Skip to main content
PMC home page
3 Biotech logoLink to 3 Biotech
. 2018 Nov 17;8(12):489. doi: 10.1007/s13205-018-1514-6

Antibiotic susceptibility profile of Pediococcus spp. from diverse sources

Varsha Singla 1,✉, Surajit Mandal 1,✉, Poonam Sharma 1, Santosh Anand 1, Sudhir Kumar Tomar 1
PMCID: PMC6240414  PMID: 30498662

Abstract

The aim of the present study was to assess the antibiotic susceptibility profile of Pediococcus strains from diverse sources. From a total of 115 dairy and non-dairy samples, 40 Pediococcus strains were isolated. Their biochemical and molecular characterization confirmed them as P. pentosaceus and P. acidilactici. All the 40 identified isolates were evaluated for antibiotic susceptibility using disc diffusion assay against a total of 20 antibiotics. The isolates exhibited varied range of responses towards the antibiotics depending on the strain type, source and location of isolation. All the isolates were either sensitive or intermediate resistant to amoxycillin, erythromycin, ceftriaxone, cloxacillin, cefoperazone, penicillin, netillin, gentamycin and chloramphenicol. Resistance towards vancomycin and nalidixic acid was exhibited by most of the isolates. A total of 16 strains belonging to dosa batter (n = 4; n = number of isolates), fermented vegetables (n = 4), fermented grape juice (n = 4), idly batter (n = 3) and the only isolate from butter milk exhibited sensitivity/intermediate towards 80–90% of the studied antibiotics. No considerable difference in susceptibility pattern was observed between the two Pediococcus species, i.e., P. pentosaceus and P. acidilactici. Overall, the maximum resistance was exhibited by isolates belonging to silage (Sil-2; 50%) followed by cow milk (PD-41), dosa batter (8-PD) and human isolate (PD-45) which showed resistance towards 40% of studied antibiotics. The susceptibility profiling of Pediococcus strains will be helpful in their safer selection for future food and feed applications.

Electronic supplementary material

The online version of this article (10.1007/s13205-018-1514-6) contains supplementary material, which is available to authorized users.

Keywords: Pediococcus, Antibiotics, Resistance, Lactic acid bacteria, Susceptibility, Food safety

Introduction

Lactic acid bacteria (LAB) are industrially important microorganisms because of long and safe history of their use for the production of numerous fermented and functional foods (Leroy and De Vuyst 2004; Rhee et al. 2011). Beside others, Pediococcus is one of the important LAB which divide alternatively in two perpendicular directions in a single plane to form peculiar tetrads. They are characterized as Gram-positive, catalase negative, non-motile, chemo-organotrophs and homofermentative (Singla et al. 2018). Pediococcus pentosaceus and P. acidilactici are among the two most widely occurring species in food and dairy environments (Banwo et al. 2013). Several technological aspects such as antimicrobial activity, phytase activity, galactose fermentation ability, exopolysaccharide (EPS) production, and flavor production make these cultures industrially useful microbes. Pediocin, the anti-listerian antimicrobial peptide produced by this particular genus is the most exploited trait allowing this organism to be used as a bio-preservative in food and dairy industry (Papagianni and Anastasiadou 2009). Beyond technological importance, strains of pediococci also act as safe probiotics (Singla et al. 2017). Due to this techno-functionality, pediococci are used either as starter, non-starter or adjunct probiotic cultures in vegetables, meat, sausages, silage, milk and milk products (Gurira and Buys 2005; Papagianni and Anastasiadou 2009; Yuksekdag and Aslim 2010; Garsa et al. 2014; Porto et al. 2017).

Resistance to antibiotics is an emerging food safety concern and the potential of bacteria to transfer the antibiotic resistance genes to pathogenic or commensal bacteria cannot be neglected. Hence, antibiotic sensitivity profiling of bacterial strains intended for their use as starter or probiotic cultures is considered as an important part of safety assessment (Sharma et al. 2014, 2016). European Food Safety Authority (EFSA) recommends that bacterial strains harboring transferable antibiotic resistance genes (acquired resistance) should not be used in animal feeds, fermented and probiotic foods for human use (EFSA 2007). Pediococci are mainly found to be susceptible to clinically important antibiotics, and no acquired resistance to these antimicrobials has been reported (Danielsen et al. 2007; Klare et al. 2007) and is also for multidrug resistivity (Cao et al. 2016; Gupta and Sharma 2017). Vancomycin resistance is widespread among pediococci, but fortunately, it is considered as intrinsic due to a modified precursor ending in D-Ala-D-lactate (Banwo et al. 2013). Similarly, resistance to aminoglycosides such as kanamycin, gentamicin and streptomycin is also an intrinsic property among Pediococcus spp. (Hummel et al. 2007). Penicillin, chloramphenicol and erythromycin are usually active antibiotics against Pediococcus spp. (Danielsen et al. 2007). Pediococci are generally considered as safe with regard to antibiotic susceptibility, yet each and every newly isolated strain should be well-assessed for antibiotic susceptibility prior to their applications in food and dairy products.

Previous studies (Ruiz-Moyano et al. 2010; Cao et al. 2016) have also reported the susceptibility pattern of Pediococcus spp., but a comprehensive evaluation of a large number (40) of Pediococcus strains of diverse origins against as many as 20 antibiotics is scarce. Therefore, the present study was focused on isolating and characterizing Pediococcus spp. from dairy and non-dairy sources, and assessing their antibiotic susceptibility pattern. Thus, the outcome of the present investigation will enable the selection of Pediococcus strains for their future intended applications.

Materials and methods

Isolation and characterization of Pediococcus spp.

A total of 115 samples comprising fermented batter of dosa, idli, kadhi, jalebi, raabdi, uttapam; pickles; dairy products including cow milk, buffalo milk, cheese, curd and cream were collected from hostels of Indian Council of Agricultural research-National Dairy Research Institute (ICAR-NDRI), Karnal, Institute’s Experimental Dairy Plant, local market, household preparations, rural and urban areas of Karnal, and also from Delhi, Hisar and Jind, India. Silage samples were collected from cattle yard, ICAR-NDRI, Karnal; human feces and human milk, from voluntaries of ICAR-NDRI, Karnal; fermented vegetables (cabbage and carrot) and fermented grape juices were prepared in our laboratory. Samples were collected in sterile sample bottles (HiMedia, Mumbai, India). Serial dilutions of the processed samples were prepared in normal saline (0.85% NaCl). Appropriate dilutions were pour plated using de Mann Rogosa Sharpe (MRS) agar medium and incubated at 37 °C for 48–72 h. Typical smooth, round, grayish-white colonies were randomly picked up, transferred to MRS broth and incubated at 37 °C for 18–24 h. After incubation, all the isolates were examined under microscope (100×) for morphology.

Gram-positive cocci in pairs/tetrads were further subjected to a series of physiological tests. Catalase, pseudocatalase, oxidase, arginine hydrolysis, hetero-fermentation tests, growth at different temperatures (30, 37, 42 and 50 °C), growth at different pH values (4.2, 6.5, 8.5 and 9.6) and growth at different salt concentrations (4, 6.5, 10 and 15% NaCl) were conducted for the preliminary characterization of the isolates. Hetero-fermentation test was performed in MRS broth with immersed inverted Durham’s tubes (Muller 1990). For pseudocatalase test, active cultures were streaked on low glucose agar plates and incubated at 37 °C for 48–72 h. Plates were then flooded with 5 mL of 3% hydrogen peroxide (Sigma-Aldrich, USA). The presence of effervescence indicated positive for pseudocatalase activity (Felton et al. 1953). Oxidase test was performed by rubbing the activated cultures on oxidase disc (HiMedia, India). Development of purple blue color indicated a positive reaction. Hydrolysis of arginine was examined by inoculating the active cultures in arginine broth and incubated at 37 °C for 24–48 h. Release of ammonia from arginine was tested by adding 1 mL of Nessler’s reagent (HiMedia, India). Appearance of orange-brown to brick-red color was considered positive for arginine hydrolysis (Hitchener et al. 1982). Putative Pediococcus isolates based on morphology and physiological examination were biochemically identified by carbohydrate fermentation pattern using APi 50CH test kits (bioMerieux, France; Singla et al. 2018).

Molecular confirmation of isolated Pediococcus strains

Biochemically identified Pediococcus isolates were further subjected to molecular characterization by polymerase chain reaction (PCR). DNA was extracted following the protocol of Pospiech and Neumann (1995). Extracted DNA was electrophoresed in 0.8% (w/v) agarose gel and was visualized with ultraviolet (UV) illumination. The isolated DNA of each strain was used to perform PCR using genus and species-specific forward and reverse oligonucleotide primers (Table 1) purchased from Sigma-Aldrich (Pfannebecker and Frohlich 2008). First, the genus-specific PCR was performed. After the confirmation of Pediococcus genus, PCR was carried out for species level identification. The sequences of primers and the corresponding PCR cycles are given in Table 1. PCR was performed in thermocycler (Eppendorf Master cycler, Germany) and the amplified products were separated on 1–2% (w/v) agarose gel depending on the product size in electrophoretic unit (Thermo Scientific, Schwerte, Germany). Subsequently, gels were examined using gel Doc system (Alpha Innotech Corp, Santa Clara, C, USA) and photographed using AlphaView SA software.

Table 1.

Genus and species-specific primers and PCR cycling conditions for identification of Pediococcus spp

Organism Primers Primer sequence (5–3′) PCR cycle conditions Amplicon size (bp) Reference
Genus Pediococcus Pedio23S_F –GAACTCGTGTACGTTGAAAAGTGCTGA– 95°C/5 min, 94 °C/30 s, 69.5 °C/30 s, 72 °C/30 s, 72°C/5 min, 32 cycles 701 Pfannebecker and Frohlich 2008
Pedio23S_R –GCGTCCCTCCATTGTTCAAACAAG–
P. pentosaceus PPE23S_F –CCAGGTTGAAGGTGCAGTAAAAT– 95 °C/15 min, 94 °C/30 s, 66°C/1 min, 72°C/1 min, 72 °C/10 min, 22 cycles 1647
P23S_R –CTGTCTCGCAGTCAAGCTC–
P. acidilactici PAC23S_F –GTTTCGGAGGAGGCGCAA– 95 °C/15 min, 94 °C/30 s, 66°C/1 min, 72°C/1 min, 72 °C/10 min, 22 cycles 213
P23S_R –CTGTCTCGCAGTCAAGCTC–
Open in a new tab

Antibiotic sensitivity assay

Disc diffusion method was used to obtain antibiograms of isolated Pediococcus strains following the modified standard Kirby–Bauer procedure (Rojo-Bezares et al. 2006). Antibiotic susceptibility pattern of isolated pediococci was assessed using commercially available antibiotic discs (HiMedia, Mumbai, India) having 20 antibiotics including amikacin (30 µg), ampicillin (10 µg), amoxycillin (10 µg), cefadroxil (30 µg), cefoperazone (75 µg), ceftazidime (30 µg), ceftriaxone (30 µg), chloramphenicol (30 µg), ciprofloxacin (5 µg), cloxacillin (1 µg), co-trimoxazole (25 µg), erythromycin (15 µg), gentamicin (10 µg), nalidixic acid (10 µg), netillin (10 µg), nitrofurantoin (300 µg), norfloxacin (10 µg), penicillin (10 units), tobramycin (10 µg) and vancomycin (30 µg). MRS agar plates were prepared and overlaid with 50 mL of MRS soft agar tempered at 45 °C and seeded with 100 µL of active Pediococcus cultures (cell density @ 108 cfu/mL). Plates were allowed to stand at room temperature for 15–20 min and then the antibiotic discs were dispensed onto the seeded agar plates under aseptic conditions. Inhibition zone diameters (mm) were measured using antibiotic zone scale after incubation at 37 °C for 24 h. Results were expressed in terms of resistant (R), intermediate resistant (IR) or susceptible (S) with zone diameter of ≤ 14, 15–19 and ≥ 20 mm, respectively, as per recommended standards given by Clinical and Laboratory Standards Institute (CLSI 2012) described by Charteris et al. (2000).

Results and discussion

Isolation and identification of Pediococcus spp.

A total 40 Pediococcus strains were isolated from 115 different dairy and non-dairy samples (Table 2). The sample-wise distribution of pediococci in our study were as follows: dosa batter (n = 14; n = number of Pediococcus isolates), idli batter (n = 7), fermented vegetables (cabbage: n = 5; carrot: n = 2), fermented grape juice (n = 4), pickle (n = 2), silage (n = 2), cow milk (n = 1), buffalo milk (n = 1), butter milk (n = 1) and human feces (n = 1). Out of 40 isolates, 36 belonged to non-dairy sources, while 3 were from dairy environment and one from human fecal sample (Table 2). Pediococci mainly inhabit fermentable sugar-rich niches such as plant materials and fermented food products including idli, dosa, fermented vegetable, pickle, silage, kimchi, etc. (Cai et al. 1999; Kleinschmit and Kung 2006; Vidhyasagar and Jeevaratnam 2012; Belhadj et al. 2014; Monika et al. 2017; Narayanan et al. 2017). The relatively lesser occurrence of pediococci in milk and milk products like in our study may be due to their poor growth in milk (Somkuti and Steinberg 2010). Isolation of few pediococci has also been reported from human sources (Uymaz et al. 2009; Osmanagaoglu et al. 2010).

Table 2.

Characterization of Pediococcus isolates

S. no. Isolates Source of isolation Microscopic observation Catalase test Pseudocatalase test Oxidase test Gas production from glucose Arginine hydrolysis Growth at different temperatures (0C) Growth at different pH Growth at different salt concentrations (%) Identified isolates
30 37 42 50 4.2 6.5 8.5 9.6 4 6.5 10 15
1 PD-1 Dosa batter, girls’ hostel, NDRI Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
2 PD-2 Dosa batter, girls’ hostel, NDRI Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
3 PD-3 Dosa batter, boys’ hostel, NDRI, Karnal Gram -positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
4 PD-4 Dosa batter, boys’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
5 PD-7 Butter milk, household, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
6 PD-8 Idli batter, boys’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
7 PD-10 Idli batter, girls’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
8 PD-13 Pickle, household, Hisar Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
9 PD-14 Dosa batter, local market, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
10 PD-16 Pickle, house hold, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
11 PD-18 Dosa batter, local market, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
12 PD-19 Dosa batter, local market Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
13 PD-20 Dosa batter, girls’ hostel, NDRI Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
14 PD-21 Dosa batter, local market, Jind Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
15 PD-22 Dosa batter, local market, Jind Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
16 PD-24 Idli batter, local market, Karnal Gram-positive Cocci in P&T − + (weakly) − − + + + + − + + + − + + − − P. pentosaceus
17 PD-25 Dosa batter, local market, Delhi Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
18 PD-26 Idli batter, local market, Hisar Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
19 PD-27 Idli batter, local market, Hisar Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
20 PD-28 Fermented vegetable (cabbage) prepared in lab NDRI, Karnal Gram-positive Cocci in P&T − + (weakly) − − + + + + − + + + − + + − − P. pentosaceus
21 PD-29 Fermented vegetable (cabbage) prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
22 PD-30 Fermented vegetable (cabbage) prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
23 PD-31 Fermented vegetable (cabbage) prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
24 PD-32 Fermented vegetable (carrot) prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
25 PD-33 Fermented vegetable (carrot) prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
26 PD-34 Fermented vegetable (cabbage) prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
27 PD-35 Fermented grape juice, prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
28 PD-36 Fermented grape juice, prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
29 PD-37 Fermented grape juice, prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
30 PD-38 Dosa batter, local market, Delhi Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
31 PD-39 Fermented grape juice, prepared in lab, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
32 PD-41 Cow milk, cattle yard Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
33 PD-44 Buffalo milk, local market, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
34 PD-45 Human feces, voluntaries from NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + + + + + − + + − − P. acidilactici
35 8-PD Dosa batter, boys’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − − − − + + + + − + + + − + + − − P. pentosaceus
36 14-PD Dosa batter, boys’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
37 25-PD Idli batter, girls’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
38 42-PD Idli batter, girls’ hostel, NDRI, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
39 Sil-1 Silage, cattle yard, NDRI, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
40 Sil-2 Silage, cattle yard, NDRI, Karnal Gram-positive Cocci in P&T − + − − + + + + − + + + − + + − − P. pentosaceus
Open in a new tab

*P&T Pairs and Tetrads

All the isolates were Gram-positive cocci occurring in pairs and tetrads, catalase and oxidase negative and homofermentative, displaying the feature of pediococci (Table 2; Simpson and Taguchi 1995). As pediococci are the only LAB that divide alternatively in two perpendicular directions in a single plane to form tetrads, morphological characterization plays a significant role in their easy identification at very early stage of isolation procedure (Singla et al. 2017). Pediococcus spp. exhibit variations in physiological and biochemical characteristics which can be used for their identification purpose (Papagianni and Anastasiadou 2009). All the strains were positive for arginine hydrolysis. Ten isolates (PD-2, PD-3, PD-4, PD-25, PD-44, 14-PD, 25-PD, 42-PD, Sil-1 and Sil-2) were pseudocatalase positive; while other two isolates (PD-24 and PD-28) exhibited weak reaction (Table 2). Strain specific pseudocatalase activity in low carbohydrate media has been reported in pediococci (Korasapati 1998). All the isolates showed appreciable growth at 30, 37 and 42 °C temperature, while only one isolate (PD-45) could grow at 50 °C. All the strains were capable to grow at pH 4.2, 6.5 and 8.5, and 4 and 6.5% NaCl, but not at pH 9.6, and 10% NaCl (Table 2). The isolates were further characterized for sugar fermentation using the analytical profile index (API). Thirty-nine isolates were biochemically (APi 50CH kit) identified as P. pentosaceus and one (PD-45) belonged to P. acidilactici (Table S1; Singla et al. 2018). Pediococcus pentosaceus and P. acidilactici are the two most common and industrially important species (Danielsen et al. 2007). Phylogenetically, they are very closely related to each other. Physiologically, fermentation of maltose and growth at 50 °C is the key differentiating characteristics among these species which is in agreement with the present investigation, where only P. acidilactici (PD-45; human fecal isolate) could grow at 50 °C and not able to ferment maltose (Table 2; Holzapfel et al. 2006).

All the Pediococcus isolates yielded 701 bp amplicon while performing genus-specific PCR (Fig. S1). Species identity was also confirmed at molecular level using species-specific primers. Thirty-nine isolates resulted into 1647 bp product, while one isolate (PD-45) yielded 213 bp amplicon (Fig. S2; Pfannebecker and Frohlich 2008), which confirmed their identity as P. pentosaceus and P. acidilactici, respectively, as similar with biochemical identification (Table 2; Fig. S2). All the 40 identified cultures were deposited in National Collection of Dairy cultures (NCDC)-ICAR NDRI, Karnal having accession numbers NCDC 867–906.

Antibiotic susceptibility

All the 40 Pediococcus strains were screened for their antibiotic sensitivity using disc diffusion soft agar overlay assay. Based on the inhibition zone, varied range of responses by tested Pediococcus cultures from different sources was observed against different antibiotics (Tables 3, 4; Fig. S3). All the strains also showed variations in terms of the degree of resistance towards the same antibiotic (Tables 3, 4). Lactic acid bacteria are generally considered as safe, but due to their high consumption, there is a need to put sufficient safeguards to protect the consumers from any adverse effects. The safety of these strains is becoming prerequisite with antibiotic resistance as an emerging issue (Hummel et al. 2007). FAO/WHO guidelines have strongly recommended antibiotic susceptibility pattern of every probiotic strain prior to their consumption or applications in food (FAO/WHO 2002).

Table 3.

Antibiotic susceptibility patterns of Pediococcus strains

S. no. Isolates Antibiotics (concentration)
Quinolones β-lactams Aminoglycosides
Nx (10 µg) CIP (5 µg) NA (10 µg) Amx (10 µg) Amp (10 µg) Cox (1 µg) P (10 units) NET (10 µg) TOB (10 µg) GEN (10 µg) Ak (30 µg)
1 P. pentosaceus
PD-1		 0 14 0 22 21 18 22 19 16 18 12
2 P. pentosaceus
PD-2		 10 20 0 27 15 20 34 27 22 26 21
3 P. pentosaceus
PD-3		 14 15 0 25 24 22 25 20 13 18 15
4 P. pentosaceus
PD-4		 12 13 0 24 25 23 26 16 15 15 10
5 P. pentosaceus
PD-7		 > 40 0 0 > 40 > 40 39 26 22 10 26 > 40
6 P. pentosaceus
PD-8		 0 15 0 22 20 26 31 24 21 21 17
7 P. pentosaceus
PD-10		 15 14 0 23 13 24 25 24 21 23 23
8 P. pentosaceus
PD-13		 11 16 0 22 26 23 28 27 27 26 24
9 P. pentosaceus
PD-14		 15 15 0 29 11 23 32 28 23 23 20
10 P. pentosaceus
PD-16		 13 16 0 22 15 22 33 26 23 23 23
11 P. pentosaceus
PD-18		 19 15 0 23 12 20 33 26 23 27 22
12 P. pentosaceus
PD-19		 16 15 0 21 26 18 30 29 26 27 23
13 P. pentosaceus
PD-20		 21 16 0 34 30 24 29 32 27 30 23
14 P. pentosaceus
PD-21		 31 16 0 38 39 36 38 27 20 26 27
15 P. pentosaceus
PD-22		 19 22 0 25 13 30 39 33 29 31 27
16 P. pentosaceus
PD-24		 10 11 0 22 12 22 24 29 23 27 19
17 P. pentosaceus
PD-25		 17 18 0 21 17 31 40 34 27 30 27
18 P. pentosaceus
PD-26		 20 16 0 16 12 24 36 31 27 29 23
19 P. pentosaceus
PD-27		 30 21 0 36 34 33 37 29 20 24 20
20 P. pentosaceus
PD-28		 29 10 0 37 36 28 35 27 24 30 23
21 P. pentosaceus
PD-29		 20 25 0 35 35 28 31 30 27 28 21
22 P. pentosaceus
PD-30		 19 19 0 34 28 24 > 40 28 27 26 22
23 P. pentosaceus
PD-31		 26 18 0 40 32 28 29 31 27 26 24
24 P. pentosaceus
PD-32		 29 14 0 36 31 28 34 29 24 26 23
25 P. pentosaceus
PD-33		 24 17 0 30 29 31 31 33 25 31 24
26 P. pentosaceus
PD-34		 26 18 0 38 33 37 37 31 31 27 24
27 P. pentosaceus
PD-35		 27 17 0 35 34 34 33 30 28 27 25
28 P. pentosaceus
PD-36		 33 16 0 35 33 32 > 40 26 21 29 21
29 P. pentosaceus
PD-37		 30 17 0 35 38 33 37 33 24 28 24
30 P. pentosaceus
PD-38		 29 25 0 29 29 34 38 34 26 28 27
31 P. pentosaceus
PD-39		 24 18 0 32 30 25 30 29 24 24 21
32 P. pentosaceus
PD-41		 0 12 0 18 11 23 34 28 22 27 18
33 P. pentosaceus
PD-44		 0 17 0 18 13 18 24 25 20 22 18
34 P. acidilactici
PD-45		 10 11 0 25 10 27 37 26 30 23 24
35 P. pentosaceus
8-PD		 11 15 0 23 20 20 24 20 14 16 12
36 P. pentosaceus
14-PD		 19 10 0 28 25 24 34 26 24 24 24
37 P. pentosaceus
25-PD		 0 14 0 31 28 28 32 29 24 28 22
38 P. pentosaceus
42-PD		 16 18 0 29 29 24 34 25 24 25 19
39 P. pentosaceus
Sil-1		 0 16 0 26 22 21 22 19 16 20 14
40 P. pentosaceus
Sil-2		 0 0 0 22 19 18 21 19 14 19 11
Open in a new tab

Nx norfloxacin, CIP ciprofloxacin, NA nalidixic acid, Amx amoxycillin, Amp ampicillin, Cox cloxacillin, P penicillin, NET netillin, TOB tobramycin, GEN gentamicin, Ak amikacin

Zero (0) represents no zone of inhibition

Table 4.

Antibiotic susceptibility patterns of Pediococcus strains

S. No. Isolates Antibiotics (concentration)
Cephalosporins Macrolides Glycopeptides Sulfonamides Azolidione Others
CFR (30 µg) CTR (30 µg) CPZ (75 µg) Caz (30 µg) E (15 µg) VA (30 µg) Cot (25 µg) NIT (300 µg) C (30 µg)
1 P. pentosaceus
PD-1		 0 20 20 17 25 0 0 18 30
2 P. pentosaceus
PD-2		 0 29 27 18 30 10 0 22 33
3 P. pentosaceus
PD-3		 20 25 22 16 26 0 0 16 30
4 P. pentosaceus
PD-4		 14 22 24 17 28 0 0 18 31
5 P. pentosaceus
PD-7		 18 31 40 > 40 > 40 0 > 40 22 > 40
6 P. pentosaceus
PD-8		 15 24 31 18 29 0 0 24 36
7 P. pentosaceus
PD-10		 14 25 28 0 28 10 0 21 32
8 P. pentosaceus
PD-13		 0 24 26 21 32 0 0 22 40
9 P. pentosaceus
PD-14		 0 23 26 11 32 0 0 19 32
10 P. pentosaceus
PD-16		 12 24 29 0 32 0 0 20 37
11 P. pentosaceus
PD-18		 0 21 29 0 33 0 0 20 35
12 P. pentosaceus
PD-19		 0 23 23 0 34 0 0 27 32
13 P. pentosaceus
PD-20		 14 27 24 21 34 10 0 19 37
14 P. pentosaceus
PD-21		 18 27 30 28 35 10 0 23 36
15 P. pentosaceus
PD-22		 0 31 35 0 34 10 0 21 > 40
16 P. pentosaceus
PD-24		 21 28 29 0 31 10 10 20 36
17 P. pentosaceus
PD-25		 0 30 21 21 40 10 0 20 40
18 P. pentosaceus
PD-26		 19 31 28 0 33 10 0 17 39
19 P. pentosaceus
PD-27		 22 30 32 27 34 0 0 20 38
20 P. pentosaceus
PD-28		 10 25 28 25 35 0 10 18 > 40
21 P. pentosaceus
PD-29		 22 28 31 20 35 0 0 24 > 40
22 P. pentosaceus
PD-30		 19 24 33 20 32 10 0 19 38
23 P. pentosaceus
PD-31		 11 28 28 22 37 0 0 21 36
24 P. pentosaceus
PD-32		 10 24 28 22 34 10 0 22 40
25 P. pentosaceus
PD-33		 15 28 31 22 34 10 0 31 > 40
26 P. pentosaceus
PD-34		 14 28 37 28 34 0 0 25 > 40
27 P. pentosaceus
PD-35		 16 30 33 25 35 10 0 25 38
28 P. pentosaceus
PD-36		 22 29 32 27 33 0 19 21 37
29 P. pentosaceus
PD-37		 24 29 31 31 37 0 11 21 36
30 P. pentosaceus
PD-38		 24 32 32 20 34 0 10 24 39
31 P. pentosaceus
PD-39		 18 24 25 21 35 17 0 22 39
32 P. pentosaceus
PD-41		 0 26 23 0 31 10 0 16 35
33 P. pentosaceus
PD-44		 20 26 23 18 29 0 0 16 29
34 P. acidilactici
PD-45		 0 29 26 0 33 0 0 19 40
35 P. pentosaceus
8-PD		 0 20 20 10 30 0 0 17 31
36 P. pentosaceus
14-PD		 0 24 23 18 33 0 0 21 36
37 P. pentosaceus
25-PD		 22 28 30 23 32 0 0 22 37
38 P. pentosaceus
42-PD		 17 30 24 22 30 0 0 23 33
39 P. pentosaceus
Sil-1		 20 24 18 12 29 0 0 0 28
40 P. pentosaceus
Sil-2		 14 18 17 11 25 0 0 0 30
Open in a new tab

CFR cefadroxil, CTR ceftriaxone, CPZ cefoperazone, Caz ceftazidime, E erythromycin, VA vancomycin, Cot Co-Trimoxazole, NIT nitrofurantoin, C chloramphenicol

Zero (0) represents no zone of inhibition

All the studied 40 isolates irrespective of their source of isolation, location and species were completely sensitive to penicillin, chloramphenicol and erythromycin (Tables 3, 4). Earlier studies also supported that these antibiotics are usually active against Pediococcus spp. (Temmerman et al. 2003; Ruiz-Moyano et al. 2010; Ribeiro et al. 2014). Contrary to this, resistance to erythromycin by Pediococcus spp. although at very low frequency has also been reported (Danielsen et al. 2007). Uymaz et al. (2009) reported that a human isolate P. pentosaceus BH105 was sensitive to penicillin and chloramphenicol while resistant towards erythromycin. Most of the isolates in our study exhibited sensitivity towards cell-wall inhibitor β-lactam group of antibiotics (penicillin: 100%, amoxycillin: 92.5%, cloxacillin: 90%, ampicillin: 67.5%; Table 3) and protein synthesis inhibitors, aminoglycosides (netillin: 90%, tobramycin: 82.5%, gentamicin: 87.5% and amikacin: 72.5%; Table 3). None of the isolate from any source was completely resistant towards amoxycillin and cloxacillin; however, 3 (PD-26: idly batter; PD-41: cow milk; PD-44: buffalo milk) and 4 (PD-1 and PD-19: dosa batter; PD-44: buffalo milk; Sil-2: silage) isolates were intermediate resistant towards these antibiotics, respectively. Isolates belonging to butter milk, fermented vegetables and fermented grape juice were sensitive to ampicillin (Table 3). Sensitivity towards ampicillin (Venkateshwari et al. 2010), amoxycillin (Ribeiro et al. 2014) and penicillin (Mandal et al. 2011) from diverse sources has been well-reported. No isolate was completely resistant towards netillin and gentamycin; however, two isolates from dosa batter (PD-3 and 8-PD), one from silage (Sil-2) and the only isolate from butter milk (PD-7) showed resistance towards tobramycin. Only 12.5% of total isolates (3 from dosa batter: PD-1, PD-4, 8-PD, and both isolates from silage) were resistant towards amikacin (Table 3). Sensitivity towards these antibiotics is well-reported (Venkateshwari et al. 2010; Cao et al. 2016). A low level of resistance was exhibited against tobramycin (10% isolates) and amikacin (12.5% isolates) (Table 3). Although at a low level, the resistance towards aminoglycosides may not be a threat as it is considered intrinsic in LAB including pediococci (Charteris et al. 2001).

The class cephalosporin disrupts the synthesis of peptidoglycan layer of bacterial cell walls. A varied response was exhibited by the isolates towards this group of antibiotics. None of the isolates was completely resistant towards ceftriaxone and cefoperazone. Interestingly, at a very low frequency, intermediate resistivity against these antibiotics was shown by silage isolates only (Table 4). Comparatively, higher resistance towards cefadroxil (52.5% isolates) and ceftazidime (32.5% isolates) was observed. Isolates from the dosa batter exhibited the maximum variations (sensitivity, intermediate resistivity and complete resistance) against cefadroxil and ceftazidime. Similar to our study (PD-45: human fecal isolate), Uymaz et al. (2009) also reported sensitivity towards ceftriaxone, while the human isolate P. pentosaceus strain BH105 showed resistance against ceftazidime.

All the Pediococcus strains except the only isolate from butter milk, and PD-36 (fermented grape juice) were resistant towards co-trimoxazole (sulphonamide; inhibitor of nucleic acid synthesis). Mandal et al. (2011) demonstrated the gene location of co-trimoxazole resistance on chromosomes which reflects intrinsic resistance towards this antibiotic. Gupta and Sharma (2017) also reported co-trimoxazole resistance by P. acidilactici strain Ch-2. In tune with the previous study (Sukumar and Ghosh 2010), the current study also revealed that all the isolates were resistant towards nalidixic acid, a member of quinolones which interferes with bacterial DNA synthesis. However, 37.5 and 30% isolates showed resistance towards norfloxacin and ciprofloxacin (quinolones), respectively (Table 4). The maximum variability (sensitivity, intermediate resistivity and complete resistance) was displayed by dosa and idly batter isolates towards norfloxacin and ciprofloxacin.

Except an isolate PD-39 (fermented grape juice), all the strains were highly resistant to vancomycin. Vancomycin is the representative of glycopeptide class of antibiotics which is active against most of the Gram-positive bacteria. Vancomycin resistance is of major concern, as vancomycin is considered as one of the last antibiotics in the treatment of multidrug-resistant pathogens (Bernardeau et al. 2008). Reports also favored the widespread vancomycin resistance among LAB, but fortunately, it is non-transferable in case of pediococci (Toomey et al. 2010; Banwo et al. 2013). A high level of glycopeptide resistance has been reported for Pediococcus and other LAB (Zarazaga et al. 1999). Intrinsic resistance of LAB to several antibiotics might be considered advantageous as such resistance could be helpful for sustainable utilization of the strains in human intestine to maintain the equilibrium of intestinal microbiota during antibiotic therapy (Ketema et al. 2010).

With regard to antibiotic susceptibility, no considerable/remarkable difference was observed between the two studied Pediococcus species, i.e., P. pentosaceus and P. acidilactici (Tables 3, 4). A total 16 strains belonging to dosa batter (4; PD-20, PD-21, PD-25, PD-38), fermented vegetables (4; PD-30, PD-31, PD-33, PD-34), fermented grape juice (4; PD-35, PD-36, PD-37, PD-39), idly batter (3; PD-8, PD-27, 42-PD) and butter milk (PD-7) exhibited sensitivity/intermediate resistance towards 80–90% of the studied antibiotics. Among them, six strains (PD-7, PD-8, PD-20, PD-25, PD-31 and PD-34) were sensitive/intermediate resistant towards 80%; while eight strains (PD-21, PD-27, PD-30, PD-33, PD-35, PD-37, PD-38 and 42-PD) to 85%, and two strains (fermented grape juice; PD-36 and PD-39) to as many as 90% of antibiotics (Tables 3, 4). Overall, the maximum resistance was exhibited by isolates belonging to silage (Sil-2; 50%) followed by cow milk (PD-41), dosa batter (8-PD) and human isolate (PD-45) which showed resistance towards 40% of studied antibiotics (Tables 3, 4).

Conclusions

The increased use of LAB as starter, adjunct and non-starter for their application in food products necessitates their safety check. In this regard, the performance of antimicrobial susceptibility testing might be considered as an essential selection criterion for starter as well as probiotic cultures. The results of the present study demonstrated varied responses of susceptibility among Pediococcus isolates depending on the strain type, source and location of isolations as well as tested antibiotics. The fact that Pediococcus strains gave different responses to the assayed antibiotics demonstrates the importance of individually testing strains for their intended application. Despite this, from the safety point of view, if a bacterial strain exhibits resistance to antimicrobials by phenotypic methods, it should be further evaluated for the molecular mechanisms.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary material 1 (DOCX 368 KB) (368.4KB, docx)

Compliance with ethical standards

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Contributor Information

Varsha Singla, Phone: + 91-184-2259183, Email: varshagarg9@gmail.com.

Surajit Mandal, Email: mandalndri@rediffmail.com.

References

  1. Banwo K, Sanni A, Tan H. Functional properties of Pediococcus species isolated from traditional fermented cereal gruel and milk in Nigeria. Food Biotechnol. 2013;27:14–38. doi: 10.1080/08905436.2012.755626. [DOI] [Google Scholar]
  2. Belhadj H, Harzallah D, Bouamra D, Khennouf S, Dahamna S, Ghadbane M. Phenotypic and genotypic characterization of some lactic acid bacteria isolated from bee pollen: a preliminary study. Biosci Microb Food Health. 2014;33:11–23. doi: 10.12938/bmfh.33.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bernardeau M, Vernoux JP, Henri-Dubernet S, Gueguen M. Safety assessment of dairy microorganisms: the Lactobacillus genus. Int J Food Microbiol. 2008;126:278–285. doi: 10.1016/j.ijfoodmicro.2007.08.015. [DOI] [PubMed] [Google Scholar]
  4. Cai Y, Kumai S, Ogawa M, Benno Y, Nakase T. Characterization and Identification of Pediococcus species isolated from forage crops and their application for silage preparation. Appl Environ Microbiol. 1999;65:2901–2906. doi: 10.1128/aem.65.7.2901-2906.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao Z, Pan H, Tong H, Gu D, Li S, Xu Y, Ge C, Lin Q. In vitro evaluation of probiotic potential of Pediococcus pentosaceus L1 isolated from paocai—a Chinese fermented vegetable. Ann Microbiol. 2016;66:963–971. doi: 10.1007/s13213-015-1182-2. [DOI] [Google Scholar]
  6. Charteris WP, Kelly PM, Morelli L, Collins JK. Effect of conjugated bile salts on antibiotic susceptibility of bile salt–tolerant Lactobacillus and Bifidobacterium isolates. J Food Prot. 2000;63:1369–1376. doi: 10.4315/0362-028X-63.10.1369. [DOI] [PubMed] [Google Scholar]
  7. Charteris WP, Kelley PM, Morelli L, Collins JK. Gradient diffusion antibiotic susceptibility testing of potentially probiotic lactobacilli. J Food Prot. 2001;64:2007–2014. doi: 10.4315/0362-028X-64.12.2007. [DOI] [PubMed] [Google Scholar]
  8. Clinical and Laboratory Standards Institute (2012) Performance standards for antimicrobial susceptibility testing: twenty-second informational supplement. CLSI Document M100-S22, Clinical Laboratory Standard Institute, Wayne, PA. ISBN 1-56238-785-5, (Print); ISBN 1-56238-786-3 (Electronic)
  9. Danielsen M, Simpson PJ, O’connor EB, Ross RP, Stanton C. Susceptibility of Pediococcus spp. to antimicrobial agents. J Appl Microbiol. 2007;102:384–389. doi: 10.1111/j.1365-2672.2006.03097.x. [DOI] [PubMed] [Google Scholar]
  10. European Food Safety Authority Opinion of the scientific committee on a request from EFSA on the introduction of a qualified presumption of safety (QPS) approach for assessment of selected microorganisms referred to EFSA. EFSA J. 2007;187:1–16. [Google Scholar]
  11. FAO/WHO (2002) Report of a Joint FAO/WHO Working Group on drafting guidelines for the evaluation of probiotics in food. ftp://ftp.fao.org/es/esn/food/wgreport2.pdf
  12. Felton EA, Evans JB, Niven CF., Jr. Production of catalase by the pediococci. J Bacteriol. 1953;65:481. doi: 10.1128/jb.65.4.481-482.1953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Garsa AK, Kumariya R, Kumar A, Lather P, Kapila S, Sood SK, Kapasiya M. In vitro evaluation of the probiotic attributes of two pediococci strains producing pediocin PA-1 with selective potency as compared to nisin. Eur Food Res Technol. 2014;239:491–499. doi: 10.1007/s00217-014-2243-7. [DOI] [Google Scholar]
  14. Gupta A, Sharma N. Characterization of potential probiotic lactic acid bacteria-Pediococcus acidilactici Ch-2 isolated from Chuli-A traditional apricot product of Himalayan region for the production of novel bioactive compounds with special therapeutic properties. J Food: Microbiol Saf Hyg. 2017;2:119. [Google Scholar]
  15. Gurira OZ, Buys EM. Characterization and antimicrobial activity of Pediococcus species isolated from South African farm-style cheese. Food Microbiol. 2005;22:159–168. doi: 10.1016/j.fm.2004.08.001. [DOI] [Google Scholar]
  16. Hitchener BJ, Egan AF, Rogers PJ. Characteristics of lactic acid bacteria isolated from vacuum-packaged beef. J Appl Microbiol. 1982;52:31–37. doi: 10.1111/j.1365-2672.1982.tb04369.x. [DOI] [PubMed] [Google Scholar]
  17. Holzapfel WH, Franz CM, Ludwig W, Back W, Dicks LM. The Prokaryotes. New York: Springer; 2006. The genera Pediococcus and Tetragenococcus; pp. 229–266. [Google Scholar]
  18. Hummel AS, Hertel C, Holzapfel WH, Franz CM. Antibiotic resistances of starter and probiotic strains of lactic acid bacteria. Appl Environ Microbiol. 2007;73:730–739. doi: 10.1128/AEM.02105-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ketema B, Tetemke M, Mogessie A. Antibiotic susceptibility patterns of LAB isolated from Wakalim, a traditional Ethiopian fermented beef sausage. J Food Saf. 2010;30:213–223. doi: 10.1111/j.1745-4565.2009.00201.x. [DOI] [Google Scholar]
  20. Klare I, Konstabel C, Werner G, Huys G, Vankerckhoven V, Kahlmeter G. Antimicrobial susceptibilities of Lactobacillus, Pediococcus and Lactococcus human isolates and cultures intended for probiotic or nutritional use. J Antimicrob Chemother. 2007;59:900–912. doi: 10.1093/jac/dkm035. [DOI] [PubMed] [Google Scholar]
  21. Kleinschmit DH, Kung L. The effects of Lactobacillus buchneri 40788 and Pediococcus pentosaceus R1094 on the fermentation of corn silage. J Dairy Sci. 2006;89:3999–4004. doi: 10.3168/jds.S0022-0302(06)72443-2. [DOI] [PubMed] [Google Scholar]
  22. Korasapati NR (1998) Genetic and biochemical characterization of bacteriocin produced by a selected Pediococcus sp. Dissertation, National Dairy Research Institute, India
  23. Leroy F, De Vuyst L. Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends Food Sci Technol. 2004;15:67–78. doi: 10.1016/j.tifs.2003.09.004. [DOI] [Google Scholar]
  24. Mandal V, Sen SK, Mandal NC. Isolation and characterization of pediocin NV 5 producing Pediococcus acidilactici LAB 5 from vacuum-packed fermented meat product. Indian J Microbiol. 2011;51:22–29. doi: 10.1007/s12088-011-0070-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Monika S, Kumar V, Kumari A, Angmo K, Bhalla TC. Isolation and characterization of lactic acid bacteria from traditional pickles of Himachal Pradesh, India. J Food Sci Technol. 2017;54:1945–1952. doi: 10.1007/s13197-017-2629-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Muller T. Comparison of methods for differentiation between homofermentative and heterofermentative lactic acid bacteria. Zentralblatt Für Mikrobiologie. 1990;145:363–366. [Google Scholar]
  27. Narayanan R, Sumanth GK, Chowdary R, Jyothi CP. In vitro study of potential probiotic Pediococcus pentosaceus isolated from idli batter and biomass production using whey. Int J Food Nutr Sci. 2017;6:34–45. [Google Scholar]
  28. Osmanagaoglu O, Kiran F, Ataoglu H. Evaluation of in vitro probiotic potential of Pediococcus pentosaceus OZF isolated from human breast milk. Probiot Antimicrob Proteins. 2010;2:162–174. doi: 10.1007/s12602-010-9050-7. [DOI] [PubMed] [Google Scholar]
  29. Papagianni M, Anastasiadou S. Pediocins: the bacteriocins of Pediococci. Sources, production, properties and applications. Microb Cell Fact. 2009;8:1–16. doi: 10.1186/1475-2859-8-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pfannebecker J, Frohlich J. Use of a species-specific multiplex PCR for the identification of pediococci. Int J Food Microbiol. 2008;128:288–296. doi: 10.1016/j.ijfoodmicro.2008.08.019. [DOI] [PubMed] [Google Scholar]
  31. Porto MCW, Kuniyoshi TM, de Azevedo PODS, Vitolo M, de Souza Oliveira RP. Pediococcus spp.: An important genus of lactic acid bacteria and pediocin producers. Biotechnol Adv. 2017;35:361–374. doi: 10.1016/j.biotechadv.2017.03.004. [DOI] [PubMed] [Google Scholar]
  32. Pospiech A, Neumann B. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet. 1995;11:217–218. doi: 10.1016/S0168-9525(00)89052-6. [DOI] [PubMed] [Google Scholar]
  33. Rhee SJ, Lee JE, Lee CH. Importance of lactic acid bacteria in Asian fermented foods. Microb Cell Fact. 2011;10:1–5. doi: 10.1186/1475-2859-10-S1-S5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ribeiro MCDO, Vandenberghe LPDS, Spier MR, Paludo KS, Soccol CR, Soccol VT. Evaluation of probiotic properties of Pediococcus acidilactici B14 in association with Lactobacillus acidophilus ATCC 4356 for application in a soy based aerated symbiotic dessert. Br Arch Biol Technol. 2014;57:755–765. doi: 10.1590/S1516-8913201402258. [DOI] [Google Scholar]
  35. Rojo-Bezares B, Sáenz Y, Poeta P, Zarazaga M, Ruiz-Larrea F, Torres C. Assessment of antibiotic susceptibility within lactic acid bacteria strains isolated from wine. Int J Food Microbiol. 2006;111:234–240. doi: 10.1016/j.ijfoodmicro.2006.06.007. [DOI] [PubMed] [Google Scholar]
  36. Ruiz-Moyano S, Martín A, Benito MJ, Hernández A, Casquete R, Córdoba MDG. Safety and functional aspects of pre-selected pediococci for probiotic use in Iberian dry-fermented sausages. Int J Food Sci Technol. 2010;45:1138–1145. doi: 10.1111/j.1365-2621.2010.02244.x. [DOI] [Google Scholar]
  37. Sharma P, Tomar SK, Goswami P, Sangwan V, Singh R. Antibiotic resistance among commercially available probiotics. Food Res Int. 2014;57:176–195. doi: 10.1016/j.foodres.2014.01.025. [DOI] [Google Scholar]
  38. Sharma P, Tomar SK, Sangwan V, Goswami P, Singh R. Antibiotic resistance of Lactobacillus sp. isolated from commercial probiotic preparations. J Food Saf. 2016;36:38–51. doi: 10.1111/jfs.12211. [DOI] [Google Scholar]
  39. Simpson WJ, Taguchi H. The genus Pediococcus, with notes on the genera Tetratogenococcus and Aerococcus. In: Wood BJB, Holzapfel WH, editors. The genera of lactic acid bacteria. New York: Springer; 1995. pp. 125–172. [Google Scholar]
  40. Singla V, Mandal S, Anand S, Tomar SK. Techno-functional attributes of Pediococcus spp.: a review. Ind J Dairy Sci. 2017;70:381–390. [Google Scholar]
  41. Singla V, Mandal S, Anand S, Sharma Y. Sugar fermentation profile of Pediococcus strains from diverse sources. Ind J Dairy Sci. 2018;71:317–319. [Google Scholar]
  42. Somkuti GA, Steinberg DH. Pediocin production in milk by Pediococcus acidilactici in co-culture with Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus. J Ind Microbiol Biotechnol. 2010;37:65–69. doi: 10.1007/s10295-009-0648-2. [DOI] [PubMed] [Google Scholar]
  43. Sukumar G, Ghosh AR. Pediococcus spp. A potential probiotic isolated from Khadi (an Indian fermented food) and identified by 16S rDNA sequence analysis. Afr J Food Sci. 2010;4:597–602. [Google Scholar]
  44. Temmerman R, Pot B, Huys G, Swings J. Identification and antibiotic susceptibility of bacterial isolates from probiotic products. Int J Food Microbiol. 2003;81:1–10. doi: 10.1016/S0168-1605(02)00162-9. [DOI] [PubMed] [Google Scholar]
  45. Toomey N, Bolton D, Fanning S. Characterisation and transferability of antibiotic resistance genes from lactic acid bacteria isolated from Irish pork and beef abattoirs. Res Microbiol. 2010;161:127–135. doi: 10.1016/j.resmic.2009.12.010. [DOI] [PubMed] [Google Scholar]
  46. Uymaz B, Şimşek O, Akkoç N, Ataoğlu H, Akçelik M. In vitro characterization of probiotic properties of Pediococcus pentosaceus BH105 isolated from human faeces. Ann Microbiol. 2009;59:485–491. doi: 10.1007/BF03175135. [DOI] [Google Scholar]
  47. Venkateshwari S, Halami P, Vijayendra S. Characterisation of the heat-stable bacteriocin-producing and vancomycin-sensitive Pediococcus pentosaceus CFR B19 isolated from beans. Beneficial Microb. 2010;1:159–164. doi: 10.3920/BM2009.0032. [DOI] [PubMed] [Google Scholar]
  48. Vidhyasagar V, Jeevaratnam K. Isolation and characterization of Pediococcus pentosaceus from idly batter: a traditional South Indian fermented food source. Biosci Biotechnol Res Asia. 2012;9:427–431. doi: 10.13005/bbra/1019. [DOI] [Google Scholar]
  49. Yuksekdag ZN, Aslim B. Assessment of potential probiotic-and starter properties of Pediococcus spp. isolated from Turkish-type fermented sausages (sucuk) J Microbiol Biotechnol. 2010;20:161–168. doi: 10.4014/jmb.0904.04019. [DOI] [PubMed] [Google Scholar]
  50. Zarazaga M, Saenz Y, Portillo A, Tenorio C, Ruiz-Larrea F, Del Campo R, Baquero F, Torres C. In vitro activities of ketolide HMR3647, macrolides, and other antibiotics against Lactobacillus, Leuconostoc, and Pediococcus isolates. Antimicrob Agents Chemother. 1999;43:3039–3041. doi: 10.1128/AAC.43.12.3039. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material 1 (DOCX 368 KB) (368.4KB, docx)

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES