Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2018 Nov 15;84(23):e02134-18. doi: 10.1128/AEM.02134-18

Divergent Nrf Family Proteins and MtrCAB Homologs Facilitate Extracellular Electron Transfer in Aeromonas hydrophila

Bridget E Conley a,b, Peter J Intile a,b, Daniel R Bond a,b, Jeffrey A Gralnick a,b,
Editor: Karyn N Johnsonc
PMCID: PMC6238070  PMID: 30266730

Metal-reducing microorganisms are used for electricity production, bioremediation of toxic compounds, wastewater treatment, and production of valuable compounds. Despite numerous microorganisms being reported to reduce metals, the molecular mechanism has primarily been studied in two model systems, Shewanella oneidensis and Geobacter sulfurreducens. We have characterized the mechanism of extracellular electron transfer in Aeromonas hydrophila, which uses the well-studied Shewanella system, MtrCAB, to move electrons across the outer membrane; however, most Aeromonas spp. appear to use a novel mechanism to transfer electrons from the inner membrane through the periplasm and to the outer membrane. The conserved use of MtrCAB in Shewanella spp. and Aeromonas spp. for metal reduction and conserved genomic architecture of metal reduction genes in Aeromonas spp. may serve as genomic markers for identifying metal-reducing microorganisms from genomic or transcriptomic sequencing. Understanding the variety of pathways used to reduce metals can allow for optimization and more efficient design of microorganisms used for practical applications.

KEYWORDS: Mtr, Nrf, extracellular electron transfer, metal reduction

ABSTRACT

Extracellular electron transfer (EET) is a strategy for respiration in which electrons generated from metabolism are moved outside the cell to a terminal electron acceptor, such as iron or manganese oxide. EET has primarily been studied in two model systems, Shewanella oneidensis and Geobacter sulfurreducens. Metal reduction has also been reported in numerous microorganisms, including Aeromonas spp., which are ubiquitous Gammaproteobacteria found in aquatic ecosystems, with some species capable of pathogenesis in humans and fish. Genomic comparisons of Aeromonas spp. revealed a potential outer membrane conduit homologous to S. oneidensis MtrCAB. While the ability to respire metals and mineral oxides is not widespread in the genus Aeromonas, 90% of the sequenced Aeromonas hydrophila isolates contain MtrCAB homologs. A. hydrophila ATCC 7966 mutants lacking mtrA are unable to reduce metals. Expression of A. hydrophila mtrCAB in an S. oneidensis mutant lacking homologous components restored metal reduction. Although the outer membrane conduits for metal reduction were similar, homologs of the S. oneidensis inner membrane and periplasmic EET components CymA, FccA, and CctA were not found in A. hydrophila. We characterized a cluster of genes predicted to encode components related to a formate-dependent nitrite reductase (NrfBCD), here named NetBCD (for Nrf-like electron transfer), and a predicted diheme periplasmic cytochrome, PdsA (periplasmic diheme shuttle). We present genetic evidence that proteins encoded by this cluster facilitate electron transfer from the cytoplasmic membrane across the periplasm to the MtrCAB conduit and function independently from an authentic NrfABCD system. A. hydrophila mutants lacking pdsA and netBCD were unable to reduce metals, while heterologous expression of these genes could restore metal reduction in an S. oneidensis mutant background. EET may therefore allow A. hydrophila and other species of Aeromonas to persist and thrive in iron- or manganese-rich oxygen-limited environments.

IMPORTANCE Metal-reducing microorganisms are used for electricity production, bioremediation of toxic compounds, wastewater treatment, and production of valuable compounds. Despite numerous microorganisms being reported to reduce metals, the molecular mechanism has primarily been studied in two model systems, Shewanella oneidensis and Geobacter sulfurreducens. We have characterized the mechanism of extracellular electron transfer in Aeromonas hydrophila, which uses the well-studied Shewanella system, MtrCAB, to move electrons across the outer membrane; however, most Aeromonas spp. appear to use a novel mechanism to transfer electrons from the inner membrane through the periplasm and to the outer membrane. The conserved use of MtrCAB in Shewanella spp. and Aeromonas spp. for metal reduction and conserved genomic architecture of metal reduction genes in Aeromonas spp. may serve as genomic markers for identifying metal-reducing microorganisms from genomic or transcriptomic sequencing. Understanding the variety of pathways used to reduce metals can allow for optimization and more efficient design of microorganisms used for practical applications.

INTRODUCTION

Dissimilatory metal-reducing bacteria (DMRB) respire oxidized metals such as Fe(III) and Mn(IV) that are insoluble at circumneutral conditions and are therefore unable to diffuse across the outer membrane (1). Electron transfer to these metal oxides requires specialized respiratory pathways that facilitate electron flow from inside the cell across the cell envelope to the insoluble terminal electron acceptor, a process termed extracellular electron transfer (EET). DMRB are capable of reducing a wide variety of extracellular electron acceptors such as iron, manganese, uranium, vanadium, cobalt, technetium, chromium, selenium, and arsenic (2). There are two model DMRB in which the mechanism for EET has been studied in detail, the deltaproteobacterium Geobacter sulfurreducens and the gammaproteobacterium Shewanella oneidensis (reviewed in references 17). In both Shewanella spp. and Geobacter spp., multiheme c-type cytochromes play a predominant role in facilitating EET across the cell envelope.

Shewanella uses a conserved pathway for EET that consists of six primary components, mostly comprised of cytochromes. Electrons are transferred to the periplasm by an inner membrane NapC/NirT family quinole dehydrogenase tetraheme cytochrome, CymA (8, 9). Electrons are delivered from CymA across the periplasm by two parallel pathways involving CctA (also known as the small tetraheme cytochrome [STC]), or FccA, a flavocytochrome c also required for fumarate respiration (1012). From the periplasm, electrons enter the outer membrane conduit, MtrCAB. MtrA is a periplasmic decaheme c-type cytochrome that receives electrons from periplasmic electron carriers, CctA or FccA, and is anchored to the outer membrane by a tight association with the integral outer membrane protein MtrB (11, 13, 14). MtrB appears to bring MtrA in close proximity to the terminal reductase, MtrC, an extracellular lipoprotein decaheme c-type cytochrome (1315). S. oneidensis is also able to secrete and use soluble shuttles in the extracellular environment, primarily flavin species, to move electrons to a variety of insoluble electron acceptors (16, 17). In addition to shuttling, flavin molecules interact with MtrC, where they may act as cofactors and increase the rate of electron transfer (18, 19).

Cytochromes are also required for EET in G. sulfurreducens, but with different pathways depending on the extracellular electron acceptor. Cytoplasmic membrane multiheme cytochromes, ImcH or CbcL, oxidize menaquinone depending on the redox potential of the acceptor (2022). Electrons are likely carried across the periplasm by the triheme cytochromes PpcA through PpcE to a variety of outer-membrane-anchored cytochrome–β-barrel–cytochrome complexes (2325). The extracellular electron acceptor is reduced by different cytochrome conduits depending on the electron acceptor being reduced (26, 27).

There are nearly 100 reports of phylogenetically diverse DMRB, but the mechanism of EET in the vast majority of these microorganisms remains to be characterized (28). Although there are parallels in the mechanisms of EET in S. oneidensis and G. sulfurreducens, there are also significant differences. In order to understand how representative the Shewanella and Geobacter strategies are for EET, the mechanisms in other DMRB must be characterized.

Aeromonas spp. have been reported to perform EET, reducing a wide range of extracellular electron acceptors, including Fe(III) oxide minerals and electrodes (2933). Aeromonas spp. are Gammaproteobacteria that are ubiquitous in aquatic systems and found in sediment, water column, and intestinal tracts and gills of fish (34). Aeromonas spp. are facultative anaerobic chemoorganotrophs that are generally capable of reducing fumarate, nitrate, nitrite, sulfite, arsenate, selenate, and trimethylamine N-oxide (TMAO) (31, 3540). Generally, Aeromonas spp., particularly A. hydrophila, Aeromonas caviae, and Aeromonas veronii, have been studied for their ability to cause disease in various hosts such as fish, frogs, domestic animals, and humans (41, 42).

The mechanism for metal reduction in Aeromonas spp. was hypothesized to be similar to that of S. oneidensis, based on genome sequence analysis (43, 44). Of the 137 Aeromonas spp. with at least draft-quality sequenced genomes, 39% are predicted to encode MtrCAB homologs, using a cutoff of 30% amino acid similarity. However, attempts to predict other components of the EET pathway were unsuccessful, as no homologs predicted to encode CymA, CbcL, ImcH, or the periplasmic carriers PpcA, CctA, and FccA could be identified in the genomes of Aeromonas spp. The absence of these homologs suggested that Aeromonas spp. may use a different protein(s) to transfer electrons from the quinone pool to the MtrCAB complex. In this study, we show in A. hydrophila that electrons from respiration travel from the inner membrane to the periplasm via an NrfBCD-like electron transfer system, which we have named NetBCD, to a predicted periplasmic diheme shuttle, PdsA, and across the outer membrane via MtrCAB.

RESULTS

Identification of outer membrane components of the metal reduction pathway in A. hydrophila.

Multiple Aeromonas spp. have been reported to reduce extracellular electron acceptors, although the mechanism has not yet been investigated (2931, 45). We identified mtrCAB gene clusters in 39% of the sequenced Aeromonas genomes and 90% of sequenced A. hydrophila strains with a genetic arrangement similar to that of S. oneidensis (Table S1). Unlike many Shewanella species, which contain mtrCAB genes, these Aeromonas genomes did not contain additional paralogs of mtrCAB, such as mtrDEF or omcA. The MtrCAB proteins encoded by the A. hydrophila ATCC 7966 genome are 36%, 45%, and 67% similar to S. oneidensis MtrCAB, respectively. The Phyre2-predicted structure of A. hydrophila MtrC shows homology with 100% confidence to S. oneidensis MtrC, MtrF, OmcA, and UndA, conserving the staggered cross arrangement of the heme binding sites (Fig. S1) (18, 4649).

To determine if the A. hydrophila MtrCAB homologs have a function similar to that of S. oneidensis MtrCAB, mtrA was deleted, and strains were examined for the ability to reduce Fe(III) and Mn(IV). Deletion of mtrA in A. hydrophila resulted in a significant decrease in the amounts of soluble Fe(III) citrate, Fe(III) oxide, and Mn(IV) oxide reduced (Fig. 1). When complemented in trans with mtrA under the expression of the vector lac promoter, reduction of Mn(IV) oxide was restored to wild-type levels (Fig. 1C), while reduction of Fe(III) citrate and Fe(III) oxide was partially restored (Fig. 1A and B).

FIG 1.

FIG 1

A. hydrophila mtrA is essential for metal reduction (A) Reduction of Fe(III) citrate over time. (B) Reduction of Fe(III) oxide over time. (C) Reduction of Mn(IV) oxide over time. Wild type with empty pBBR1MCS-2 (●), ΔmtrA with empty pBBR1MCS-2 (▲), ΔmtrA with pAhmtrA (■). Each data point is representative of three independent experiments performed in triplicate, displaying mean ± SEM.

We examined if A. hydrophila MtrCAB could restore metal reduction in a mutant strain of S. oneidensis, JG1453, with the following deletions of multiheme cytochromes: ΔmtrABC, ΔmtrDEF, ΔomcA, ΔdmsE, ΔSO4360, and ΔcctA (50). A. hydrophila mtrCAB was expressed using the native lac promoter of pBBR1MCS-2 in S. oneidensis strain JG1453, and reduction of Fe(III) citrate, Fe(III) oxide, and Mn(IV) oxide was quantified. A. hydrophila MtrCAB restored reduction of Fe(III) citrate and Mn(IV) oxide to wild-type levels in S. oneidensis JG1453 (Fig. 2A and Fig. 2C). Reduction of Fe(III) oxide was restored to wild-type levels, although the rate of reduction was slightly slower (Fig. 2B). We were unable to complement mtrA mutants in either S. oneidensis or A. hydrophila with the mtrA gene from the opposite organism (Fig. S2).

FIG 2.

FIG 2

A. hydrophila mtrCAB can restore metal reduction in S. oneidensis mutants lacking outer membrane multiheme cytochrome complexes (ΔmtrABC ΔmtrDEF ΔomcA ΔdmsE ΔSO4360 ΔcctA), complemented with A. hydrophila mtrCAB. (A) Reduction of Fe(III) citrate over time. (B) Reduction of Fe(III) oxide over time. (C) Reduction of Mn(IV) oxide over time. Wild type with empty pBBR1MCS-2 (●), JG1453 with empty pBBR1MCS-2 (▲), JG1453 with pAhmtrCAB (■). Each data point is representative of three independent experiments performed in triplicate, displaying mean ± SEM.

Identification of inner membrane and periplasmic components of the metal reduction pathway in A. hydrophila.

Considering the known role of multiheme c-type cytochromes for metal reduction in S. oneidensis and G. sulfurreducens, we searched the A. hydrophila genome for additional genes predicted to encode multiple CXXCH heme binding motifs. We identified 12 multiheme c-type cytochromes in addition to MtrA and MtrC. Predicted cytochromes identified included a peroxidase (AHA_3403), a cytochrome with 56% identity to S. oneidensis CytcB (AHA_0269), a predicted periplasmic diheme class I c-type cytochrome c553 (AHA_2763), and two cytochromes with unknown functions (AHA_2545 and AHA_2948). The remaining cytochromes are predicted to be involved in respiration of TMAO (torC, AHA_4048), nitrate (napBC, AHA_1589 and AHA_1590), oxygen (ccoP, AHA_2298), and nitrite (nrfAB, AHA_2464 and AHA_2465).

An additional copy of nrfB (AHA_2762) was located upstream and divergently transcribed from mtrCAB (Fig. 3). In E. coli, the Nrf system is responsible for nitrite reduction, with NrfBCD residing at the inner membrane and periplasm to transfer electrons from menaquinone to NrfA, the terminal nitrite reductase located in the periplasm (51). NrfEFG are specialized cytochrome maturation factors required for NrfA function (52). A complete nrfABCDEFG gene cluster (AHA_2464 to AHA_2470) is present in another location on the genome, while the gene cluster near mtrCAB contains only nrfBCD, lacking a nrfA paralog and the nrfEFG maturation genes.

FIG 3.

FIG 3

Key genes and proteins involved in metal reduction in Aeromonas hydrophila ATCC 7966. (A) Blue genes, netBCD, encode proteins involved in menaquinone oxidation and transferring electrons from the quinone pool to the periplasm. The green gene, pdsA, encodes a protein involved in carrying electrons across the periplasm from the inner membrane to the outer membrane. Red genes, mtrCAB, encode proteins involved in transferring electrons across the outer membrane, oxidizing the periplasmic carrier and reducing the terminal electron acceptor. (B) PsdA and NetBCD with annotated domains and motifs color coded as follows: secretion signals, Sec in light green and TAT in light pink; heme binding sites in orange; 4Fe-4S binding sites in pink; and transmembrane domains in lavender. Areas of homology to known proteins are also annotated in black boxes. The green protein is predicted to be soluble in the periplasm, and blue proteins are predicted to be located at and in the inner membrane.

Based on the phenotypes we describe below, we propose to rename the gene cluster upstream of mtrCAB netBCD, for Nrf-like electron transfer (AHA_2760 to AHA_2762) (Fig. 3A). The atypical nrfBCD gene cluster located upstream of mtrCAB also encodes a putative 22.5-kDa periplasmic diheme c-type cytochrome we propose to rename PdsA, for periplasmic diheme shuttle (AHA_2763) (Fig. 3A). PdsA is predicted to be a class I c-type cytochrome c553 (Fig. 3B), with low sequence identity (10 to 35%) to other monoheme or diheme cytochromes c553, which are generally electron carriers utilized in a wide variety of metabolisms (5356).

Further analysis of sequenced Aeromonas genomes revealed that all strains with mtrCAB also contain pdsA and netBCD in the same genomic architecture, except for Aeromonas diversa strain CECT 4254 and Aeromonas schubertii strains WL1483 and ATCC 43700. A. diversa and A. schubertii strains are predicted to encode diheme c-type cytochromes that are 71% and 75% similar, respectively, to A. hydrophila ATCC PdsA; however, instead of the netBCD gene product, a predicted NapC/NirT family protein is encoded immediately downstream of pdsA. In A. hydrophila, NetB is 76% similar to NrfB, with the N-terminal region being most divergent, while NetCD and NrfCD have a high degree of similarity (90%) (Fig. 3B). Based on homology to NrfBCD, we hypothesize that NetCD oxidizes the menaquinone pool at the inner membrane and reduces NetB in the periplasm.

Deletion of pdsA and netBCD in A. hydrophila resulted in a significant decrease in the amount of Fe(III) citrate reduced compared to the wild type (Fig. 4A). Fe(III) citrate reduction in the ΔpdsA ΔnetBCD strain was restored to wild-type levels by expressing pdsA and netBCD in trans under the control of a lac promoter (Fig. 4A). Reduction of Fe(III) oxide and Mn(IV) oxide by pdsA and netBCD mutants and complemented strains demonstrated the same trend as Fe(III) citrate reduction (Fig. S3). Deletion of pdsA and netBCD in A. hydrophila did not alter the growth rate with nitrite as the terminal electron acceptor (Fig. S4).

FIG 4.

FIG 4

pdsA and netBCD are essential for Fe(III) citrate reduction in A. hydrophila and can complement S. oneidensis mutants. (A) Reduction of Fe(III) citrate by A. hydrophila strains over time. Wild type with empty pBBR1MCS-2 (●), ΔpdsA ΔnetBCD with empty pBBR1MCS-2 (▲), ΔpdsA ΔnetBCD with ppdsA/netBCD (■), ΔpdsA ΔnetBCD with pnetBCD (▼). (B) Reduction of Fe(III) citrate by S. oneidensis strains over time. Wild type (●), ΔcymA ΔcctA ΔfccA with empty pBBR1MCS-2 (▲), ΔcymA ΔcctA ΔfccA with ppdsA/netBCD (■), ΔcymA ΔcctA ΔfccA with pnetBCD (▼). Each data point is representative of two independent experiments performed in triplicate, displaying mean ± SEM.

To further examine the functions of PdsA and NetBCD in metal reduction, we heterologously expressed pdsA and netBCD in pBBR1MCS-2 under the control of the vector lac promoter in a strain of S. oneidensis missing the inner membrane (CymA) and periplasmic cytochromes (CctA and FccA) required for EET. Expression of pdsA-netBCD in the S. oneidensis ΔcymA ΔcctA ΔfccA mutant restored Fe(III) citrate reduction to wild-type levels (Fig. 4B). In S. oneidensis, CymA is also essential for nitrate, nitrite, dimethyl sulfoxide (DMSO), and fumarate reduction (57, 58). Expression of pdsA and netBCD in an S. oneidensis ΔcymA strain partially complemented growth in DMSO, fumarate, and nitrate but with lower final cell yield and longer lag time (Fig. 5A to C); however, reduction of nitrite was not restored in these strains (Fig. 5D). A negative-control strain carrying only the empty vector control was unable to restore growth in fumarate, DMSO, nitrate, and nitrite (Fig. 5).

FIG 5.

FIG 5

pdsA and netBCD can complement fumarate, DMSO, and nitrate but not nitrite reduction in S. oneidensis. Growth over time of S. oneidensis strains that respire (A) fumarate, (B) DMSO, and (C) nitrate. (D) Nitrite production and consumption over time during the growth of S. oneidensis strains that respire nitrate. Wild type with empty pBBR1MCS-2 (●), ΔcymA with empty pBBR1MCS-2 (▲), ΔcymA with ppdsA/netBCD (■), ΔcymA with pnetBCD (▼), and ΔcymA with pcymA (◆). Each data point is representative of two independent experiments performed in triplicate, displaying mean ± SEM.

In S. oneidensis, periplasmic tetraheme cytochromes FccA and CctA carry electrons across the periplasm from CymA to MtrA (1012). A. hydrophila also requires a strategy to move electrons across the periplasm. Due to the genomic context and predicted cellular localization, we hypothesized that PdsA is the periplasmic electron carrier for EET in A. hydrophila. We examined a series of mutants complemented with and without pdsA for the ability to restore Fe(III) citrate reduction in both A. hydrophila and S. oneidensis. A. hydrophila ΔpdsA ΔnetBCD complemented only with netBCD is unable to reduce Fe(III) citrate (Fig. 4A). Expression of netBCD alone in an S. oneidensis ΔcymA ΔcctA ΔfccA mutant strain was also unable to restore Fe(III) citrate reduction (Fig. 4B). Fe(III) citrate reduction was rescued in both cases when pdsA and netBCD were expressed together on a plasmid. Growth on fumarate, DMSO, and nitrate in S. oneidensis ΔcymA was complemented by expressing netBCD with or without pdsA under the same promoter (Fig. 5A and B). It should be noted that the native periplasmic electron carriers (FccA and CctA) were present in this genetic background. The addition of pdsA resulted in an increased rate of nitrite production when grown on nitrate compared to that of strains not expressing pdsA (Fig. 5D). These phenotypes are consistent with our hypothesis that the diheme c-type cytochrome PdsA traffics electrons between NetBCD and MtrCAB.

A phylogenetic analysis was performed to better understand how NrfBCD and NetBCD are related. NetB and NrfB were selected because of greater differences in amino acid similarity compared to those of NrfCD and NetCD. A. diversa and A. schubertii were excluded from analysis because they do not encode a NetB homolog. NetB and NrfB from Aeromonas spp. clustered separately from each other (Fig. 6). NrfB from other Gammaproteobacteria, representatives of the orders Vibrionales, Pasteurellales, and Enterobacteriales, clustered separately from NrfB and NetB of Aeromonas spp.

FIG 6.

FIG 6

Molecular phylogenetic analysis of NrfB and NetB. NrfB from selected representative strains of Vibrionales, Pasteurellales, and Enterobacteriales are shown in yellow, red and green, respectively. NrfB from selected Aeromonas spp. are shown in blue and NetB from selected Aeromonas spp. are shown in purple. Amino acid sequences were aligned with ClustalW, and evolutionary relationships were inferred using the maximum likelihood method with 1,000 bootstrap replicates, based on the JTT matrix-based model. The tree is drawn to scale, with the scale bar representing substitutions per site.

DISCUSSION

Metal-reducing bacteria have been isolated from a wide range of environments and are phylogenetically diverse, yet our understanding of EET mechanisms in microorganisms beyond Shewanella and Geobacter is limited. Here, we present a working model of EET in A. hydrophila that is consistent with our findings (Fig. 7). NetCD oxidizes the menaquinone pool and reduces the periplasmic cytochrome NetB. PdsA receives electrons from NetB, which can move across the periplasm to reduce MtrA. MtrC oxidizes MtrA and reduces an extracellular electron acceptor while in a conduit complex with MtrB.

FIG 7.

FIG 7

Model for the mechanism of extracellular electron transfer in A. hydrophila. NetBCD, a NrfBCD-like complex, oxidizes the menaquinone pool and transfers electrons to PdsA, a predicted periplasmic diheme. Electrons are then transferred across the periplasm to MtrABC, which moves electrons across the outer membrane to the extracellular acceptor.

Multiple Aeromonas spp. have been reported to reduce extracellular electron acceptors (2933, 45). Initial examinations of Aeromonas genomes revealed homologs to Shewanella mtrCAB-like gene clusters, which were targeted for mutagenesis in A. hydrophila. Deletion of the mtrA homolog in A. hydrophila resulted in significant decreases in the reduction of Fe (III) citrate, Fe(III) oxide, and Mn(IV) oxide, which could be restored with complementation (Fig. 1). Reduction of Fe(III) oxide was only partially restored in A. hydrophila ΔmtrA expressing mtrA on a plasmid, possibly due to differences in expression or production of MtrA versus the natively encoded MtrC or MtrB. Because MtrCAB proteins form a complex together, differences in expression or production levels could result in the observed partial complementation. Additionally, Fe(III) oxide is reduced slower than the higher potential Mn(IV) oxide and Fe(III) citrate, which may allow the observation of partial complementation. Reduction of Fe(III) citrate, Fe(III) oxide, and Mn(IV) oxide could be restored by A. hydrophila mtrCAB expression in an S. oneidensis mutant missing all homologs of this conduit system (Fig. 2). Shewanella spp. reduce soluble shuttles via the Mtr pathway to help facilitate extracellular electron transfer. We are currently exploring the possible role of soluble shuttles in Aeromonas EET. Gene deletions and heterologous expression experiments strongly suggest that A. hydrophila uses a strategy similar to that of Shewanella to move electrons across the outer membrane for EET. However, the mechanism to deliver electrons to MtrA from the cytoplasmic membrane and across the periplasm of A. hydrophila was less clear.

CymA from S. oneidensis and ImcH from Geobacter sulfurreducens both belong to the NapC/NirT family of quinol dehydrogenases, multiheme c-type cytochromes that are generally responsible for oxidizing menaquinone and reducing an acceptor cytochrome in the periplasm (8, 9, 20). The only NapC/NirT family protein predicted to be encoded in the genome of A. hydrophila is a NapC homolog (AHA_1590), which is likely involved in nitrate reduction and is encoded in the napFDAGBC gene cluster. By searching the genome for predicted multiheme cytochromes, we identified a cluster of genes upstream and divergently transcribed from mtrCAB that were previously annotated as being involved in nitrite reduction (nrfBCD). In E. coli, NrfBCD forms a complex to transfer electrons from menaquinone to the periplasmic terminal nitrite reductase, NrfA (51, 59). NrfD contains eight transmembrane domains and forms a complex with NrfC, which is predicted to contain four 4Fe-4S cluster cofactors (60). The NrfCD complex oxidizes menaquinone and reduces NrfB, a periplasmic pentaheme c-type cytochrome (60). Electrons are passed from NrfB to NrfA, which facilitates reduction of NO2 to NH3 (61). Due to the genomic context, predicted function, and evidence we present here, we hypothesize that A. hydrophila uses an NrfBCD-like complex to oxidize menaquinone and reduce a periplasmic acceptor, which we have renamed Nrf-like electron transfer NetBCD based on its role in EET. A periplasmic diheme c-type cytochrome encoded directly upstream of netBCD works to shuttle electrons between NetB and MtrA across the periplasm, as shown in Fig. 7. We propose to rename this locus pdsA for periplasmic diheme shuttle. The N-terminal domain of NetB that diverges in sequence similarity with NrfB (Fig. 3B) may be responsible for interacting with PdsA.

Fe(III) citrate reduction by A. hydrophila was significantly impaired when pdsA and netBCD was deleted, and this gene cluster restored Fe(III) citrate reduction when expressed in a strain of S. oneidensis missing inner membrane and periplasmic proteins involved in metal reduction (Fig. 4). Complementation required PdsA in both A. hydrophila and S. oneidensis mutants (Fig. 4), consistent with a role for this putative diheme cytochrome as a periplasmic electron carrier. The use of a diheme cytochrome as a periplasmic shuttle is mechanistically unique among DMRB described to date. S. oneidensis uses two tetraheme cytochromes, CctA and FccA, to transfer electrons from CymA to MtrA (1012), while G. sulfurreducens is hypothesized to use triheme cytochromes, PpcA through PpcE, to transfer electrons across the periplasm (23, 24). The diheme cytochrome MacA from G. sulfurreducens was originally proposed to be involved in metal reduction; however, biochemical characterization shows that MacA is a diheme peroxidase of the CcpA family (62, 63). In contrast, PdsA is annotated as cytochrome c553, class I c-type family of cytochromes, and does not share homology to diheme peroxidases. Cytochromes c553 are generally small soluble electron carriers, and have been reported to be involved in multiple metabolisms. In the sulfate-reducing deltaproteobacterium Desulfovibrio vulgaris, cytochrome c553 is a periplasmic monoheme electron carrier that oxidizes formate dehydrogenase and reduces cytochrome c oxidase (53). In multiple Cyanobacteria species, cytochrome c553, also known as cytochrome c6, is a monoheme electron carrier that oxidizes cytochrome b6f complex and reduces photosystem I (54). In the purple sulfur gammaproteobacterium Allochromatium vinosum, cytochrome c553 (TsdA) is a periplasmic diheme protein that oxidizes thiosulfate and reduces multiple electron carriers (55). TsdA has been reported to be widespread in Proteobacteria, with homologs present in Alpha-, Beta-, Delta-, Epsilon-, and Gammaproteobacteria (56). The role of electron shuttling for cytochrome c553 in other organisms is consistent with our observations in A. hydrophila.

CymA in S. oneidensis is required for a variety of respiratory pathways, including fumarate, DMSO, nitrate, and nitrite. An S. oneidensis mutant lacking cymA was able to respire fumarate, DMSO, and nitrate when expressing netBCD but with longer lag times and a lower final cell density (Fig. 5A to C). Nitrate reduction, as measured by nitrite production, was faster in S. oneidensis ΔcymA expressing pdsA and netBCD compared to that in S. oneidensis ΔcymA expressing only netBCD (Fig. 5D). The periplasmic shuttles, fccA and cctA, are still encoded in the ΔcymA background and might contribute to electron transfer from NetBCD to the nitrate reductase NapC. The presence of PdsA, an additional periplasmic electron shuttle, in S. oneidensis lacking cymA increases the transfer of electrons to NapC compared to that in a strain not producing PdsA. Additionally, interactions between CctA or FccA with NetB may be less efficient than PdsA interacting with NetB, which could result in an increased rate of nitrite production. Reduction of nitrite was not complemented by expression of netBCD (Fig. 5D), suggesting that NetB may be unable to directly interact with NrfA. These data suggest that NetBCD is capable of reducing alternative terminal reductases when expressed in S. oneidensis. In A. hydrophila, however, there are dedicated menaquinone/quinone oxidases involved in the reduction of fumarate, nitrate, and nitrite. We hypothesize that in Aeromonas spp., NetBCD is specifically used in extracellular electron transfer, unlike the versatile CymA of Shewanella spp.

Not all sequenced Aeromonas spp. are predicted to encode EET machinery. Strains predicted to encode EET machinery are listed in Table S1 in the supplemental material, indicating the presence of homologs to mtrCAB, pdsA, and netBCD. The majority (>60%) of Aeromonas bestiarum, Aeromonas pisciola, Aeromonas popoffii, A. hydrophila, Aeromonas dhakensis, A. diversa, and A. schubertii strains contain mtrCAB, pdsA, and netBCD. A. diversa and A. schubertii are atypical in this group, as they encode a NapC/NirT family protein ∼45% similar to CymA from S. oneidensis in place of netBCD. All Aeromonas spp. that contain mtrCAB also have pdsA, regardless of the inner membrane component. Of the Aeromonas spp. with at least draft-quality sequenced genomes, 61% do not encode MtrCAB or PdsA and NetBCD. In some genera of Aeromonas spp., Aeromonas salmonicida, Aeromonas veronii, Aeromonas jandaei, and Aeromonas enteropelogenes, only a few strains are predicted to encode MtrCAB, PdsA, and NetBCD, representing the minority of their species (<35% of strains encoding MtrCAB) in the genus. The varied abilities of species to encode metal reduction in Aeromonas spp. may suggest that metal reduction traits can be transferred by horizontal gene transfer or may be lost by a genus as strains diversify.

Phylogenetic analyses show that NetB from A. hydrophila clusters with other putative NetB proteins in Aeromonas spp., while NrfB from Vibrionales, Pasteurellales, and Enterobacteriales representatives cluster separately from Aeromonas NrfB and NetB (Fig. 6). The N termini of all encoded Aeromonas NetB proteins contain 70 amino acids that do not share homology to NrfB. The unique N-terminal sequence of NetB could have evolved to allow electron transfer to PdsA and/or to prevent electron transfer to NrfA, which may explain why NetBCD could not complement nitrite reduction when expressed heterologously in S. oneidensis ΔcymA (Fig. 5D). NetB is phylogenetically distinct from NrfB, consistent with these proteins diverging from a common ancestor to facilitate electron transfer via different pathways beyond the cytoplasmic membrane.

For metal reduction in Gammaproteobacteria, the outer membrane conduit structure appears to be more conserved than the inner membrane and periplasmic components. The diversity of inner membrane proteins involved in the metal reduction pathway could be due to the fact that proton motive force (PMF) is only generated at the inner membrane and not at the outer membrane. The generation of PMF, use of different quinones, and potential dependence of the electron acceptor may have spurred greater innovation of proteins in the inner membrane. Attempts by homology search to find other genera predicted to encode NetBCD were not successful. To the best of our knowledge, the use of NetBCD for metal reduction is unique to Aeromonas spp.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

Stains used in this study are listed in Table 1. A. hydrophila ATCC 7966 was obtained from the American Type Culture Collection (Manassas, VA). S. oneidensis strain MR-1 was originally isolated from Lake Oneida in New York State (64). All chemicals were obtained from Sigma-Aldrich (St. Louis, MO). Strains were grown aerobically in lysogeny broth (LB) during routine manipulation and strain construction. Medium was supplemented with 50 μg/ml (S. oneidensis and Escherichia coli) or 75 μg/ml (A. hydrophila) kanamycin, 100 μg/ml gentamicin, and 250 μM 2,6-diaminopimelic acid (DAP), as necessary. The strains used for cloning, derivative strains of S. oneidensis and A. hydrophila, and the plasmids used in this study are found in Table 1. The minimal medium used for experiments was Shewanella basal medium (SBM) containing (per liter) 0.225 g K2HPO4, 0.225 g KH2PO4, 0.46 g NaCl, 0.225 g (NH4)SO4, 0.117 g MgSO4 · 7H2O, 2.38 g HEPES, 10 ml of mineral mix (65), 10 ml vitamin mix excluding riboflavin (66), 0.5 g Casamino Acids, and 20 mM lactate at pH 7.2. Cultures were grown at 30°C (S. oneidensis and A. hydrophila) or 37°C (Escherichia coli) and shaken at 250 rpm when grown aerobically. Fe(III) oxide (β-FeOOH) and Mn(IV) oxide were prepared as previously described (67, 68). Electron donors and acceptors were provided in the following final concentrations: 20 mM lactate, 40 mM sodium fumarate, 50 mM DMSO, 3 mM NaNO3, 5 mM Fe (III) citrate, 20 mM Mn (IV) oxide, and ∼10 mM Fe(III) oxide.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid Genotype, relevant characteristic(s) Source or reference
Strains
    JG274 S. oneidensis MR-1, wild type 64
    JG168 JG274 with empty pBBR1MCS-2, Kmr 65
    JG730 JG274 ΔmtrA 43
    JG1064 JG274 ΔcymA 78
    JG1224 JG1064 with empty pBBR1MCS-2, Kmr This study
    JG1453 JG274 (ΔmtrABC ΔmtrDEF ΔomcA ΔdmsE ΔSO4360 ΔcctA) 50
    JG3522 JG3423 with empty pBBR1MCS-2, Kmr This study
    JG3568 JG1453 with pAhmtrCAB, Kmr This study
    JG3584 JG1453 with empty pBBR1MCS-2, Kmr This study
    JG3423 Aeromonas hydrophila ATCC 7966 ATCC
    JG3626 JG3423 ΔmtrA This study
    JG3634 JG3626 with empty pBBR1MCS-2, Kmr This study
    JG3658 JG3626 with pAhmtrA, Kmr This study
    JG3689 JG1064 with pnetBCD, Kmr This study
    JG3711 JG1064 with ppdsA and netBCD, Kmr This study
    JG3745 JG274 ΔcymA ΔfccA ΔcctA This study
    JG3746 JG3745 with ppdsA and netBCD, Kmr This study
    JG3747 JG3745 with pnetBCD, Kmr This study
    JG3752 JG3745 with empty pBBR1MCS-2, Kmr This study
    JG3786 JG3423 ΔpdsA and netBCD This study
    JG3788 JG3786 with pnetBCD, Kmr This study
    JG3790 JG3786 with empty pBBR1MCS-2, Kmr This study
    JG3793 JG3786 with ppdsA and netBCD, Kmr This study
    JG3796 JG1064 with pcymA, Kmr This study
    JG4008 JG730 with empty pBBR1MCS-2, Kmr This study
    JG4009 JG3626 with pSomtrA, Kmr This study
    JG4015 JG730 with pSomtrA, Kmr This study
    JG4016 JG730 with pAhmtrA, Kmr This study
    UQ950 E. coli DH5α λ(pir) host for cloning, F Δ(argF-lac)169 ϕ80dlacZ58(ΔM15) glnV44(AS) rfbD1 gyrA96(NalR) recA1 endA1 spoT1 thi-1 hsdR17 deoR λpir+ 69
    WM3064 E. coli donor strain for conjugation, thrB1004 pro thi rpsL hsdS lacZΔM15 RP4–1360 Δ(araBAD)567 ΔdapA1341::[erm pir(wt)] 69
Plasmids
    pSMV3 Deletion vector, Kmr, sacB 69
    pBBR1MCS-2 Broad-host range cloning vector, Kmr 71
    pEXG2 Deletion vector, Gentr, sacB 70
    pcymA cymA in pBBR1MCS-22 with 12 bp upstream and 78 bp downstream in pBBR1MCS-2 Lab stock
    pAhmtrCAB mtrCAB (AHA_2764–AHA_2766) with 75 bp upstream and 90 bp downstream in pBBR1MCS-2 This study
    pAhmtrA mtrA with 25 bp upstream and 20 bp downstream in pBBR1MCS-2 This study
    pSomtrA mtrA with 20 bp upstream and 20 bp downstream in pBBR1MCS-2 This study
    ppdsA/netBCD pdsA and netBCD (AHA_2760–AHA_2763) with 35 bp upstream and 77 bp downstream in pBBR1MCS-2 This study
    pnetBCD netBCD with 62 bp upstream and 42 bp downstream in pBBR1MCS-2 This study
    pΔAhmtrA 1,138 bp upstream and 1,102 bp downstream of mtrA in pEXG2 This study
    pΔpdsA/netBCD 1,196 bp upstream and 1,052 bp downstream of pdsA and netBCD in pSMV3 This study
    pΔcymA 78
    pΔfccA 78
    pΔcctA 951 bp upstream and 861 bp downstream of cctA in pSMV3 43

Plasmid and mutant construction.

Primers used to construct plasmids are listed in Table 2. Construction of in-frame deletion mutants was performed as previously described (69). For both Shewanella and Aeromonas strains, 1-kb fragments upstream and downstream of the targeted sequence, including nine nucleotides after the start codon and nine nucleotides before the stop codon, were amplified and cloned into the suicide vector pSMV3 (69) or pEXG2 (for A. hydrophila ΔmtrA) (70). Merodiploids were selected for by kanamycin or gentamicin resistance, and clones were screened by PCR. Merodiploids were resolved by sucrose counterselection mediated by sacB and screened by PCR. Complementation strains were constructed using pBBR1MCS-2 (71). All constructs and deletion mutants were verified with Sanger sequencing by ACGT, Inc. (Wheeling, IL).

TABLE 2.

Primers used in the study

Function or primer Sequence Restriction site
Complementation
    AhmtrCAB_F ACCTAGCTCGAGATACTCAAGGTTGATTTTCGATCCG XhoI
    AhmtrCAB_R TCTTACAAGCTTAGATGATGAAAGAGGGGAGCCTGG HindIII
    AhmtrA_F AATCGTCTCGAGCCCTTTGCCGTTGAAGAACACGAT XhoI
    AhmtrA_R TCAGCTAAGCTTTATTTCATGACTTCTCTCC HindIII
    SomtrA_F NNNNNNAAGCTTGACAAATTGGGAAGCCTATT HindIII
    SomtrA_R NNNNNNTCTAGAAATTTCATTTTCTCGTCTCC XbaI
    pdsA-netBCD_F GCTTATAAGCTTGGGTTTATAGACCTTTTCTG HindIII
    pdsA-netBCD_R CTATTATCTAGATTAGCAGCAATAAAAAAGGC XbaI
    netBCD_F NNNNNNAAGCTTCTCCTTTTTGTTGCCAGGCG HindIII
    netBCD_R TTTGTTTGCCTGCGATTTGCTCTAGANNNNNN XbaI
    cymA_F NNNNNNGAATTCGGAGATAGAGTAATGAACTG EcoRI
    cymA_R NNNNNNGAGCTCCTATCTAGATAGATCTGCTA SacI
Deletion
    ΔAhmtrA_upF GGACAAGCTTTGTTCAAGTTTGACGACGTG HindIII
    ΔAhmtrA_upR CCAGTCTAGACGGGGTGATTCTTTTCATATCGTGTC XbaI
    ΔAhmtrA_downF GTCCTCTAGACAATCACTGCGGCGCTGAGGAGAG XbaI
    ΔAhmtrA_downR GTCCAGAATTCTCATCGGACTTGTCCTTGCG EcoRI
    ΔpdsA-netBCD_upF CAATTTACTAGTTGTTGATCTTGCCGTTGATG SpeI
    ΔpdsA-netBCD_upR CTATTATCTAGAGCGTTTCATTTCTTATCC XbaI
    ΔpdsA-netBCD_downF CTATTATCTAGACAGATGACGGTGATGTAGCC XbaI
    ΔpdsA-netBCD_downR GCTTATGCGGCCGCCGGTGCAACGTTTTATCACC NotI

Metal reduction assays.

Metal reduction was measured using ferrozine assays, as previously described with some modifications (72). Single colonies freshly streaked from frozen stocks were inoculated into LB and grown overnight. Cells were washed once in SBM and resuspended to an optical density at 600 nm (OD600) of 1. This suspension was diluted 1:10 into 270 μl of SBM with either ∼5 mM Fe(III) citrate, ∼10 mM Fe(III) oxide, or ∼20 mM Mn(IV) oxide in a 96-well plate. Plates were kept in a GasPak system anaerobic petri dish holder (Becton, Dickinson and Company) that was flushed with argon for 15 min between time points and incubated at room temperature. At each time point, samples were diluted 1:10 into 0.5 N HCl to prevent the oxidation of Fe(II) (72). Fe(II) was measured by diluting the acid-fixed sample 1:10 into a solution containing 2 g/liter ferrozine buffered in 100 mM HEPES (73), and optical density at 562 nm (OD562) was quantified. Standard curves for Fe(II) were made from FeSO4 dissolved in 0.5 N HCl. Biological Mn(IV) reduction was quantified indirectly via the abiotic reduction of Mn(IV) by Fe(II), which can be quantified by ferrozine. Samples from Mn(IV) reduction assays were mixed with Fe(II), and the remaining Fe(II) was measured via ferrozine, which corresponds to the amount of remaining Mn(IV). Mn(IV) was diluted 1:5 into 4 mM FeSO4 in 2 M HCl, and incubated in the dark overnight, and the resulting Fe(II) was measured (20). Standard curves for Mn(IV) were made by diluting 1:10 of Mn(IV) oxide in 4 mM FeSO4 in 2 M HCl and incubating in the dark overnight. Mn(IV) standards were diluted 1:5 in 0.5 M HCl and diluted 1:10 into a solution containing ferrozine, and OD562 was quantified.

Genome comparisons and phylogeny.

The Integrated Microbial Genomes (IMG) system (https://img.jgi.doe.gov/cgi-bin/m/main.cgi) was used to compare both draft and finished Aeromonas genomes, using a cut off 30% amino acid identity. Multiple sequence alignments of NrfB and NetB amino acid sequences were generated using ClustalW (74). MEGA7 was used to generate a phylogenetic tree using the maximum likelihood method with 1,000 bootstrap replications, based on the JTT matrix-based model (75, 76). The analysis involved 70 amino acid sequences with a total of 143 positions in the final data set. All positions containing gaps and missing data were eliminated. The graphical representation of the phylogenetic tree was generated using FigTree version 1.4.3 (77).

Structural modeling.

A. hydrophila ATCC 7966 MtrC AHA_2764, was aligned to homologous proteins using the intensive modeling mode in Phyre2 version 2.0 (46). The resulting predicted structure was visualized using PyMOL version 2.0 (www.pymol.org) and compared to published structures of Shewanella MtrC (PDB accession number 4LM8), MtrF (accession number 3PMQ), OmcA (accession number 4LMH) and UndA (accession number 3UFK) (18, 4749).

Supplementary Material

Supplemental file 1
zam023188879s1.pdf (825.6KB, pdf)

ACKNOWLEDGMENTS

We thank Tim Yahr (University of Iowa) for sharing the pEXG2 vector.

This work was supported by a grant from the National Science Foundation (DEB-1542513) to J.A.G. and D.R.B. B.E.C. was partly supported by the Stanwood Johnston Fellowship from the University of Minnesota.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02134-18.

REFERENCES

  • 1.Shi L, Dong H, Reguera G, Beyenal H, Lu A, Liu J, Yu H-Q, Fredrickson JK. 2016. Extracellular electron transfer mechanisms between microorganisms and minerals. Nat Rev Microbiol 14:651–662. doi: 10.1038/nrmicro.2016.93. [DOI] [PubMed] [Google Scholar]
  • 2.Gralnick JA, Newman DK. 2007. Extracellular respiration. Mol Microbiol 65:1–11. doi: 10.1111/j.1365-2958.2007.05778.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bird LJ, Bonnefoy V, Newman DK. 2011. Bioenergetic challenges of microbial iron metabolisms. Trends Microbiol 19:330–340. doi: 10.1016/j.tim.2011.05.001. [DOI] [PubMed] [Google Scholar]
  • 4.Weber KA, Achenbach LA, Coates JD. 2006. Microorganisms pumping iron: anaerobic microbial iron oxidation and reduction. Nat Rev Microbiol 4:752–764. doi: 10.1038/nrmicro1490. [DOI] [PubMed] [Google Scholar]
  • 5.Brutinel ED, Gralnick JA. 2012. Shuttling happens: soluble flavin mediators of extracellular electron transfer in Shewanella. Appl Microbiol Biotechnol 93:41–48. doi: 10.1007/s00253-011-3653-0. [DOI] [PubMed] [Google Scholar]
  • 6.Shi L, Richardson DJ, Wang Z, Kerisit SN, Rosso KM, Zachara JM, Fredrickson JK. 2009. The roles of outer membrane cytochromes of Shewanella and Geobacter in extracellular electron transfer. Environ Microbiol Rep 1:220–227. doi: 10.1111/j.1758-2229.2009.00035.x. [DOI] [PubMed] [Google Scholar]
  • 7.Lovley DR, Holmes DE, Nevin KP. 2004. Dissimilatory Fe(III) and Mn(IV) reduction. Adv Microb Physiol 49:219–286. doi: 10.1016/S0065-2911(04)49005-5. [DOI] [PubMed] [Google Scholar]
  • 8.Marritt SJ, Lowe TG, Bye J, McMillan DGG, Shi L, Fredrickson J, Zachara J, Richardson DJ, Cheesman MR, Jeuken LJC, Butt JN. 2012. A functional description of CymA, an electron-transfer hub supporting anaerobic respiratory flexibility in Shewanella. Biochem J 444:465–474. doi: 10.1042/BJ20120197. [DOI] [PubMed] [Google Scholar]
  • 9.Myers JM, Myers CR. 2000. Role of the tetraheme cytochrome CymA in anaerobic electron transport in cells of Shewanella putrefaciens MR-1 with normal levels of menaquinone. J Bacteriol 182:67–75. doi: 10.1128/JB.182.1.67-75.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Leys D, Meyer TE, Tsapin AS, Nealson KH, Cusanovich MA, Van Beeumen JJ. 2002. Crystal structures at atomic resolution reveal the novel concept of “electron-harvesting” as a role for the small tetraheme cytochrome c. J Biol Chem 277:35703–35711. doi: 10.1074/jbc.M203866200. [DOI] [PubMed] [Google Scholar]
  • 11.Sturm G, Richter K, Doetsch A, Heide H, Louro RO, Gescher J. 2015. A dynamic periplasmic electron transfer network enables respiratory flexibility beyond a thermodynamic regulatory regime. ISME J 9:1802–1811. doi: 10.1038/ismej.2014.264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Leys D, Tsapin AS, Nealson KH, Meyer TE, Cusanovich MA, Van Beeumen JJ. 1999. Structure and mechanism of the flavocytochrome c fumarate reductase of Shewanella putrefaciens MR-1. Nat Struct Biol 6:1113–1117. doi: 10.1038/70051. [DOI] [PubMed] [Google Scholar]
  • 13.Hartshorne RS, Reardon CL, Ross D, Nuester J, Clarke TA, Gates AJ, Mills PC, Fredrickson JK, Zachara JM, Shi L, Beliaev AS, Marshall MJ, Tien M, Brantley S, Butt JN, Richardson DJ. 2009. Characterization of an electron conduit between bacteria and the extracellular environment. Proc Natl Acad Sci U S A 106:22169–22174. doi: 10.1073/pnas.0900086106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ross DE, Ruebush SS, Brantley SL, Hartshorne RS, Clarke TA, Richardson DJ, Tien M. 2007. Characterization of protein-protein interactions involved in iron reduction by Shewanella oneidensis MR-1. Appl Environ Microbiol 73:5797–5808. doi: 10.1128/AEM.00146-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Edwards MJ, White GF, Lockwood CW, Lawes M, Martel A, Harris G, Scott DJ, Richardson D, Butt JN, Clarke TA. 2018. Structural model of a porin-cytochrome electron conduit from the outer membrane of a metal reducing bacterium suggests electron transfer via periplasmic redox partners. J Biol Chem 293:8103–8112. doi: 10.1074/jbc.RA118.001850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.von Canstein H, Ogawa J, Shimizu S, Lloyd JR. 2008. Secretion of flavins by Shewanella species and their role in extracellular electron transfer. Appl Environ Microbiol 74:615–623. doi: 10.1128/AEM.01387-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Marsili E, Baron DB, Shikhare ID, Coursolle D, Gralnick JA, Bond DR. 2008. Shewanella secretes flavins that mediate extracellular electron transfer. Proc Natl Acad Sci U S A 105:3968–3973. doi: 10.1073/pnas.0710525105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Edwards MJ, White GF, Norman M, Tome-Fernandez A, Ainsworth E, Shi L, Fredrickson JK, Zachara JM, Butt JN, Richardson DJ, Clarke TA. 2015. Redox linked flavin sites in extracellular decaheme proteins involved in microbe-mineral electron transfer. Sci Rep 5:11677. doi: 10.1038/srep11677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Okamoto A, Hashimoto K, Nealson KH, Nakamura R. 2013. Rate enhancement of bacterial extracellular electron transport involves bound flavin semiquinones. Proc Natl Acad Sci U S A 110:7856–7861. doi: 10.1073/pnas.1220823110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Levar CE, Chan CH, Mehta-Kolte MiG Bond DR. 2014. An inner membrane cytochrome required only for reduction of high redox potential extracellular electron acceptors. mBio 5:e02034-14. doi: 10.1128/mBio.02034-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Levar CE, Hoffman CL, Dunshee AJ, Toner BM, Bond DR. 2017. Redox potential as a master variable controlling pathways of metal reduction by Geobacter sulfurreducens. ISME J 11:741–752. doi: 10.1038/ismej.2016.146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zacharoff L, Chan CH, Bond DR. 2016. Reduction of low potential electron acceptors requires the CbcL inner membrane cytochrome of Geobacter sulfurreducens. Bioelectrochemistry 107:7–13. doi: 10.1016/j.bioelechem.2015.08.003. [DOI] [PubMed] [Google Scholar]
  • 23.Lloyd JR, Leang C, Myerson ALH, Coppi MV, Cuifo S, Methe B, Sandler SJ, Lovely DR. 2003. Biochemical and genetic characterization of PpcA, a periplasmic c-type cytochrome in Geobacter sulfurreducens. Biochem J 369:153–161. doi: 10.1042/bj20020597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Morgado L, Brulx M, Pessanha M, Londer YY, Salgueiro CA. 2010. Thermodynamic characterization of a triheme cytochrome family from Geobacter sulfurreducens reveals mechanistic and functional diversity. Biophys J 99:293–301. doi: 10.1016/j.bpj.2010.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ueki T, DiDonato LN, Lovley DR. 2017. Toward establishing minimum requirements for extracellular electron transfer in Geobacter sulfurreducens. FEMS Microbiol Lett 364:fnx093. doi: 10.1093/femsle/fnx093. [DOI] [PubMed] [Google Scholar]
  • 26.Jiménez Otero F, Chan CH, Bond DR. 2018. Identification of different putative outer membrane electron conduits necessary for Fe(III) citrate, Fe(III) oxide, Mn(IV) oxide, or electrode reduction by Geobacter sulfurreducens. J Bacteriol 200:e00347-18. doi: 10.1128/JB.00347-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Liu Y, Wang Z, Liu J, Levar C, Edwards MJ, Babauta JT, Kennedy DW, Shi Z, Beyenal H, Bond DR, Clarke TA, Butt JN, Richardson DJ, Rosso KM, Zachara JM, Fredrickson JK, Shi L. 2014. A trans-outer membrane porin-cytochrome protein complex for extracellular electron transfer by Geobacter sulfurreducens PCA. Environ Microbiol Rep 6:776–785. doi: 10.1111/1758-2229.12204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Koch C, Harnisch F. 2016. Is there a specific ecological niche for electroactive microorganisms? ChemElectroChem 3:1282–1295. doi: 10.1002/celc.201600079. [DOI] [Google Scholar]
  • 29.Chung K, Okabe S. 2009. Characterization of electrochemical activity of a strain ISO2-3 phylogenetically related to Aeromonas sp. isolated from a glucose-fed microbial fuel cell. Biotechnol Bioeng 104:901–910. doi: 10.1002/bit.22453. [DOI] [PubMed] [Google Scholar]
  • 30.Sharma SC, Feng C, Li J, Hu A, Wang H, Qin D, Yu CP. 2016. Electrochemical characterization of a novel exoelectrogenic bacterium strain SCS5, isolated from a mediator-less microbial fuel cell and phylogenetically related to Aeromonas jandaei. Microbes Environ 31:213–225. doi: 10.1264/jsme2.ME15185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Knight V, Blakemore R. 1998. Reduction of diverse electron acceptors by Aeromonas hydrophila. Arch Microbiol 169:239–248. doi: 10.1007/s002030050567. [DOI] [PubMed] [Google Scholar]
  • 32.Ishii S, Suzuki S, Norden-Krichmar TM, Phan T, Wanger G, Nealson KH, Sekiguchi Y, Gorby YA, Bretschger O. 2014. Microbial population and functional dynamics associated with surface potential and carbon metabolism. ISME J 8:963–978. doi: 10.1038/ismej.2013.217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ishii S, Suzuki S, Yamanaka Y, Wu A, Nealson KH, Bretschger O. 2017. Population dynamics of electrogenic microbial communities in microbial fuel cells started with three different inoculum sources. Bioelectrochemistry 117:74–82. doi: 10.1016/j.bioelechem.2017.06.003. [DOI] [PubMed] [Google Scholar]
  • 34.Janda JM, Abbott SL. 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin Microbiol Rev 23:35–73. doi: 10.1128/CMR.00039-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Strom AR, Larsen H. 1979. Anaerobic fish spoilage by bacteria I. Biochemical changes in herring extracts. J Appl Bacteriol 46:531–543. doi: 10.1111/j.1365-2672.1979.tb00852.x. [DOI] [PubMed] [Google Scholar]
  • 36.Lerke P, Adams R, Farber L. 1965. Bacteriology of spoilage of fish muscle. Appl Microbiol 13:625–630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Barrett EL, Kwan HS. 1985. Bacterial reduction of trimethylamine oxide. Annu Rev Microbiol 39:131–149. doi: 10.1146/annurev.mi.39.100185.001023. [DOI] [PubMed] [Google Scholar]
  • 38.Macfarlane GT, Herbert RA. 1984. Dissimilatory nitrate reduction and nitrification in estuarine sediments. Microbiology 130:2301–2308. doi: 10.1099/00221287-130-9-2301. [DOI] [Google Scholar]
  • 39.Cole JA, Brown CM. 1980. Nitrite reduction to ammonia by fermentative bacteria: a short circuit in the biological nitrogen cycle. FEMS Microbiol Lett 7:65–72. doi: 10.1111/j.1574-6941.1980.tb01578.x. [DOI] [Google Scholar]
  • 40.McLeod ES, Dawood Z, Macdonald R, Oosthuizen MC, Graf J, Steyn PL, Brözel VS. 1998. Isolation and identification of sulphite- and iron reducing, hydrogenase positive facultative anaerobes from cooling water systems. Syst Appl Microbiol 21:297–305. doi: 10.1016/S0723-2020(98)80037-4. [DOI] [Google Scholar]
  • 41.Gray SJ. 1984. Aeromonas hydrophila in livestock: incidence, biochemical charactenstics and antibiotic susceptibility. J Hyg (Lond) 92:365–375. doi: 10.1017/S0022172400064585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gosling PJ. 1996. Aeromonas species in diseases of animals, p 121–175. In Austin B, Altwegg M, Gosling PJ, Joseph S (ed), The genus Aeromonas, 1st ed John Wiley & Sons, Ltd, Chichester, United Kingdom. [Google Scholar]
  • 43.Coursolle D, Gralnick JA. 2010. Modularity of the Mtr respiratory pathway of Shewanella oneidensis strain MR-1. Mol Microbiol 77:995–1008. doi: 10.1111/j.1365-2958.2010.07266.x. [DOI] [PubMed] [Google Scholar]
  • 44.Shi L, Rosso KM, Zachara JM, Fredrickson JK. 2012. Mtr extracellular electron-transfer pathways in Fe(III)-reducing or Fe(II)-oxidizing bacteria: a genomic perspective. Biochem Soc Trans 40:1261–1267. doi: 10.1042/BST20120098. [DOI] [PubMed] [Google Scholar]
  • 45.Lovley DR, Fraga JL, Blunt-Harris EL, Hayes LA, Phillips EJP, Coates JD. 1998. Humic substances as a mediator for microbially catalyzed metal reduction. Acta Hydrochim Hydrobiol 26:152–157. doi:. [DOI] [Google Scholar]
  • 46.Kelley L, Mezulis S, Yates CM, Wass MN, Sternberg MJ. 2015. The Phyre2 web portal for protein modelling, prediction, and analysis. Nat Protoc 10:845–858. doi: 10.1038/nprot.2015.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Clarke TA, Edwards MJ, Gates AJ, Hall A, White GF, Bradley J, Reardon CL, Shi L, Beliaev AS, Marshall MJ, Wang Z, Watmough NJ, Fredrickson JK, Zachara JM, Butt JN, Richardson DJ. 2011. Structure of a bacterial cell surface decaheme electron conduit. Proc Natl Acad Sci U S A 108:9384–9389. doi: 10.1073/pnas.1017200108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Edwards MJ, Baiden NA, Johs A, Tomanicek SJ, Liang L, Shi L, Fredrickson JK, Zachara JM, Gates AJ, Butt JN, Richardson DJ, Clarke TA. 2014. The X-ray crystal structure of Shewanella oneidensis OmcA reveals new insight at the microbe-mineral interface. FEBS Lett 588:1886–1890. doi: 10.1016/j.febslet.2014.04.013. [DOI] [PubMed] [Google Scholar]
  • 49.Edwards MJ, Hall A, Shi L, Fredrickson JK, Zachara JM, Butt JN, Richardson DJ, Clarke TA. 2012. The crystal structure of the extracellular 11-heme cytochrome UndA reveals a conserved 10-heme motif and defined binding site for soluble iron chelates. Structure 20:1275–1284. doi: 10.1016/j.str.2012.04.016. [DOI] [PubMed] [Google Scholar]
  • 50.Coursolle D, Gralnick JA. 2012. Reconstruction of extracellular respiratory pathways for iron(III) reduction in Shewanella oneidensis strain MR-1. Front Microbiol 3:56. doi: 10.3389/fmicb.2012.00056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Simon J, Kroneck PMH. 2014. The production of ammonia by multiheme cytochromes c, p 211–236. Met Ions Life Sci 14:211–236. doi: 10.1007/978-94-017-9269-1_9. [DOI] [PubMed] [Google Scholar]
  • 52.Eaves DJ, Grove J, Staudenmann W, James P, Poole RK, White SA, Griffiths I, Cole JA. 1998. Involvement of products of the nrfEFG genes in the covalent attachment of haem c to a novel cysteine-lysine motif in the cytochrome c552 nitrite reductase from Escherichia coli. Mol Microbiol 28:205–216. doi: 10.1046/j.1365-2958.1998.00792.x. [DOI] [PubMed] [Google Scholar]
  • 53.Sebban-Kreuzer C, Dolla A, Guerlesquin F. 1998. The formate dehydrogenase-cytochrome c553 complex from Desulfovibrio vulgaris Hildenborough. Eur J Biochem 253:645–652. doi: 10.1046/j.1432-1327.1998.2530645.x. [DOI] [PubMed] [Google Scholar]
  • 54.Ho KK, Kerfeld CA, Krogmann D. 2011. The water soluble cytochromes of cyanobacteria, p 515–540. In Peschek GA, Obinger C, Renger G (ed), Bioenergetic processes of cyanobacteria. Springer, Dordrecht, Netherlands. [Google Scholar]
  • 55.Kurth JM, Brito JA, Reuter J, Flegler A, Koch T, Franke T, Klein EM, Rowe SF, Butt JN, Denkmann K, Pereira IAC, Archer M, Dahl C. 2016. Electron accepting units of the diheme cytochrome c TsdA, a bifunctional thiosulfate dehydrogenase/tetrathionate reductase. J Biol Chem 291:24804–24818. doi: 10.1074/jbc.M116.753863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Denkmann K, Grein F, Zigann R, Siemen A, Bergmann J, van Helmont S, Nicolai A, Pereira IAC, Dahl C. 2012. Thiosulfate dehydrogenase: a widespread unusual acidophilic c-type cytochrome. Environ Microbiol 14:2673–2688. doi: 10.1111/j.1462-2920.2012.02820.x. [DOI] [PubMed] [Google Scholar]
  • 57.Myers CR, Myers JM. 1997. Cloning and sequence of cymA, a gene encoding a tetraheme cytochrome c required for reduction of iron(III), fumarate, and nitrate by Shewanella putrefaciens MR-1. J Bacteriol 179:1143–1152. doi: 10.1128/jb.179.4.1143-1152.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Schwalb C, Chapman SK, Reid GA. 2003. The tetraheme cytochrome CymA is required for anaerobic respiration with dimethyl sulfoxide and nitrite in Shewanella oneidensis. Biochemistry 42:9491–9497. doi: 10.1021/bi034456f. [DOI] [PubMed] [Google Scholar]
  • 59.Simon J. 2002. Enzymology and bioenergetics of respiratory nitrite ammonification. FEMS Microbiol Rev 26:285–309. doi: 10.1111/j.1574-6976.2002.tb00616.x. [DOI] [PubMed] [Google Scholar]
  • 60.Hussain H, Grove J, Griffiths L, Busby S, Coie J. 1994. A seven-gene operon essential for formate-dependent nitrite reduction to ammonia by enteric bacteria. Mol Microbiol 12:153–163. doi: 10.1111/j.1365-2958.1994.tb01004.x. [DOI] [PubMed] [Google Scholar]
  • 61.Clarke TA, Cole JA, Richardson DJ, Hemmings AM. 2007. The crystal structure of the pentahaem c-type cytochrome NrfB and characterization of its solution-state interaction with the pentahaem nitrite reductase NrfA. Biochem J 406:19–30. doi: 10.1042/BJ20070321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Butler JE, Kaufmann F, Coppi MV, Núñez C, Lovley DR. 2004. MacA, a diheme c-type cytochrome involved in Fe(III) reduction by Geobacter sulfurreducens. J Bacteriol 186:4042–4045. doi: 10.1128/JB.186.12.4042-4045.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Seidel J, Hoffmann M, Ellis KE, Seidel A, Spatzal T, Gerhardt S, Elliott SJ, Einsle O. 2012. MacA is a second cytochrome c peroxidase of Geobacter sulfurreducens. Biochemistry 51:2747–2756. doi: 10.1021/bi300249u. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Myers CR, Nealson KH. 1988. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science 240:1319–1321. doi: 10.1126/science.240.4857.1319. [DOI] [PubMed] [Google Scholar]
  • 65.Hau HH, Gilbert A, Coursolle D, Gralnick JA. 2008. Mechanism and consequences of anaerobic respiration of cobalt by Shewanella oneidensis strain MR-1. Appl Environ Microbiol 74:6880–6886. doi: 10.1128/AEM.00840-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Balch WE, Fox GE, Magrum LJ, Woese CR, Wolfe RS. 1979. Methanogens: reevaluation of a unique biological group. Microbiol Rev 43:260–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Lovley DR, Phillips EJP. 1986. Organic matter mineralization with reduction of ferric iron in anaerobic sediments. Appl Environ Microbiol 51:683–689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Chan CH, Levar CE, Zacharoff L, Badalamenti JP, Bond DR. 2015. Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens. Appl Environ Microbiol 81:7178–7186. doi: 10.1128/AEM.01967-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Saltikov CW, Newman DK. 2003. Genetic identification of a respiratory arsenate reductase. Proc Natl Acad Sci U S A 100:10983–10988. doi: 10.1073/pnas.1834303100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rietsch A, Vallet-Gely I, Dove SL, Mekalanos JJ. 2005. ExsE, a secreted regulator of type III secretion genes in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 102:8006–8011. doi: 10.1073/pnas.0503005102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Kovach ME, Elzer PH, Steven Hill D, Robertson GT, Farris MA, Roop RM, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176. doi: 10.1016/0378-1119(95)00584-1. [DOI] [PubMed] [Google Scholar]
  • 72.Coursolle D, Baron DB, Bond DR, Gralnick JA. 2010. The Mtr respiratory pathway is essential for reducing flavins and electrodes in Shewanella oneidensis. J Bacteriol 192:467–474. doi: 10.1128/JB.00925-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Stookey LL. 1970. Ferrozine—a new spectrophotometric reagent for iron. Anal Chem 42:779–781. doi: 10.1021/ac60289a016. [DOI] [Google Scholar]
  • 74.Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Jones DT, Taylor WR, Thornton JM. 1992. The rapid generation of mutation data matricies from protein sequences. Comput Appl Biosci 8:275–282. [DOI] [PubMed] [Google Scholar]
  • 76.Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Drummond AJ. 2009. FigTree. http://tree.bio.ed.ac.uk/software/figtree/. Retrieved 4 January 2018 (Software).
  • 78.Ross DE, Flynn JM, Baron DB, Gralnick JA, Bond DR. 2011. Towards electrosynthesis in Shewanella: energetics of reversing the Mtr pathway for reductive metabolism. PLoS One 6:e16649. doi: 10.1371/journal.pone.0016649. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
zam023188879s1.pdf (825.6KB, pdf)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES