Skip to main content
Avicenna Journal of Medical Biotechnology logoLink to Avicenna Journal of Medical Biotechnology
. 2018 Oct-Dec;10(4):273–276.

KIF21A Gene c.2860C>T Mutation in CFEOM1A: The First Report from Iran

Masoomeh Ramahi 1, Abolfazl Rad 2, Ebrahim Shirzadeh 3, Maryam Najafi 4,*
PMCID: PMC6252030  PMID: 30555664

Abstract

Congenital Fibrosis of the Extra Ocular Muscles1 (CFEOM1) is an autosomal dominant condition, caused by mutation in the KIF21A and TUBB3. It is characterized by congenital non-progressive restrictive ophthalmoplegia and ptosis. Mutational analysis of the known genes in such rare diseases by Sanger sequencing not only prevents wasting the time and expenses but also speeds diagnosis process, genetic counseling, and the possibility of prenatal diagnosis. Here, for the first time, association of pathogenic variant c.2860C>T in KIF21A gene in an Iranian family with positive history of CFEO-M1A was reported.

Keywords: Fibrosis of extra ocular muscles, Iran, Mutation, Prenatal diagnosis

Introduction

Congenital Fibrosis of the Extraocular Muscles (CFEOM) is characterized by congenital non-progressive ophthalmoplegia with or without ptosis affecting part or all of the oculomotor and/or the trochlear nucleus with its related nucleus and nerve 1. According to the clinical difference in the phenotype, CFEOM is subdivided to seven types including CFEOM1 (OMIM 135700) 1, CFEOM2 (OMIM 602078) 2, CFEOM3A (OMIM 600638) 3, CFEOM3B (OMIM 135700) 4, CF-EOM3C (OMIM 609384) 5, Tukel syndrome (OMIM 609428) 6, and CFEOM5 (OMIM 61004) 7. Literature reviews revealed pathogenic variants in the TUBB1 (Tubulin Beta 1 Class VI), TUBB2 (Tubulin Beta 2 Class II), TUBB3 (Tubulin Beta 3 Class III) 3, TUKLS (Tukel syndrome) 6, KlF21A (Kinesin Family Member 21A) 8, COL2A1 (Collagen Type XXV Alpha 1 Chain) 7 and PHOX2A (Paired Like Homeobox 2a) 2 genes in different types of CFEOM.

Classic CFEOM shows bilateral ophthalmoplegia with the eyes fixed in an infraducted position about 20 to 30 degrees below the horizontal midline. But CFE-OM3 phenotype has more variable clinical features as unilateral eye involvement and may be able to raise the eyes above midline 9. Inheritance pattern of CFEOM5, CFEOM2 and Tukel syndrome is autosomal dominant but CFEOM1 and CFEOM3 are autosomal recessive 10.

The first time, Yamada et al reported mutations in the KIF21A in 45 patients with CFEOM1 phenotype 8.

This study for the first time reported association of c.2860C>T KIF21A in the CFEOM1A phenotype in an Iranian family.

Case Presentation

Proband was a 31-year-old man (III2) referred to Ophthalmology Department, Vasei Hospital on Dec. 2016 with severe bilateral restricted eye movements and ptosis since birth (Figure 1). His intellectual and social ability were satisfying and there were no other clinical symptoms as growth parameters abnormality, abdominal, respiratory and cardiovascular problems. Eye examination showed significant limitation of abduction, limitation of adduction and limitation of depression bilaterally. To compensate ptosis, 20 degree chin-up head position was noted. Fundoscopic observation detected no pigmentary retinopathy and optic atrophy. Pupillary function and anterior segment examinations were within normal limits. Due to the positive family history with similar ocular abnormalities across three generations (Figure 2), proband and his family received clinical genetic service.

Figure 1.

Figure 1.

External photograph of II:7, III:2, III:9.

Figure 2.

Figure 2.

Pedigree related to the family with clinically affected CFEOM (1A). (+/−): Affected, (−/−): Wild type.

Patient II:7 is a 54 year old man who was born with bilateral ophthalmoplegia and ptosis. Levator function was absent in both eyes. Primary vertical position of each eye was infraducted. Patient III:9 was a 14 year old boy who was born with typical signs of ptosis and complete restriction in eye movements. Ptosis was slightly improved after surgery at the age of 6 in the right eye.

All 3 patients had a normal cornea, iris, lens, and fundus appearance. Phenotype of the referring family has been suspected to be similar to the CFEOM 1. For time and cost saving, instead of doing Whole Exome Sequencing (WES) or performing Sanger sequencing on the known genes, according to the literature reviews, only KIF21A and TUBB3 were sequenced which are involved in the most common form of CFEOM.

Sanger sequencing

Ethical committee of Sabzevar University of Medical Sciences confirmed the study. Consent form was collected from all the members of the family that participated in the study. For performing molecular experiments, 5 ml peripheral blood was collected from each sample and was kept in EDTA tubes. According to the extraction kit (C.N. DN 8115C Sina colon, Iran), genomic DNA was extracted from peripheral blood. Considering the mutation reports of KIF21A and TUBB3 in the literatures, exons 8, 20, 21 of the KIF21A gene and exons 1, 2, 3, 4 of TUBB3 gene were amplified using sequence specific primers (Table 1). Optimal temperature conditions were as following: 5 min at 95°C, 35 cycles of 30 s at 95°C, 30 s at 57°C, and 1 min at 72°C. Then, Sanger sequencing was performed on purified amplicons (high throughput Applied Biosystems 3730XL sequencers). To analyze the results, the sequences were monitored using Finch TV software version 1.4.0.

Table 1.

TUBB3 and KIF21A primer sequences for conventional PCR

Gene (exon/s) Forward sequence Reverse sequence Amplicon size
tubulin beta-3(1) CAGCTCCTCTGGGAGACA CATCCCTTTGTTGCAGGTT 485 bp
tubulin beta-3(2) GAGGGCTAAAAGGCTTCACA GGTGCTGAGACCTGGTCAGT 272 bp
tubulin beta-3(3) CGGGCACAGAATTCAGAAA TCATGTGAGGAGCTGACCAT 300 bp
tubulin beta-3(4) TGCCCTTGGGATGTTCAG GGGATCCACTCCACGAAGTA 846 bp
tubulin beta-3(4) GTTCGATGCCAAGAACATGA AGCTCTTCTTGCCTGTCCAC 862 bp
KIF21A(8) TTTTAGCATTTTAGGTGCTTTT AAAGTGCCAGCCTTAGATGT 306 bp
KIF21A(20–21) TGTTGTACTTAAATGAAAAAATGGCTC AGAGAAATCTGAAAAGCAAGCAGG 794 bp

Results

Data showed a heterozygote mutation c.2860C>T in the exon 21 of the KIF21A. c.2860C>T mutation changed the 954th amino acid of KIF21A from Arginine to Tryptophan (p. Arg954Trp). For validating the pathogenic variant, segregation was extended on the rest of family members (wild type and patient individuals). Segregation results confirmed c.2860C>T variant in the patients (Figure 3).

Figure 3.

Figure 3.

Chromatographs of Sanger sequencing. The healthy parents harbor normal DNA sequences, whereas the patient with CFEOM exhibits a c.2860C>T mutation at the second nucleotide position of codon 954 (p.Arg954Trp) on exon 21 of the KIF21A gene locus.

Discussion

In this paper, for the first time, the association of pathogenic variant c.2860C>T in KIF21A gene in an Iranian family with positive history of CFEOM1A was reported. NM_001173464.1 (KIF21A): c.2860C>T is known in ClinVar, uniport and dbSNP databases as a pathogenic variant and predictor tool such as phyloP, Grantham, SIFT and Mutation Taster if this change is deleterious and disease causing [Alamut Visual version 2.9 (Interactive Biosoftware, Rouen, France)].

CFEOM1 is subdivided to CFEOM1A and CFEO-M1B with mutation in KIF21A and TUBB3, respectively 11. CFEOM1A is the most common form of CFEO-M1 with autosomal dominant inheritance pattern that is characterized by congenital non-progressive restrictive ophthalmoplegia and ptosis 12.

KIF21A with 38 exons is located on 12q12 chromosome. It proceeds microtubule-stabilization through balancing polymerization and depolymerization 13. Mutational analysis of KIF21A in CFEOM1 confirmed 13 different missense mutations (c.84C>G, c.1056C->G, c.1067T>C, c.2830G>C, c.2839A>G, c.2840T>G, c.2840T>C, c.2841G>A, c.2860C>T, c.2861G>A, c.2861G>T, c.3022G>C, c.3029T>C) and a deletion c.3000_3002delTGA (p.Asp1001del) at codon 1001 14,15. Mutated KIF21A probably leads to CFEOM1 through failure in transferring cargo essential to the development of the oculomotor axons, neuromuscular junction or extraocular muscles 8. Our data was in line with the previous reports and existing in silico predictors.

Chan et al genotyped a pedigree with CFEOM1 phenotype from Iran which they did not find any known variant 16. In figure 4, 3 of most common pathogenic variants are illustrated that disrupt the conserved regions of the KIF21A protein. Interestingly, in the present study, it was indicated that Iranian CFE-OM1A cases develop disease by the same way as cases from Japan, Hung Kung, America, and Europe. KIF21A is a causative gene in more than 50% of CFEOM1 phenotype in the case reports that were not hitherto pointed in Iranian families 14. Recurrence risk ratio of affected offspring is approximately 50% in each generation in CFEOM1.

Figure 4.

Figure 4.

KIF21A mutations. Scheme of the Kinesin protein structure and the relative most common variant locations of KIF21A.

Conclusion

Therefore, results of this study demonstrated that genetic clinicians should refer to the literature reviews to record the last update of known genes in the rare disease prior to do Whole Exome/Genome Sequencing (WES/WGS) which most of families couldn’t afford it. Sanger sequencing of known genes not only saves time and needs less cost but also facilitates prognosis, genetic counseling and Prenatal Diagnosis (PND).

Acknowledgement

We kindly acknowledge the technical supports of our colleagues in Department of Ophthalmology and Cellular and Molecular Research Center, Sabzevar University of Medical Sciences.

Footnotes

Conflict of Interest

The authors declare no conflict of interest.

References

  • 1.Engle EC, Goumnerov BC, McKeown CA, Schatz M, Johns DR, Porter JD, et al. Oculomotor nerve and muscle abnormalities in congenital fibrosis of the extraocular muscles. Ann Neurol 1997;41(3):314–325. [DOI] [PubMed] [Google Scholar]
  • 2.Nakano M, Yamada K, Fain J, Sener EC, Selleck CJ, Awad AH, et al. Homozygous mutations in ARIX (PHOX2A) result in congenital fibrosis of the extraocular muscles type 2. Nat Genet 2001;29(3):315–320. [DOI] [PubMed] [Google Scholar]
  • 3.Tischfield MA, Baris HN, Wu C, Rudolph G, Van Maldergem L, He W, et al. Human TUBB3 mutations perturb microtubule dynamics, kinesin interactions, and axon guidance. Cell 2010;140(1):74–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sener EC, Lee BA, Turgut B, Akarsu AN, Engle EC. A clinically variant fibrosis syndrome in a Turkish family maps to the CFEOM1 locus on chromosome 12. Arch Ophthalmol 2000;118(8):1090–1097. [DOI] [PubMed] [Google Scholar]
  • 5.Aubourg P, Krahn M, Bernard R, Nguyen K, Forzano O, Boccaccio I, et al. Assignment of a new congenital fibrosis of extraocular muscles type 3 (CFEOM3) locus, FEOM4, based on a balancedtranslocation t(2;13) (q37.3; q12.11) and identification of candidate genes. J M Genet 2005;42(3):253–259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tukel T, Uzumcu A, Gezer A, Kayserili H, Yuksel-Apak M, Uyguner O, et al. A new syndrome, congenital extraocular muscle fibrosiswith ulnar hand anomalies, maps to chromosome 21qter. J M Genet 2005;42(5):408–415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shinwari JM, Khan A, Awad S, Shinwari Z, Alaiya A, Alanazi M, et al. Recessive mutations in COL25A1 are a cause of congenital cranial dysinnervationdisorder. Am J Hum Genet 2015;96(1):147–152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yamada K, Andrews C, Chan WM, McKeown CA, Magli A, de Berardinis T, et al. Heterozygous mutations of the kinesin KIF21A in congenital fibrosis of the extraocular muscles type 1 (CFEOM1). Nat Genet 2003;35(4):318–321. [DOI] [PubMed] [Google Scholar]
  • 9.Whitman M, Hunter DG, Engle E. Congenital fibrosis of the extraocular muscles (CFEOM). Washington, Seattle; 1993–2018. 2004 Apr 27 [updated 2016 Jan 14]. [PubMed] [Google Scholar]
  • 10.Lu S, Zhao C, Zhao K, Li N, Larsson C. Novel and re-current KIF21A mutations in congenital fibrosis of the extraocular musclestype 1 and 3. Arch Ophthalmol 2008; 126(3):388–394. [DOI] [PubMed] [Google Scholar]
  • 11.Kaçar Bayram A, Per H, Quon J, Canpolat M, Ülgen E, Doğan H, et al. A rare case of congenital fibrosis of extraocular muscle type 1A due to KIF21A mutation with Marcus Gunnjaw-winking phenomenon. Eur J Paediatr Neurol 2015;19(6):743–746. [DOI] [PubMed] [Google Scholar]
  • 12.Luk HM, Lo IF, Lai CW, Ma LC, Tong TM, Chan DH, et al. Congenital fibrosis of extraocular muscle type 1A due to KIF21A mutation: first case report from Hong Kong. Hong Kong Med J 2013;19(2):182–185. [PubMed] [Google Scholar]
  • 13.Tiab L, d'Allèves Manzi V, Borruat FX, Munier F, Schorderet D. Mutation analysis of KIF21A in congenital fibrosis of the extraocular muscles (CFEOM) patients. Ophthalmic Genet 2004;25(4):241–246. [DOI] [PubMed] [Google Scholar]
  • 14.Chen H, Liu T, Zeng Z, Wang Y, Lin Y, Cheng L, et al. Clinical characteristics of a KIF21A mutation in a Chinese family with congenital fibrosis of the extraocular muscles type 1. Medicine (Baltimore) 2017;96(38):e8068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang P, Li S, Xiao X, Guo X, Zhang Q. KIF21A novel deletion and recurrent mutation in patients with congenital fibrosis of the extraocular muscles-1. Int J Mol Med 2011;28(6):973–975. [DOI] [PubMed] [Google Scholar]
  • 16.Chan WM, Andrews C, Dragan L, Fredrick D, Armstrong L, Lyons C, et al. Three novel mutations in KIF21A highlight theimportance of the third coiled-coil stalk domain in the etiology of CFEOM1. BMC Genet 2007; 8:26. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Avicenna Journal of Medical Biotechnology are provided here courtesy of Avicenna Research Institute

RESOURCES