Nuclear Localization of Huntingtin mRNA Is Specific to Cells of Neuronal Origin

SUMMARY

Huntington’s disease (HD) is a monogenic neurodegenerative disorder representing an ideal candidate for gene silencing with oligonucleotide therapeutics (i.e., antisense oligonucleotides [ASOs] and small interfering RNAs [siRNAs]). Using an ultra-sensitive branched fluorescence in situ hybridization (FISH) method, we show that ~50% of wild-type HTT mRNA localizes to the nucleus and that its nuclear localization is observed only in neuronal cells. In mouse brain sections, we detect Htt mRNA predominantly in neurons, with a wide range of Htt foci observed per cell. We further show that siRNAs and ASOs efficiently eliminate cytoplasmic HTT mRNA and HTT protein, but only ASOs induce a partial but significant reduction of nuclear HTT mRNA. We speculate that, like other mRNAs, HTT mRNA sub-cellular localization might play a role in important neuronal regulatory mechanisms.

In Brief

Huntington’s disease (HD) is a monogenic neurodegenerative disorder representing an ideal candidate for gene silencing with oligonucleotide therapeutics. Didiot et al. examine the subcellular localization of HTT mRNA in non-neuronal and neuronal cells and the efficiency of oligonucleotide therapeutics on HTT mRNA subcellular fractions.

Graphical Abstract

INTRODUCTION

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by a CAG repeat expansion within exon 1 of the coding region of the huntingtin gene (-ton’s Disease Collaborative Research Group, 1993). The mono-genic nature of HD makes it an ideal candidate for gene silencing with oligonucleotide therapeutics, such as antisense oligonucle-otides (ASOs) and short interfering RNAs (siRNAs), which are both involved in post-transcriptional gene silencing by reducing the target mRNA levels (for review, Crooke et al., 2018). siRNAs induce mRNA degradation by loading into the RNA-induced silencing complex (RISC) in the cytoplasm, and ASOs promote mRNA degradation via RNase H in both the nucleus and the cytoplasm.

In the central dogma of cellular biology, the mRNAs are predominantly localized in the cytoplasm in mammalian cells.Therefore, both classes of therapeutics are highly efficient at silencing mRNA expression, presumably due to the cytoplasmic localization of mRNA. When studying HTT mRNA silencing in different cell types, we observed that siRNA treatment fully silenced HTT in HeLa cells (>95%) but only reduced Htt by 50%−70% in mouse primary neurons (Alterman et al., 2015). To understand the reason(s) behind this discrepancy in the degree of silencing in different cell types, we wanted to carefully visualize the cellular distribution of Htt mRNA in individual cells. We hypothesized that the differences in silencing efficacy were due to a difference in cellular localization of Htt mRNA between cell types.

In this study, we used a highly sensitive, branched fluorescence in situ hybridization (FISH) technology—RNAscope (Wang et al., 2012)—and confocal microscopy to observe and quantify the intracellular distribution of HTT mRNA at high resolution in single cells. We found that a significant fraction of HTT mRNA localizes to the nucleus of neuronal cells, but not non-neuronal cells. This cellular localization of HTT mRNA affects its silencing by thera-peutic oligonucleotides both in vitro and in vivo: siRNAs and ASOs nearly eliminated cytoplasmic HTT mRNA and only ASOs partially reduced nuclear HTT mRNA levels. Our findings reveal a new parameter for consideration in our understanding of the role of HTT mRNA in neuronal regulatory mechanisms and oligo-nucleotide therapeutic development.

RESULTS

Branched FISH Technology Enables Precise In Situ Detection of Spliced Htt mRNA

Previously, CAG-specific probes have been used as a proxy for HTT mRNA detection (de Mezer et al., 2011; Urbanek et al., 2017). However, we observed intense CAG FISH staining throughout the nucleus and cytoplasm, and a very low fraction of the CAG-FISH signal co-localized with the FISH signal using an HTT mRNA-specific probe set (Figures S1A and S1B). Thus, we implemented and validated a highly sensitive and specific branched FISH technology to detect Htt mRNA.

To ensure the specific detection of Htt mRNA by the FISH assay, we developed a panel of probes that target different regions of Htt mRNA and independent targets and used the following controls (Table S1; Figure S1): (1) co-targeting of Htt mRNA and CAG repeat (Figures S1A-S1D); (2) co-targeting the same Htt mRNA region (exons 27–35 [E27–35]) in two different fluorescent channels (488 and 570 nm; Figures S1E-S1H); (3) co-targeting of two different regions of Htt mRNA (E1–7 and E27–35; Figures S1I-S1L); (4) co-targeting exonic (E27–35) and intronic (I61) regions of Htt mRNA (Figures S1M and S1N); and (5) co-targeting Htt mRNA and Herc2 mRNA (Figures S1O and S1P). To accurately estimate the number of mRNA foci per cell and ensure that intracellular distribution (nucleus versus cytoplasm) does not affect mRNA quantification, we quantified mRNA foci in three dimensions throughout the volume of each cell (see STAR Methods for details).

We observed up to 70% and 80% of FISH foci co-localization using probe sets that target similar or different regions of the Htt mRNA (Figures S1F and S1J) and no co-localization of Htt mRNA foci with Herc2 mRNA foci (Figure S1P). Background co-localization (calculated by rotating one channel 180°) did not exceed 1% in most samples (Figures S1G, S1H, S1K, and S1L). The exception was the CAG-specific probe set, which resulted in ~10% background co-localization, which isexpected for probes that stain hundreds of foci per cell (Figures S1C and S1D). In addition, we observed that the majority of nuclear Htt mRNA foci localized in the nucleus appeared to be spliced (Figures S1M and S1N).

More Than 50% of Htt mRNA Is Localized to the Nucleus in Mouse Primary Neurons

We assessed the intracellular distribution of Htt and control mRNAs in mouse primary cortical neurons (Figures S2A-S2E). Precise quantification of mRNA foci by FISH showed ~200 ActB, ~25 Ppib, ~30 Hprt, ~37 Herc2, and ~20 Htt foci per cell (Figures S2A and S2B). Whereas most housekeeping mRNAs localized primarily in the cytoplasm (90% Ppib, −80% ActB, and −80% Hprt), 60% of Htt mRNA localized in the nucleus. The nuclear enrichment of Htt mRNA was not an artifact of mRNA length; we observed only 40% nuclear localization of Herc2 mRNA, which is longer than Htt mRNA (Table S1). As expected, the long non-coding RNAs (lncRNAs) Neat1 and Malat1 were only detected in the nucleus (Figures S2A and S2C). To confirm Htt mRNA localization patterns observed by FISH and ensure that the probe hybridization is similar in nucleus and cytoplasm, we performed RT-qPCR to quantify nuclear and cytoplasmic ActB, Herc2, and Htt mRNA fractions isolated from primary neurons. The data showed that Htt mRNA is significantly more enriched in the nuclear fraction than ActB or Herc2 mRNA (respectively, ***p < 0.001 and *p < 0.05; Figures S2D and S2E). Thus, Htt mRNA shows an unusual enrichment in the nuclei of mouse primary neurons.

To determine whether the non-dividing characteristic of neurons affects Htt mRNA subcellular localization, we assessed mRNA distribution in dividing cells of neuronal origin (Neuro2a cells; Figure S2F). Precise transcript quantification showed an average of −30 Htt, −115 Ppib, −75 Hprt, and −27 Herc2 mRNA foci per cell (Figure S2G). Whereas the control Hprt, Ppib, and Herc2 mRNA foci were all predominantly cytoplasmic (90%, 71%, and 64%), most Htt mRNA foci were nuclear (68%). As expected, almost all Neat1 lncRNA foci were nuclear (95%; Figures S2G and S2H). Thus, nuclear enrichment of Htt mRNA is observed in both dividing and non-dividing cells of neuronal origin.

Htt mRNA Nuclear Localization Is Specific to Cells of Neuronal Origin

To determine the effect of cell type on Htt mRNA localization, we compared Htt mRNA distribution in non-neuronal cells (i.e., HeLa, human primary fibroblasts, and mouse primary fibroblasts) to that observed in cells of neuronal origin (i.e., mouse Neuro2a cells, cortical primary neurons, and mouse brain tissue). Whereas −50% of Htt mRNA foci localized to the nucleus in neuronal cells, only 10%−20% of Htt mRNA foci were nuclear in non-neuronal cells (Figures 1A–1C). These findings agree with our observation that siRNA can completely silence Htt mRNA in HeLa cells, but not in primary neurons.

Figure 1. Htt mRNA Is Highly Retained in the Nucleus in Cells of Neuronal Origin.

(A) Htt mRNA (green) detected in cells of non-neuronal origin (HeLa, Hm, and Mm primary fibroblasts) and In cells of neuronal origin (Mm Neuro2a, Mm cortical primary neurons, and Mm brain section) by dual-color FISH. Nuclei are labeled with Hoechst (blue). Representative images of maximum Z projections of optical sections through the nucleus are spaced 0.5 μm apart. 100× oil objective is shown (scale bars, 5 μm). (B) Scatterplot representing the absolute quantification of Htt transcript in each cell line. Each dot represents the number of nuclear and cytoplasmic foci for one cell (n = 20–30 cells). Linear regression is shown for each transcript. (C) Percentage of nuclear and cytoplasmic localization of Htt mRNA in different cell lines (n ~20 cells; mean ± SEM; ****p < 0.0001; one-way ANOVA-Bonferroni’s multiple comparisons test). See also Figure S2.

In both primary neurons and brain sections, we observed significant cell-to-cell variability in both Htt mRNA expression and subcellular localization. To evaluate Htt mRNA level and distinguish between neuronal and non-neuronal cells in the brain, we developed and optimized a dual FISH-immuno- fluorescence approach that allows simultaneous detection of mRNA and protein. NeuN and GFAP were, respectively, used as markers for neurons (Figure 2) and glial cells (Figure S3). Htt mRNA in the brain was almost entirely neuronal. Moreover, the number of Htt mRNA foci varied widely between neurons: undetectable in some neurons and as many as 60 foci in others (Figures 2A, 2B, S3A, and S3B). On average, we observed −17 Htt mRNA foci per cell, with −55% of foci in the nucleus (Figures 2B, 2D, S3C, and S3D). These data quantitatively confirm the previous findings that Htt mRNA is predominantly expressed in neurons in vivo (http://proteinatlas.org).

Figure 2. A Large Fraction of Htt mRNA Is Localized in the Nucleus of Striatal and Cortical Neurons in Mouse Brain.

(A and B) Htt mRNA (green) detected in neurons (NeuN-positive cells, red) and glia (NeuN-negative cells) in the (A) striatum and the (B) cortex. Nuclei labeled with Hoechst (blue) are shown. Representative images are maximum Z projections of >20 optical sections spaced 0.5 μm apart. 100 × oil objective for neuronal type cells is shown (scale bars, 5 μm). (C and D) Scatter graph of nuclear and cytoplasmic Htt mRNA foci in (C) the striatum and (D) the cortex (n = 20–30 cells; mean ± SEM; *p < 0.05; **p < 0.01; one-way ANOVA-Bonferroni’s multiple comparisons test). See also Figure S3.

Human Fibroblast Reprogramming into Neuron-like Cells Changes HTT mRNA Nuclear-Cytoplasmic Distribution

Human adult fibroblasts, which express cytoplasmic Htt mRNA, can be reprogrammed directly into neuron-like cells by overexpressing miR-9 and miR-124 and several neuronal transcription factors (Richner et al., 2015; Tang et al., 2013). We therefore tested whether trans-differentiation of fibroblasts into neuron-like cells affects HTT mRNA subcellular distribution (Figure 3). Upon the induction of miR-9 and miR-124 expression (Figure 3A), cells gradually acquired a neuronal morphology characterized by reduction of the cytoplasm and the development of neuronal projections (Figure 3B). Before trans-differentiation, −90% of HTT mRNA foci were cytoplasmic. In trans-differentiated neuron-like cells, −60% of HTT mRNA foci were nuclear (Figures 3C–3E). The change in the nuclear-cytoplasmic ratio is accompanied by a sharp decrease in the number of cytoplasmic foci, suggesting that the rate of nucleo-cytoplasmic export of Htt mRNA might differ in neuronal and non-neuronal cells. Thus, cell type, rather than origin, is crucial in defining HTT mRNA cellular localization.

Figure 3. A Large Fraction of Htt mRNA Is Localized in the Nucleus of Fibroblast- Derived Neuron-like Cells.

(A) Scheme of fibroblasts conversion to neurons showing the neuronal morphology acquisition (adapted from Richner et al., 2015). (B) Phase contrast images of human primary fibroblasts transduced with miR-9/9*−124 and CDM at post-induction dates (PIDs) 20. (C) Htt mRNA (green) was detected by FISH in Hs primary fibroblasts and Hs primary fibroblast- derived neuron-like cells. Nuclei labeled with Hoechst (blue) are shown. Representative images are maximum Z projections of >20 optical sections spaced 0.5 μm apart. 100× oil objective for neuronal type cells is shown (scale bars, 5 μm). (D) Scatterplot of nuclear and cytoplasmic Htt mRNA foci (n = 20–30 cells; mean ± SEM; ns, not significant; ****p < 0.0001; one-way ANOVA- Bonferroni’s multiple comparisons test). (E) Percentage of nuclear and cytoplasmic localization for Htt transcript (n = 20–30 cells; mean ± SEM; ****p < 0.0001; one-way ANOVA- Bonferroni’s multiple comparisons test).

Nuclear Htt mRNA Is More Stable than Cytoplasmic Htt mRNA

Several cellular processes might contribute to nuclear retention of Htt mRNA in neuronal cells, including slow nuclear-cytoplasmic export or rapid cytoplasmic mRNA turnover. To determine the rate of Htt mRNA turnover, we blocked RNA polymerase II (Pol II)-mediated transcription and quantified mRNA levels at 2, 4, 6, 8, and 10 hr post- transcriptional inhibition (Figures S4A-S4C). Cytoplasmic Htt mRNA levels (4-hr half-life) decreased significantly faster than nuclear Htt mRNA (10-hr half-life; ****p < 0.0001; Figures S4A and S4B). By contrast, Herc2 mRNA turned over at the same rate in both nuclear and cytoplasmic fractions (~6-hr half-life; Figure S4C). The cytoplasmic Htt and Herc2 mRNAs decreased at similar rates, and nuclear Htt mRNA decreased at a significantly slower rate than Herc2 mRNA (Figures S4B and S4C).

Nuclear Htt mRNA Resists Silencing by Both ASOs and siRNAs

Our findings suggest that the neuronal-specific nuclear enrichment of Htt mRNA could explain why siRNAs cannot fully silence Htt mRNA in neuronal cells. We therefore directly tested whether the subcellular localization of Htt mRNA affects its ability to be silenced by therapeutic oligonucleotides (Figures 4 and S4E-S4K).

Figure 4. In Vivo Htt mRNA Silencing in Striatal Neurons by Hydrophobically Modified siRNA and Antisense Oligonucleotides.

DHA-siRNA^NTC, DHA-siRNA^HTT, ASO^NTC, and ASO^HTT(4 nmol in 2 μL;n = 3 animals per group) were administered by unilateral intrastriatal bolus microinjection. Brains were collected after 7 days, and Htt mRNA foci subcellular levels were assessed by FISH. (A) Schematic diagram of sagittal and coronal sectionsthrough the mouse striatum at the site of injection. The striatal region selected to acquire the images (red box) is indicated. (Band C) FISH detection of Htt mRNA(green) upon (B) DHA-siRNAand (C) ASOtreatments. Nuclei labeledwith Hoechst (blue) areshown. Representative images are maximum Z projections through the nuclear region spaced 0.5 μm apart. 100× oil objective is shown (scale bars, 5 μm).

Mouse primary neurons were treated for 7 days with either LNA GapmeR ASO targeting position 3,209 in Htt exon 23 (ASO^HTT) (Hung and Leeds, 2007) or chemically stabilized, hydrophobic siRNA targeting position 10,150 in Htt 3’ UTR (siRNA^HTT) (Alter- man et al., 2015). Sequence and chemical composition of compounds used are shown in Table S2. FISH analysis of treated neurons showed that both chol-siRNA^HTT and DHA-siRNA^HTT reduced cytoplasmic Htt mRNA foci by 90% (Figures S4E and S4H), but not nuclear Htt mRNA foci. ASO^HTT significantly reduced the number of cytoplasmic and nuclear Htt foci (by 80% and 40%; Figure S4E). There was no major impact of both siRNAs and ASOs on Hprt and Herc2 mRNA foci level and localization (Figures S4F and S4G). siRNA and ASO cytotoxicity, measured using the alamar blue assay, showed that the primary neurons’ viability was not altered by the treatment at the indicated concentrations (Figure S4H). To evaluate siRNAs’ and ASOs’ silencing efficiency, we measured the total cellular level of Htt mRNA using the QuantiGene assay. We observed 60% Htt mRNA silencing in cellstreated with 0.15 mM ASO^HTTorsiRNA^HTT (Figure S4K), consistent with previous observations. At 1.25 mM concentration, ASO^HTT reduced total Htt mRNA by ~85%, whereas siRNA^HTT only reduced total Htt mRNA by ~75%, consistent with the possibility that siRNAs mostly silence cytoplasmic Htt mRNA and ASOs silence both nuclear and cytoplasmic Htt mRNA. Consistent with efficient silencing of cytoplasmic Htt mRNA, both therapeutic oligonucleotides significantly reduced HTT protein levels (Figures S4I and S4J).

We evaluated the impact of Htt mRNA subcellular distribution on oligonucleotide efficiency in vivo (Figure 4). When injected directly in mouse striatum, DHA-siRNAs induced efficient Htt mRNA silencing and had no measurable impact on neuronal integrity or innate immune activation (Nikan et al., 2016). Mice were directly injected with 4 nmol DHA-siRNA^NTC, DHA- siRNA^HTT (Nikan et al., 2016), ASO^NTC, and ASO^HTT (Hung and Leeds, 2007) in the right striatum (n = 3 animals per group; Figure 4A). After 7 days, levels of nuclear and cytoplasmic Htt mRNA foci were assessed by FISH (Figures 4B and4C). Consistent with the data obtained in vitro, we observed that DHA-siRNA^HTT reduced cytoplasmic Htt mRNA foci by 95%, but not nuclear Htt mRNA foci. In contrast, ASO^HTT significantly reduced the number of both cytoplasmic and nuclear Htt foci by 90% and 60%, respectively (Figure 4D). We did not detect any significant impact by either siRNA or ASO on Hprt and Herc2 mRNA foci level and localization (Figures 4E and4F).

DISCUSSION

The HD gene Htt is expressed throughout the body, but HD pathology is primarily limited to neuronal tissues. Using branched FISH, high-resolution confocal microscopy, and volumetric quantification of mRNA foci, we show that wild-type Htt mRNAs (with a normal number of CAG repeats) accumulate in the nucleus of neuronal cells, but not in non-neuronal cells. A similar Htt distribution pattern was demonstrated by the analysis of RNA sequencing (RNA-seq) datasets from human embryonic stem cell (HESC)-derived neurons (Blair et al., 2017; Figure S3E). The results showed that, relative to the total number of reads in each sample, Htt transcript is detected more often in the nuclear fraction than in the cytoplasmic fraction. These findings suggest that Htt mRNA processing, export, or stability is differentially regulated in neuronal cells both in vitro and in vivo.

Advances in oligonucleotide therapeutics have put effective treatments for HD within reach (Kordasiewicz et al., 2012; http://www.ionispharma.com). Therapeutic oligonucleotides cause gene silencing by directing mRNA destruction, thereby preventing the expression of proteins involved in genetic disease. Whereas ASOs target mRNAs in the nucleus and cytoplasm, siRNAs primarily target mRNAs in the cytoplasm (this study and Castanotto et al., 2015). We have found that ASOs partially but significantly reduce the nuclear fraction of Htt, and siRNAs do not silence nuclear Htt mRNA at the used concentrations used. Regardless of the oligonucleotide used, nuclear Htt mRNA is more resistant to silencing than cytoplasmic Htt mRNA. The resistance of nuclear Htt mRNA to silencing by oligo-nucleotides could be related to the increased stability or retention of nuclear Htt mRNA compared to cytoplasmic Htt mRNA. Future studies are needed to understand the compartmental efficiency of various oligonucleotides on wild-type and mutant Htt and for the development and optimization of therapeutics to treat HD and other neurode-generative diseases.

The investigation of Htt mRNA distribution in brain sections revealed a high degree of variability in levels of Htt mRNA expression between different cell types (neurons versus glia) and within the same cell types. In general, neurons express significantly more Htt mRNA than glia. Similarly, detection of HTT mRNA in wild-type human brain by immunohistochemistry showed higher level of HTT mRNA in neurons than in glia (Landwehrmeyer et al., 1995). These data are consistent with data from RNA-seq datasets performed on various cell population of mouse cerebral cortex and suggest Htt mRNA is predominantly expressed in neurons compared to glia (Zhang et al., 2014; Figure S3F).

Interestingly, as previously described, we also observed a substantial variability of Htt mRNA level between individual neurons, with neurons not expressing Htt mRNA and neurons expressing as many as 60 copies per cell (Keeler et al., 2016). Several studies have demonstrated that the cell to cell variability is a biological phenomenon and could play critical roles in determining biologically and clinically significant phenotypes (for review, Patange et al., 2018). HTT mRNA subcellular distribution, as well as expression variability, may provide valuable information about HTT function in neuronal regulatory mechanisms.

Summary and Conclusion

Using branched FISH, we localize and quantify wild-type Htt mRNA (non-expanded CAG repeat) in different cell types and evaluate the differential silencing efficiency of ASOs and siRNAs on nuclear versus cytoplasmic Htt mRNA. We show that more Htt mRNA is nuclear in neuronal cells compared to non-neuronal cells. Furthermore, we show that siRNAs and ASOs differentially silence nuclear and cytoplasmic Htt mRNA. This is the first detailed observation of a clear change in Htt mRNA intracellular localization based on cellular identity and the first investigation of the differential subcellular efficacy of different oligonucleotide therapies. These results provide insight into the characteristics of Htt mRNA, incite future investigation into the subcellular distribution of mutant Htt mRNA, and identify a new aspect for consideration in the development of future oligonucleotide therapeutics targeting HTT mRNA.

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
rabbit polyclonal anti-HTT	Sapp et al., 2012	Ab1; RRID: N/A
rabbit polyclonal anti-RPB1	Cell Signaling	Cat#2629; RRID: AB_2167468
mouse monoclonal anti-GAPDH	Sigma	Cat#MAB374; RRID: AB_21G7445
chicken monoclonal anti-NeuN	Millipore	Cat#MAB377B; RRID: AB_177621
chicken polyclonal anti-GFAP	Millipore	Cat#AB5541; RRID: AB_177521
Chemicals, Peptides, and Recombinant Proteins
AlamarBlue	Life Technologies	Cat#DAL1G25
Critical Commercial Assays
See Table S1 for the list and cat# of RNAscope probes	ACDBio	N/A
RNAscope Fluorescent Multiplex Assay	ACDBio	Cat#32G85G
QuantiGene 2.0 Assay	Affymetrix	Cat#QSGG11
QuantiGene 2.0 Htt probe	Affymetrix	Cat#SB-1415G
QuantiGene 2.0 Ppib probe	Affymetrix	Cat#SB-1GGG2
Experimental Models: Cell Lines
Mouse: Neuro2a	ATCC	Cat#CCL-131
Mouse: embryonic day 16 cortical primary neurons	N/A	N/A
Mouse: primary fibroblasts	N/A	N/A
Human: HeLa	ATCC	Cat#CCL-2
Human: primary fibroblasts	Coriell	Cat#GMG8399
Experimental Models: Organisms/Strains
Mouse: wild-type FVB/NJ (female)	The Jackson Laboratory	Cat#GG18GG
Oligonucleotides
Chol-siRNAHTT	Alterman et al., 2015	hsiRNA HTT1G15G
Chol-siRNANTC	Alterman et al., 2015	hsiRNA NTC
DHA-siRNAHTT	Nikan et al., 2016	DHA-hsiRNAHTT
DHA-siRNANTC	Nikan et al., 2016	DHA-hsiRNANTC
ASOhtt	Hung and Leeds, 2007; Exiqon	ASO-32G9 (IONIS)
ASOntc	Exiqon	ASO-ContA
Oligonucleotides	This paper	Table S2
Software and Algorithms
ImageJ	NIH	https://imagei.nih.gov/ii/
GraphPad Prism	GraphPad Software Inc.	https://www.graphpad.com/scientifc-software/prism/
R	The R Foundation	https://www.r-proiect.org/
Other
RNaseq	Blair et al., 2017	N/A
RNaseq	Zhang et al., 2014	https://web.stanford.edu/group/barres_lab/brain_rnaseq.html

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Anastasia Khvorova (Anastasia.khvorova@umassmed.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice and Ethic Statements

Female wild-type FVB/NJ mice were purchased from The Jackson Laboratory and maintained in a specific pathogen-free facility. All procedures were performed in accordance with the National Institutes of Health Guideline for Laboratory Animals (including the timed pregnant mice used to obtain primary neurons) and were approved by the University of Massachusetts Medical School IACUC (Protocol #A2411).

Human Primary Cells

Adult dermal fibroblasts from healthy control were acquired from the Coriell Institute for Medical Research. Therefore, in regard to deidentified skin fibroblasts samples, we do not have access to the master list to reidentify subjects. This activity is not considered to meet federal definitions under the jurisdiction of an institutional review board and is thus exempt from the definition of human subject.

METHOD DETAILS

Cell Culture

HeLa and Neuroblastoma 2a (Neuro2a) cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (Cellgro #10–013CV) supplemented with 10% fetal bovine serum (FBS; GIBCO #26140) and 100 U/ml Penicillin/Streptomycin (Invitrogen #15140) and grown at 37℃ and 5% CO₂. Cells were split every 3–4 days.

The mouse primary fibroblasts were obtained from mouse dermal tissue following a method published by (Seluanov et al., 2010). Mouse and human primary fibroblast were maintained in MEM (GIBCO #11095) supplemented with 15% fetal bovine serum, 2% EAA (GIBCO #11130), 2% NEAA (GIBCO #11140), 1% vitamins (GIBCO #11120), 100 U/ml Penicillin/Streptomycin and pH7.4 and grown at 37°C and 5% CO₂. Cells were split every 3–4 days.

For FISH, cells were plated at 2.5×10⁵ cells per dish on 35 mm glass bottom dishes (MatTek #P35G-1.5–10-C) pre-coated for one hour with poly-L-lysine (Sigma #P4707). Unless stated otherwise, the FISH procedure was performed at 2 days post-plating.

Conversion of Fibroblasts into Neuron-like Cells

The trans-differentiation of human primary fibroblasts into fibroblast-derived neurons was performed following the detailed protocol developed by (Richner et al., 2015). Briefly, the lentiviral cocktail of rtTA, pTight-9–124-BclxL, CTIP2, MYT1L, DLX1 and DLX2 was added to fibroblasts for 16 h, then cells were washed in PBS and cultured in fibroblasts medium (FM) containing 1 μg/mL doxycycline (DOX). At post-induction day (PID) 3, cells were cultured in FM containing 3 μg/mL puromycin, 3 μg/mL blasticidin and DOX. At PID 5 cells were replated onto sterile 24-wells glass-bottom plates (MatTek #P24G-1.5–10-F) pre-coated with polyornithine, fibro- nectin and laminin and cultured in FM + DOX. On PID 6, FM was replaced by Reprogramming Neuronal Medium (RNM): NbActiv4 (Brainbits #Nb4–500) with 200 μM dibutyl cyclic AMP, 1 mM valproic acid, 10 ng/mL BDNF, 10 ng/mL NT-3 and 1 μM retinoic acid, supplemented with DOX. Half-volume medium changes with RNM were performed every 4 days with addition of DOX every 2 days thereafter until PID 30–35. Addition of puromycin and blasticidin was terminated after PID 14.

Preparation of Primary Neurons

Primary cortical neurons were prepared and maintained as described in (Alterman et al., 2017). The procedure was performed using sterile standard dissection tools.

Primary cortical neurons were isolated from E16–17 mouse embryos of wild-type FVB/NJ mice. Pregnant females were anesthetized by intraperitoneal injection of Avertin at 250 mg per kg body weight (Sigma, #T48402) followed by cervical dislocation. Embryos were removed and transferred to ice-cold DMEM/F12 medium (Invitrogen #11320). Brains were removed and meninges were carefully detached. Cortices were isolated and transferred into pre-warmed papain solution for 25 min at 37℃, 5% CO2 to dissolve the tissue. Papain (Worthington #54N15251) was dissolved in 2 mL Hibernate E (Brainbits #HE) and 1 mL EBSS (Worthington #LK003188), and supplemented with 0.25 mL of 10 mg/ml DNase1 (Worthington #54M15168) in Hibernate E. After the 25–30 min incubation, the papain solution was gently removed and 1 mL NbActiv4 (Brainbits #Nb4–500) supplemented with 2.5% FBS was added to the tissue. Tissues were then dissociated by gentle trituration through a fire-polished, glass Pasteur pipet. Neurons were counted, diluted at 1 × 10⁶ cells/ml and plated as required for each experiment as described below. After overnight incubation at 37°C, 5% CO₂, an equal volume of NbActiv4 supplemented with anti-mitotics, 2.4 μg/ml 5-Fluoro-2’-deoxyuridine monophosphate (Sigma #F3503) and 4.8 μg/ml Uridine triphosphate (Sigma #U6625) to prevent the growth of non-neuronal cells, was added to neuronal cultures. Half of the volume of media was replaced with fresh NbActiv4 containing anti-mitotics every 48 hours until the experiments were performed.

FISH experiments

2 × 10⁵ cells were plated in the glass center of 35 mm glass-bottom dishes (MatTek #P35G-1.5–10-C) pre-coated with poly-L-lysine (Sigma #P4707). Cells were fixed and processed for FISH five days post-preparation.

In vitro silencing and cell viability assays

1 × 10⁵ neurons per well were plated on 96-well plates pre-coated with poly-L-lysine (BD BIOCOAT #356515) as described in (Alterman et al., 2017). Cells were processed 7 days post-treatment.

RT-qPCR

Experiments were performed with 2×10⁶ cortical primary neurons plated on 6 cm plates, pre-coated with poly-D-lysine.

Oligonucleotides

Sequences and chemical modification patterns of siRNA^HTTand ASO^HTTare described in Table S2. All siRNAs design, synthesis and quality control have been performed in house and are available upon request. ASOs, designed by IONIS Pharmaceuticals (Hung and Leeds, 2007), have been purchased from Exiqon.

RNA Polymerase II Inhibition

Triptolide was dissolved in DMSO to a 10 mM stock concentration. Primary cortical neurons were treated with a final concentration of 25 μM triptolide (MedChemExpress #HY-32735) for indicated amount of time. Cells were fixed directly after treatment and processed for FISH experiment.

Cell Viability Assay

The oligonucleotide cytotoxicity was assessed in vitro in primary neurons in 96-well plates using alamarBlue® reagent (Life Technologies #DAL1025) as recommended by manufacturer instruction. Briefly, 20 μl of alamarBlue® reagent were added in 200 μl primary neurons culture medium and incubated for 4 hours. Resofurin fluorescence was measured at 550 nm excitation and 600 nm emission wavelengths.

Animal Stereotaxic Injections of Oligonucleotides

All mice used were wild-type female adults FVB/NJ, 14 weeks old at the time of the injection (The Jackson Laboratory). Prior to injection, mice were deeply anesthetized with 1.2% Avertin (Sigma #T48402). 4 nmol DHA-siRNA^NTC, DHA-siRNA^HTT, ASO^NTC or ASO^HTT (n = 3 mice per treatment group), diluted at 2 nmol/ml in aCSF, were administered by direct bollus microinjection into the right striatum by stereotaxic placement; coordinates (relative to bregma) were +1.0 mm anterio-posterior, +2.0 mm medio-lateral, and +3.0 mm dorso-ventral. All injection surgeries were performed using sterile surgical techniques and were accomplished using standard rodent stereotaxic instrument and an automated microinjection syringe pump (Digital Mouse Stereotaxic Frame; World Precision Instrument #504926). Mice were euthanized 7 days post-injection and brains were harvested.

Preparation of Mouse Brain Sections

Mice were sacrificed according to our institutional IAUCUC protocol (#A2411). Brains were removed, placed with eye bulbs facing upward in disposable cryomold (Polysciences, inc #18986–1), and frozen in O.C.T. embedding medium (Tissue-Tek #4583) in a dry ice/methanol bath. Brains were stored in −80°C and transferred at −20°C 24 hours prior sectioning. Brains were sliced into 20 mm brain sections using a cryostat (temperatures: sample holder −13°C, blade −12°C) (ThermoFisher CryoStar NX70) and mounted on superfrost slides (Fisher #1255015). Slides were stored at −80°C until further experiment.

Fluorescent In Situ Hybridization

FISH allows to perform single-cell detection of transcripts in situ and accurately quantify and report the relative levels of mRNA expression. Therefore, we compared the expression level of Htt mRNA with the expression level of housekeeping genes rather than normalize Htt mRNA level with any other control gene. mRNAs vary in sequence and length which may affect their subcellular localization. Thus, we investigated the cellular distribution of Htt mRNA with multiple transcripts: 1) the conventional housekeeping mRNAs ActB, Ppib and Hprt; 2) Herc2 mRNA, selected because it is a transcript longer than Htt mRNA; 3) Neat1 and Malatl long non-coding RNAs (lncRNAs) exclusively localized in the nucleus. The comparison of Htt mRNA level with multiple genes provided a more accurate and unbiased analysis of Htt transcript subcellular localization. See ‘‘Key Resources Table’’ for the detailed list and description of the genes assessed in this study.

Sample preparation

Cultured adherent cells were prepared as described by the manufacturer protocol for cultured adherent cells. Briefly, cells were fixed in 10% formalin for 20–30 min at 4°C and washed three times in PBS. Cells were dehydrated by sequential incubation in 50%, 70% and 100% ethanol for 1 min and incubated at least overnight and up to 6 months in 100% ethanol at −20°C. The day of FISH experiment, cells were re-hydrated by sequential incubation in 70% and 50% ethanol for 1 min followed by incubation in PBS for 10 min. Cells were incubated for 10 min in protease solution (Pretreat III) at room temperature. Cells were washed twice in PBS and processed for FISH.

Brain sections obtained on a cryostat were prepared as described by the manufacturer protocol for fresh frozen tissue (ACDBio #320513). Briefly, sections were fixed in 10% formalin for 15–20 min at4°Cand washed three times in PBS. Sections were dehydrated by sequential incubation in 50%, 70% and 100% ethanol for5 min at room temperature and air-dried for5 min at room temperature. During this time the hydrophobic barrier around the sections can be drawn. Sections were incubated for 20–30 min in protease solution (Pretreat IV) at room temperature. Sections were washed twice in PBS and processed for FISH.

FISH experiments

FISH were performed using the RNAscope® Fluorescent Multiplex kit (ACDBio #320850) following the manufacturer instruction (ACDBio #320293). Prior any experiment, we ensured that the probes were prewarmed at 40°C and cooled to room temperature to dissolve any crystal formed in the probe solution during storage at 4°C. Following sample preparation, samples were incubated with the target probe in the HybEZ oven at 40°C for 3 hours. The signal was amplified by incubation with the pre-amp, amp and label probes for 30 min each at 40°C. Between each incubation, samples were incubated in wash buffer twice for 2 min at room temperature. Following signal amplification, sample nuclei were stained with Dapi solution for 1 min, mounted in ProLong Gold antifade medium (ThermoFisher #P36930) and dried at room temperature overnight.

FISH-IF

Detection of NeuN and GFAP by immunofluorescence (IF) were performed following FISH experiment. Briefly, FISH procedure was performed as previously described by the manufacturer protocol followed directly by IF. Brain sections were incubated for 1 hour in blocking solution (2% Normal goat serum, 0.01% Triton-Xin PBS) at room temperature. Slides were washed 3 times for 5 min in PBS. Brain sections were incubated in primary antibodies diluted in PBS (chicken monoclonal anti-NeuN 1:1000, Millipore #MAB377B; chicken polyclonal anti-GFAP 1:1000, Sigma #AB5541) overnight at room temperature. Slides were washed 3 times for 5 min in PBS and incubated for 1 hour at room temperature in secondary antibodies diluted in PBS. Slides were washed 3 times for 5 min in PBS, mounted in ProLong Gold antifade medium and dried at room temperature overnight.

Confocal Imaging

Images were acquired with a CSU10B Spinning Disk Confocal System scan head (Solamere Technology Group) mounted on a TE-200E2 inverted microscope (Nikon) with a 100× Plan/APO oil-immersion objective and a Coolsnap HQ2 camera (Roper Technologies). Z stacks were acquired using Micro-Manager by imaging at 0.5 μm intervals throughout the samples (brain section or cells). Consistent laser settings were used for all imaging sessions: 350 nm laser, 100 ms; 488 nm laser, 300 ms; 543 nm laser, 300 ms; gain 500. Images were processed using ImageJ software.

Cell Fractionation, RNA Isolation and qRT-PCR

Fractionation

At DIV8, neurons were lysed with 200 ml ice cold hypotonic lysis buffer (20 mM Tris-HCl pH7.5; 15 mM NaCl; 10 mM EDTA; 0.5% NP-40; 0.1% Triton X-100). Lysate was scraped from the plate and centrifuged at 1,200 × g for 10 min at 4°C to pellet nuclei. Cytoplasmic fractions were flash frozen and nuclear pellets were washed 2X in ice cold hypotonic lysis buffer and then flash frozen.

RNA extraction

Nuclear and cytoplasmic lysates were incubated in hypotonic lysis buffer/10% SDS/200 mg/ml proteinase K (ThermoFisher #AM2548) for 1 hour at 42°C, followed by acid phenol chloroform extraction, chloroform extraction, and ethanol precipitation. RNA was treated with Turbo DNase (ThermoFisher #AM9720), followed by cleanup with RNA Clean and Concentrator Kit (Zymo Research #R1015). Due to residual DNA contamination, nuclear fractions were DNase treated twice.

RT-qPCR

2 μg of cytoplasmic RNA or 1 mg of nuclear RNA was reverse transcribed using random hexamer priming and Superscript IV Reverse Transcriptase (ThermoFisher #18090010). cDNA was purified using Ampure beads (Agencourt #A63880) and amplified using Type-it Fast SNP Probe PCR Kit (QIAGEN #206045) and TaqMan MGB probes (ThermoFisher #4316034). Primer sequences are: Htt Exon 5 F-TGGTGCTCCTCGAAGTTTGC, R-TCCTCCGGTCTTTTGCTTGT; Herc2 F- AGCCTTCTGCATCCTTGGTC, R-CGGAAGTCAGCAA TGGTCCT; ActB F-CTGTCGAGTCGCGTCCACC, R-CGCAGCGATATCGTCATCCA.

Htt mRNA Silencing Quantification

Htt mRNA silencing was performed as described in (Alterman et al., 2017). mRNA levels were assessed using the QuantiGene 2.0 Assay (Affymetrix #QS0011) and Htt mRNA level was normalized to Ppib mRNA (housekeeping control). Cells were lysed in 250 μL diluted lysis mixture per well (Affymetrix #13228) supplemented with 0.167 μg/ml proteinase K (Affymetrix #QS0103) for 30 min at 55°C. Cell lysates were mixed thoroughly and 40 μL (~16,000 cells) each lysate was added to the capture plate along with 40 μL additional diluted lysis mixture without proteinase K. Probe sets were diluted as specified in the Affymetrix protocol. 20 μL of mouse Htt or Ppib probe sets (Affymetrix #SB-14150, #SB-10002) was added for a final volume of 100 μL per sample well. The samples were incubated overnight at 55°C. The next day, the signal was amplified according to the Affymetrix QuantiGene protocol by incubating the samples with each probe for 1 hour: pre-amp and amp probes at 55°C and label probes at 50°C. Between each incubation, samples were washed three times in wash buffer at room temperature using a plate washer (Biotek EL_X-405). Luminescence was detected on a Veritas Luminometer (Promega). The average of the three technical replicates represents the mRNA expression value per sample.

Western Blot

Western blots were performed as described in (Keeler et al., 2016). Briefly, 10ug of primary neuronal lysates were separated by SDS-PAGE using 3%−8% Tris acetate gels (Life Technologies #EA03785BOX), transferred to nitrocellulose, blocked in 5% milk/TBS + 0.1% Tween 20, incubated in primary antibody overnight at 4°C then secondary antibody 1 hour at room temperature. Signal was detected using Super Signal West Pico Chemiluminescent kit (Pierce #34080) and a CCD imaging system (Alpha Inno-tech) or Hyperfilm ECL (GE Healthcare #28906839) and densitometry was determined using ImageJ software (NIH). Primary antibodies were rabbit polyclonal anti-HTT antibody Ab1 (Sapp et al., 2012) (1:2000 in blocking buffer) and mouse monoclonal anti-GAPDH antibody (1:2000 in blocking buffer; Sigma #MAB374). Secondary antibodies were peroxidase-labeled anti-rabbit IgG (1:2500 in blocking buffer, Jackson Immunoresearch #711035152) or anti-mouse IgG (1:5000 in blocking buffer, Jackson Immu- noresearch #715035150).

QUANTIFICATION AND STATISTICAL ANALYSIS

Transcripts Localization and Quantification

Nuclear versus cytoplasmic localization analysis of RNA foci was performed with ImageJ (v1.51n) using a macro designed in house (Lawrence J. Hayward). Briefly, the 3D ROI Manager of Thomas Boudier (Ollion et al., 2013) was used to define individual fluorescent foci as 3D objects and to quantitate the integrated intensity of voxels within each object. Hoechst images were used to segment the nuclear regions in 3D. Distinct foci were segmented in 3D using radial Gaussian local thresholding from background-subtracted and filtered images, and the raw intensities within each 3D object were then integrated to obtain the total fluorescence signal. Following mRNA foci quantification in Htt mRNA silencing experiments, Htt mRNA levels were normalized to Herc2 mRNA in vitro and Hprt mRNA level in vivo.

Co-Localization Quantification

Co-localization analysis was performed in ImageJ v1.51n (Schneider et al., 2012). To detect RNA foci, image stacks were convolved using a difference of Gaussians (DOG) method by using the 2D Gaussian filter (sigma = 134 nm, an approximation of a near-diffraction limited spot) and subtracting the same image stack with a larger Gaussian filter (sigma = 268 nm). The processed images were then thresholded using the Triangle method (Zack et al., 1977) thereby generating a binary image for each channel. Foci were converted to objects using the 3D objects counter plugin (Bolte and Cordelieres, 2006) and co-localization was determined by calculating the fraction of overlapping objects in different channels. Co-localization values are reported as the percent of objects that are co-localized with a given label. To distinguish nuclear versus cytoplasmic RNA, the DAPI channel was convolved with a Gaussian filter (sigma = 670 nm) and thresholded using the Otsu method (Otsu, 1979). RNA foci overlapping the processed DAPI channel were considered nuclear and non-overlapping foci were considered cytoplasmic. Additionally, non-specific co-localization was calculated by rotating one of the channels over both the X- and Y-axes and re-calculating the co-localization using the same method. This allowed us to determine that co-localization was genuine and not simply due to random signal.

RNA-seq Data Analysis

Analyses of RNA-seq data were performed using the R statistical software environment.

Processed nuclear and cytoplasmic RNA-seq datasets across neuronal differentiation from (Blair et al., 2017) were downloaded from the Gene Expression Omnibus (GSE100007) and TPM values for Htt mRNA (ENSG0000197386) were extracted for plotting.

Expression of Htt mRNA across neuronal cell types was assessed on an interactive web browser (http://web.stanford.edu/group/barres_lab/brain_rnaseq.html) with data from (Zhang et al., 2014).

Statistical Analysis

Data analyses were performed using GraphPad Prism 7 software (GraphPad Software Inc.). Statistical parameters including the exact value of n, dispersion and precision measures (mean ± SEM) and statistical significance, denoted by asterisks (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001) are reported in the figures and figure legends. Data were analyzed using unpaired two-tailed t test, unpaired one-way or two-way ANOVA test with Bonferroni test for multiple comparison as specified in the figure legends. Differences in all comparisons were considered significant at p < 0.05. Randomization and investigator blinding were not considerations for this study design.

Highlights.

• ~50% HTT mRNA is localized in cell nucleus

• HTT mRNA nuclear localization is limited to neuronal cells

• Nuclear HTT mRNA is more stable than cytoplasmic

• Nuclear HTT mRNA resists silencing by therapeutic oligonucleotides