Single step production of Cas9 mRNA for zygote injection

Abstract

Production of Cas9 mRNA in vitro typically requires the addition of a 5ʹ cap and 3ʹ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

METHOD SUMMARY

A new Cas9 mRNA that contains an EMCV IRES and triple helical tail structure can be utilized for zygote injections. This mRNA can be produced in a single step without the addition of a poly(A) tail and maintains the same efficiency of modifications as commercially available Cas9 mRNA.

With the rise of the CRISPR/Cas9 technology, we have constructed a new Cas9 mRNA that does not possess a poly(A) tail but rather a triple helical tail originating from the mMalat1 gene. The use of the triple helix tail lends itself to produce an unlimited, inexpensive Cas9 mRNA that creates modifications at the same efficiency as commercially available Cas9 mRNA. In absence of polyadenylation, the resulting mRNA has a defined, fixed length that facilitates assessment of mRNA degradation.

Since the development and use of the CRISPR/Cas9 system, genetic engineering in zygotes of mammals is becoming highly efficient [1–5]. However, in vitro production of Cas9 mRNA has its limitations. After in vitro transcription, it is difficult to assess RNA degradation due the variable length of the poly(A) tail. An alternative source of stable, assessable Cas9 mRNA may be more useful and more efficient for laboratories that produce their own Cas9 as compared to commercially produced Cas9 mRNA that can be expensive and difficult to evaluate.

The majority of mRNAs are polyadenylated to possess a poly(A) tail. This poly(A) tail generally contains around 200 adenosine (A) nucleotides and is critical for the transcript to be exported out of the nucleus, translated, and is important for RNA stability. Similar to Malat1, histone mRNAs end in a six-base stem and four base loop that functionally replaces the poly(A) tail [6]. Surprisingly, recent research found that the 3ʹ end of a nuclear noncoding RNA, Malat1, can also support the translation of a GFP reporter gene just as efficiently as the poly(A) tail [7]. While Malat1 is a long non-coding RNA (lncRNA), it is among the most abundantly expressed lncRNAs and the A rich triple helical structure is able to bind to the ribosome and protect it from exonucleases. Addition of a triple helical structure to the Cas9 instead of the poly(A) tail simplifies mRNA production.

To create the triple helical structure on Cas9 a triple helical sequence from the mMalat1 gene was cloned into the plasmid vector pCR™4-TOPO 9 (Invitrogen, Thermo Fischer, Grand Island, NY, USA) (pBKR1). pBKR1 was cut with NcoI to BstEII, gel purified, and cloned into a T7 IRES expression plasmid (pSF-T7-EMCV, Oxford Genetics, Oxford, UK) at NcoI to BstEII (pBKR2). Cas9 was cut NcoI to EcoRI from pX330 [8], gel purified and cloned into pBKR2 at NcoI to EcoRI to make pBKR3 (Figure 1). The pBKR3 plasmid was linearized with BsmBI and in vitro transcription was completed by using the mMessage mMachine kit (Thermo Fisher). The kit utilizes an anti-reverse cap analog during transcription. The RNA was purified with a MEGAclear kit (Thermo Fisher). The Cas9 RNA that contains a triple helical tail is referred to as “MU Cas9 mRNA”. Alternatively, an uncapped mRNA was also produced by using the linearized pBKR3 vector and completing in vitro transcription by using a ribonucleotide solution mix (NEB, Ipswich, MA, USA) and an RNA polymerase (NEB), and then the resulting mRNA was purified by using the MEGAclear kit. This uncapped mRNA was named MU Cas9 mRNA_NC. All guide RNAs (gRNAs) were produced as in Whitworth et al. [1]; a brief description follows. The 20 bp guides were designed to target sequences next to an S. pyogenes protospacer adjacent motif [9]. A gBlock containing a T7 promotor sequence was added upstream of the guide and Integrated DNA Technologies (Coralville, IA, USA) synthesized the guide. Each gBlock was PCR amplified, and then purified by using a Qiagen (Valencia, CA, USA) PCR purification kit. The purified gBlock amplicons were used for in vitro transcription by using the MEGAshortscript (Ambion, Thermo Fisher) kit. The resulting RNAs were then purified by using the MEGAclear Transcription Clean-Up Kit. Single guide RNA and Cas9 mRNA were diluted in nuclease-free water and stored at −80°C until zygote injection.

Figure 1.

A. Schematic of a linearized pBKR3 vector. B. MU Cas9 mRNA_NC with specific elements identified. C. Cas9 containing a 5ʹ cap and modified with pseudouridine and 5-methylcytidine mRNA containing a 3ʹ poly(A) tail (TriLink Biotechnologies).

An mRNA concentration curve was completed to determine the optimal concentration of Cas9 mRNA to be used during zygote injection with respect to both blastocyst development and the percent gene edited. Four proprietary gRNAs that were previously confirmed to create modifications during zygote injections were used to test for the efficiency of modifications. MU Cas9 mRNA was directly compared with commercially available Cas9 mRNA that had been polyadenylated and contains 5-methylcytidine and pseudouridine modifications (TriLink Biotechnologies, San Diego, CA, USA) (Figure 1). Cas9 mRNA (10 ng/μl, 20 ng/μl, 40 ng/μl, and 80 ng/μl) were each co-injected with all four gRNAs (15 ng/ul). Zygotes were created by using in vitro matured oocytes and in vitro fertilization [1]. The injected zygotes were cultured in MU2 medium for 7 days [10].

Development to the blastocyst stage was reduced by injecting zygotes with either Cas9 mRNA compared to zygotes that were not injected (Figure 2), but development was not affected by the type of Cas9 mRNA or the concentration of Cas9 mRNA that was injected (Figure 2). The goal was to determine if large deletions existed in the PCR amplicons by agarose gel electrophoresis. There were no differences in the percentage of modifications as seen by gel imaging between the sources of Cas9 mRNA; however there was an increase in the percentage of modifications in the 80 ng/μl concentration of MU Cas9 mRNA compared to commercial Cas9 mRNA (Table 1). By assessing if large deletions existed in the PCR amplicons as a way to measure modification efficiency, we underestimated the number of true modifications present in each embryo and did not detect mosaicism.

Figure 2.

The effect of Cas9 type and concentration on blastocyst percentage. This data is derived from 3 replicates containing 196, 178; 198, 175; 204, 180; 194, 175, injected zygotes respectively. NI refers to the non-injected control.

Table 1. Percentage of modified blastocysts developed from zygote injections of commercially available Cas9 or MU Cas9 at varying concentrations.

Five replicates of injections were completed to generate this data. ^a,b denotes P<0.05.

Cas9 Source	Percentage of Modified Blastocysts ± S.E.	Total Number of Blastocysts Assayed
10 ng/μL MU Cas9	72.7%±10.8%	52
10 ng/μL Cas9	73.0%±7.5%	23
20 ng/μL MU Cas9	86.7%±6.1%	61
20 ng/μL Cas9	73.5%±13.4%	26
40 ng/μL MU Cas9	87.0%±7.1%	58
40 ng/μL Cas9	82.2%±6.3%	19
80 ng/μL MU Cas9	90.9%±2.2%a	38
80 ng/μL Cas9	58.5%±17.1%b	20

To confirm our results, we assessed modifications by using gRNAs for two different genes (proprietary Gene X and phenylalanine hydroxylase (PAH) Table 2). MU Cas9 mRNA and Cas9 mRNA were injected (20 ng/μl) with different pairs of gRNAs and the resulting blastocysts were analyzed for modifications. There were no differences in the percentage of blastocysts that developed after injection by either MU Cas9 or Cas9 mRNA with the respective guides. Gene X had 16% vs. 14% blastocyst development and PAH had 10% vs. 9% blastocyst development for Cas9 and MU Cas9, respectively. There was also no difference in the percent of blastocysts modified by injection of either Cas9 mRNA with guides (Table 3).

Table 2.

PAH guide oligos and primer sequences used for genotyping single embryos.

Oligo or Primer	Sequence
gRNA1	GCTATGGCAGAACAAAACTA
gRNA2	GTCTACCGCCATCCAAGAAA
Forward	CTTGTCTTGCTTTCAGTTCTTC
Reverse	CACAGAACACGCCACTTAT

Table 3.

Analysis of gene modifications in blastocysts from zygote injections of commercially available Cas9 or MU Cas9 plus gRNAs.

	Proprietary Gene X			PAH
Cas9 Source	% of Blastocysts Modified ±SE		Number of Blastocysts Assayed	% of Blastocysts Modified ±SE		Number of Blastocysts Assayed
20 ng/μL Cas9	49%±8%	N=29		47%±5%	N=37
20 ng/μL MU Cas9	49%±9%	N=21		38%±14%	N=35

We also wanted to determine if a 5ʹ cap was needed for this mRNA to be functional. We injected the same four guide RNAs from experiment one and 20 ng/μl MU Cas9 mRNA_NC without a 5ʹ cap into zygotes. On day 7, blastocysts were collected and the gel shift assay showed that 18 of the 19 blastocysts collected were modified (94.7%). This illustrates the functionality of an un-capped Cas9 mRNA for use in zygote injections.

In summary, making Cas9 mRNA with a triple helical tail was efficient and results in genetic modification not different from commercial Cas9 mRNA. When injected into zygotes, there is no difference in blastocyst development compared to the commercial Cas9 mRNA at the same concentration. There is also no difference in the percent of modifications between the two sources of Cas9 mRNA, with the exception of the 80 ng/μl concentration where MU Cas9 mRNA had a higher rate. The successful generation of an alternative Cas9 mRNA provides an attractive one-step mRNA protocol for use in zygote injections.