63140 field strains of ILTV were used as the parental viruses for in vivo coinoculation. These strains belong to genotypes VI and V, following the ILTV classification system used in the United States (38), and were first isolated from broiler flocks (11). Both parental viruses were propagated at the Poultry Diagnostic and Research Center (PDRC), University of Georgia, GA. For this study, the parental viruses were propagated and titrated in chicken hepatocellular carcinoma (LMH) cells (39) using a plaque assay, as previously described (40). The vaccines used in the present study were the herpesvirus of turkey (HVT)-vectored vaccine Innovax-ILT (Merck Animal Health, Madison, NJ) and the chicken embryo origin (CEO) vaccine Trachivax (Merck Animal Health, Madison, NJ).

Cell culture and in vitro characterization of viruses.

Virus isolation and purification from clinical material collected during the in vivo experiment, as well as in vitro characterization of the parental strains, were performed in LMH cell monolayers. The cells were cultured in growth medium (GM) consisting of Dulbecco's minimal essential medium (DMEM; Gibco-Thermo Fisher) supplemented with antibiotic-antimycotic (100×; Gibco-Thermo Fisher), as recommended by the manufacturer, and 10% (vol/vol) fetal bovine serum (FBS; Sigma-Aldrich). Virus titrations were performed using the plaque assay described previously (41). In vitro multistep virus growth kinetics and entry kinetics studies were performed as described by Devlin et al. (41) and Lee et al. (42), respectively.

In vivo coinoculation experiment.

This experiment was undertaken with approval from the Animal Ethics Committee (AEC) of the University of Georgia (A2016 10-010-Y1-A0). Two hundred specific-pathogen-free (SPF) eggs were obtained from Valo BioMedia North America Inc. (Adel, IA) and incubated in a small-scale hatcher (Natureform, Inc., Jacksonville, FL) at the PDRC facilities. After hatch chickens were provided with water and feed ad libitum. At 1 day of age, 33 chicks were vaccinated subcutaneously in the neck with HVT-LT Innovax at a dose of approximately 120,000 PFU per bird (twice the full dose) administered in 100 μl. At 2 weeks of age a total of 33 chickens were vaccinated with the Trachivax CEO vaccine at dose of approximately 3.67 50% tissue culture infective doses (TCID₅₀) per bird (one dose, as described on the vaccine label) administered in 33 μl via eye drop. Also, at 2 weeks of age 40 chickens were mock vaccinated via eye drop with vaccine diluent.

At 5 weeks of age, three groups of 18 chickens each, vaccinated with either CEO Trachivax or HVT-LT Innovax or mock vaccinated, were housed in separate isolators and challenged by coinoculation with 300 μl of a 1:1 mixture of the 1874c5 and 63140 strains of ILTV containing 10³ PFU of each strain by the intratracheal route. Immediately after the coinoculation challenge, six naive (unvaccinated and uninoculated) chickens of the same age (5 weeks) were introduced into each group as in-contact animals. Nine additional groups of five to eight chickens each that had been previously vaccinated with either CEO Trachivax or HVT-LT Innovax or mock vaccinated were housed in separate isolators and challenged at 5 weeks of age with 10³ PFU of either 63140 or 1874c5 or mock challenged with GM. Three naive chickens were added to each group as in-contact birds immediately after inoculation. In total, 148 chicks were used in this study. The different experimental groups are summarized in Table 4.

TABLE 4.

Experimental groups

Group namea	No. of chickens inoculated in the group	No. of in-contact birds added at the time of challenge
Mock-Vx/Mock-Ch	8	0
Mock-Vx/63140-Ch	7	3
Mock-Vx/1874c5-Ch	7	3
Mock-Vx/coinoculation-Ch*	18	6
CEO-Vx†/Mock-Ch	5	3
CEO-Vx†/63140-Ch	5	3
CEO-Vx†/1874c5-Ch	5	3
CEO-Vx†/coinoculation-Ch*	18	6
HVT-Vx§/Mock-Ch	5	3
HVT-Vx§/63140-Ch	5	3
HVT-Vx§/1874c5-Ch	5	3
HVT-Vx§/coinoculation-Ch*	18	6

^aVx, vaccinated; Ch, challenged; †, CEO vaccine (Trachivax; Merck Animal Health, Madison, NJ) delivered by eye drop at 2 weeks of age; §, HVT vaccine (Innovax-ILT; Merck Animal Health, Madison, NJ) delivered intradermally at 1 day of age; *, coinoculation (strains 63140 and 1874c5; all challenge inocula were delivered intratracheally at 5 weeks of age).

The birds were monitored for 9 days. At 3, 5, 7, and 9 days after challenge, tracheal swabs were collected using standard techniques, placed into 1 ml of viral transport medium (DMEM, 3% [vol/vol] FBS, and 100 μg of ampicillin/ml), transported on ice, and then stored at −80°C until they were processed for virus isolation and purification. Prior to storage at −80°C, 200-μl aliquots of tracheal swab suspension were collected and stored separately at −20°C for DNA extraction using the MegaZorb DNA Mini-Prep kit (Promega) following the manufacturer's instructions. DNA extracts were used as the template for measurement of the ILTV genome concentration using a TaqMan qPCR that amplified a 103-bp product from glycoprotein C, as described previously (43).

Virus isolation and purification.

Progeny viruses were isolated and purified as previously described (32). Material from each tracheal swab was serially diluted (10-fold) in GM in order to identify the appropriate dilution for plaque purification. Dilutions were used to inoculate LMH cell monolayers in 6-well plates. After 1 h of incubation at 37°C, the cell monolayer was covered with semisolid (2% [wt/vol]) methylcellulose overlay medium containing 10% (vol/vol) FBS and incubated at 37°C in a humidified atmosphere of 5% (vol/vol) CO₂ in air. After incubation for 24 to 48 h, up to 20 plaques were picked from each sample from the chickens coinoculated with 1874c5 and 63140 ILTV, and up to 10 were picked from samples collected from birds that received only one challenge virus (either 1874c5 or 63140) for each of the time points at which samples were collected (day 3, 5, 7, and 9 after challenge). Plaques were picked with a micropipette and then each plaque was propagated individually by the inoculation of LMH cell monolayers in 12-well plates. Three rounds of plaque purification were performed, with one freeze-thaw cycle between each round. A final virus amplification step was then performed in 1 well of a 12-well plate per isolate to increase the amount of each ILTV isolate for downstream analysis.

SNP genotyping assay.

To detect recombination, a TaqMan SNP genotyping assay was developed that targeted six unique SNPs distributed along the two ILTV genomes. The SNPs were separated by a maximum of 30 kbp and a minimum of 2 kbp and were selected following alignment of the whole-genome sequences of 63140 and 1874c5 (GenBank accession numbers JN542536 and JN542533, respectively) using the Mauve algorithm in Genious 8.0 (44) (Fig. 5A). All targeted SNPs were transition changes resulting in either nonsynonymous or synonymous changes (Table 5). Each of the six SNPs identified in the full-genome sequences of the parental strains was reconfirmed by PCR (primers are listed in Table S1 in the supplemental material) and amplicon sequencing (BigDye Terminator v3.1; Life Technologies). Samples were processed by the Georgia Genomics and Bioinformatics Core, University of Georgia, followed by sequence analysis using Geneious version 8.0 (44). After the presence of each SNP was confirmed, the target sequences for each SNP were analyzed using RealTimeDesign (Biosearch Technologies; https://www.biosearchtech.com/realtimedesign) (see Table S2) to design appropriate primers and TaqMan probes. The dye 6-carboxyfluorescein (FAM) was used for all the 63140 SNP probes, and 560 CAL Fluor orange (CAL) was used for all 1874c5 SNP probes (Table 6). In silico evaluation of the probes and primers was performed using the oligonucleotide evaluator feature within RealTimeDesign (https://www.biosearchtech.com/ProbeITy/design/OligoEvaluator.aspx). For the TaqMan PCR assays, DNAs extracted from plaque-purified laboratory stocks of 63140 and 1874c5 were used as control samples. These extracted DNAs were also used to create control samples that contained a mixture of both virus genomes at ratios of 10:1, 1:1, and 1:10. The genome concentrations were determined using a qPCR targeting the UL15 gene described elsewhere (43). These pure and mixture controls were then used as the templates in control reactions, along with negative (no template)-control reaction mixtures that included distilled water rather than template DNA. Each PCR mixture contained 2 μl of DNA template, a 500 nM concentration of each of the specific primers, and a 500 nM concentration of the specific probe (Table 6), in addition to 8 μl of the TaqMan GTXpress master mix (Applied Biosystems). Reaction mixtures were incubated in an Mx3000 real-time thermocycler (Stratagene) through 1 cycle of 95°C for 2 min and 40 cycles of 30 s at 95°C and 60°C for 1 min. The fluorescence from FAM (63140 SNPs) and CAL Fluor orange 560 (1874c5 SNPs) generated during the PCR amplification was read and the measurements plotted using Stratagene Mx3000P QPCR 4.1v. The results were used to confirm the presence of DNA derived from the genome of either 63140 or 1874c5 ILTV at each SNP locus (Fig. 5B). Following validation of the assay using the control samples, the assay was then applied to DNA extracted from plaque-purified viruses recovered from the in vivo study in order to detect and discriminate between parent and recombinant viruses. Any samples that yielded a result that could not be definitively identified as either ILTV genome at any of the SNP loci (i.e., potentially contained a mixed population of viruses) were excluded from further analysis.

FIG 5.

Single nucleotide polymorphism (SNP) genotyping assay. (A) Schematic representation of the distribution of the TaqMan probes along the unique long (UL), unique short (US), and internal and terminal repeat (IR and TR) regions of the genomes of ILTV strains 63140 (gray) and 1874c5 (black). The SNPs targeted are indicated with arrows and were located in the UL54, ORFE, UL36, UL6, ORF1, ORF1 and US9 genes. (B) Scatter plot of results from SNP genotyping assays when applied to 3 10-fold dilutions of positive-control samples, starting from 1 × 10⁵ genome copies per reaction of pure 63140 DNA or 1874c5 DNA negative-control samples (no-template and DNA negative extraction controls) and mixed control samples (63140 and 1874c5 ILTV DNA in ratios of 10:1, 1:1, and 1:10). SNP genotyping assay results were analyzed using Stratagene Mx3000P QPCR 4.1v software. Orange 560 dye was used for the detection of SNPs originating from strain 1874c5 (x axis), and FAM was used for the detection of SNPs originating from strain 63140 (y axis).

TABLE 5.

Single nucleotide polymorphisms (SNPs) selected within the genomes of strains 63140 and 1874c5 for recombination detection assays

Target gene	Target length sequenced (bp)	Codon and amino acid for straina:		Transitionb
		63140	1874c5
UL54	98	CAC, Val	CAT, Val	S
ORFE	102	GTT, Gln	GCT, Arg	NS
UL36	105	TGC, Thr	TGT, Thr	S
UL6	175	CGG, Ala	TGG, Thr	NS
ORF1	90	TTA, Leu	CTA, Leu	S
US9	67	ACA, Thr	ATA, Ile	NS

^aModified nucleotide shown in bold.

^bS, synonymous; NS, nonsynonymous.

TABLE 6.

Oligonucleotide probes and primers used to detect SNPs within the genomes of ILTV strains 63140 and 1874c5

Target gene	SNP position in 63140	SNP position in 1874c5	Distinguishing nucleotide		Fluorogenic probe (5′-BHQ1plus-3′)a	Primer (5′–3′)b
			63140	1874c5
UL54	11750	11865	C	T	FAM-AAGACCGCACGCTCA	F: CACGGCCTCTCATAAACTTATTTCG
					CAL-TATGGAAGACCGTACGCT	R: CGAGCCTCGTTCCCGTTAC
ORFE	30097	30209	T	C	FAM-AATATCGCCGCTTGTAGTAG	F: GGCAAGTAATTATCGGCGAAGCTAT
					CAL-CGCCGCTCGTAGTAG	R: GAGACAGCCCGCATCACTC
UL36	55879	55994	C	T	FAM-CTGGCAACGACACGTA	F: CCCGGAACCAGAAGATCGAAG
					CAL-CCTGGCAACAACACGT	R: GCGGTGTCATGTTTATCTCTGTG
UL6	102923	103038	C	T	FAM-CATCATAGGCGCGGATT	F: CAGTTACCAATGGTTCCCAAACAAC
					CAL-CCATCATAGGTGCGGATT	R: GCCAGAGGGTTCGAAATGCT
ORF1	130696	129283	T	C	FAM-TGAGAAATCTTAAGGACCCC	F: ACTCCGTCTGCAATAATTTCCCTT
					CAL-ATGAGAAATCTTAGGGACCCC	R: CGTTAAAGCTATTTCCAGCGACAG
US9	139387	137974	C	T	FAM-CCACACACCCATGC	F: CGCTCTACCGTTTCCAGTCAAC
					CAL-CCCACATACCCATGC	R: GCACGCGCCCATACTCAG

^aDistinguishing nucleotides are in bold. The BHQ1plus quencher (Biosearch Technologies) was attached to the 5′ end.

^bF, forward; R, reverse.

Examination of viral diversity.

To characterize the viral progeny and identify recombinants, DNA from each plaque-purified virus was extracted and used as the template in the TaqMan SNP genotyping assay. To measure diversity, we first defined each recombinant using a unique genotype pattern code. These genotype pattern codes were then analyzed in RStudio 0.99.902 using VeganR (45) and BiodiversityR (46). VeganR calculates the diversity indices used to perform ecological diversity measurements in communities (47). BiodiversityR was used to generate Renyi profiles. This package provides a graphical user interface via R-Commander incorporating functions used by VeganR to analyze measures of diversity, including richness (x axis value = 0), Hill values (x axis values = 0.25, 0.5, 4, 8, 16, 32, and 64), Shannon-Weaver (x axis value = 1), 1/Simpson (x axis value = 2), and 1/Berger Parker (x axis value = infinite) (46).