Skip to main content
Oncology Letters logoLink to Oncology Letters
. 2018 Oct 4;16(6):6977–6987. doi: 10.3892/ol.2018.9549

The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co-infection using multiplex quantitative polymerase chain reaction

Prinya Prasongdee 1,2, Patcharaporn Tippayawat 1,3, Temduang Limpaiboon 1, Chanvit Leelayuwat 1, Molin Wongwattanakul 1, Patcharee Jearanaikoon 1,
PMCID: PMC6256370  PMID: 30546431

Abstract

Persistent infection with human papillomavirus (HPV) type 16 and 18 is known to be a major risk factor for cervical cancer. Increased prevalence of co-infection with these high-risk types has been observed in pre-cancerous and cancerous tissues. The determination of physical status and copy numbers of viruses is therefore useful in clinical settings. A simple multiplex quantitative polymerase chain reaction (qPCR) for HPV16/HPV18 co-infection in one tube reaction was established in the present study using TaqMan®-based PCR for E2 and E6 viral DNA. The detection range was up to 106 copies with 100% specificity and high precision (CV of cycle time <0.5%). The analytical accuracy and robustness were verified by competitive assay using an unequal mixture of HPV16/HPV18 DNA. No significant effect was demonstrated when compared with the simplex qPCR. The detection of physical status was evaluated in cervical samples, including 5 pre-cancerous and 15 cancerous samples. No significant difference was observed between simplex and multiplex qPCR (P=0.372). In conclusion, the developed multiplex qPCR method successfully demonstrated the viral status of the common HPV types in one tube. This assay will facilitate viral assessment and monitoring of cervical cancer associated with HPV16 and HPV18 co-infection.

Keywords: human papillomavirus type 16, human papillomavirus type 18, multiplex TaqMan® polymerase chain reaction, co-infection, pre-cancerous state, cervical cancer

Introduction

Cervical cancer (CXCA) is the fourth leading cause of cancer-associated mortality among females worldwide (1). The majority of CXCA cases are associated with high risk human papillomavirus (HR-HPV) infection. Among HR-HPV, HPV16 and HPV18 account for 70% of all CXCA cases worldwide (1), including in Asian populations (2). Epidemiological data revealed an increase in multiple HPV infection from 10% of CXCA cases in 2005 (3) to 65% in 2016 (35). However, these figures may reflect a higher sensitivity of detection, resulting in the co-infection of HPV16 and HPV18 being reported as the most common HR-HPV in Africa (6) and Asia (7), and specifically in Thailand (8), as 31.9, 20.8 and 27.8%, respectively. An increased odds ratio of HPV16 and 18 co-infection compared with single infection was demonstrated by Chaturvedi et al (9) and Trottier et al (10), but the opposite results were reported by Salazar et al (11). These controversial findings implied that other viral parameters, not only HPV genotype, may serve important roles in disease progression.

The physical state of HPV infection occurs as one of two forms: An episomal or an integrated form. The episomal state involves the complete life cycle of viral replication in the infected host cells, whereas the integrated form involves integration of HPV DNA into the host DNA, a major genetic event leading to cervical carcinogenesis (12). Viral integration and viral load have previously been reported to be biomarkers for cancer with high-grade cervical lesions (13). Several methods have been used for the detection of integrated HPV, including polymerase chain reaction (PCR) (14), in situ hybridization (15,16) and amplification of papillomavirus oncogene transcripts (APOT) (17). These are all qualitative measurements. Recently, we established a quantitative PCR of E2 and E6 genes to measure the viral load and physical status of HPV16 DNA in one tube (18). A ratio of E2/E6 gene of 1.0 is used to define the episomal form, while a decreased ratio (less than 1.0) indicates the integrated form, due to deletion of the E2 gene during viral integration. The present study demonstrated the benefit of using viral numbers and physical status as surrogate markers of cancer progression.

To the best of our knowledge, the present study was the first to report the simultaneous measurement of 4 genes, E2 and E6 genes of HPV16 and HPV18, in a single tube. The development of multiplex qPCR in the present study provides a total coverage of 70% of HR-HPV-associated CXCA, including single and co-infection of HPV16 and HPV18. The analytical performance of the multiplex qPCR was evaluated in clinical samples, compared with simplex qPCR.

Materials and methods

Samples

A total of 20 cervical tissues harboring single or co-infection of HPV16 and HPV18 were collected from 5 pre-cancerous lesions (mean, 42.2±6.6 years) and 15 cancerous lesions (mean, 49.5±13.7 years). Samples were collected between 2002 and 2004 under written informed consents approved by the Ethical Committee of Khon Kaen University, Khon Kaen, Thailand (approval no. HE562296) and between 2013 and 2014 approved by the the Ubonratchathani Cancer Hospital, Ubon Ratchathani, Thailand (approval no. CE012/2013). DNA samples were extracted using a QIAamp Viral DNA kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer's protocol. Extracted DNA was used for HPV16 and HPV18 screening by Nested Multiplex PCR, as previously described (19).

Cell culture

The human papillomavirus Caski and HeLa cell lines containing the integrated form of HPV16 (600 DNA copies per cell) and HPV18 (20–50 DNA copies per cell) were used as internal standard for determination of physical status of HPV16 and 18, respectively. HeLa cell line containing HPV18 and CaSki cell line containing HPV16 were used as HPV positive controls. Cells were cultured in 25 cm2 flasks at 37°C with 5% CO2 in Dulbecco's Modified Eagle Medium high glucose (DMEM-HG) media supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (10,000 U/ml penicillin and 10 mg/ml streptomycin; all Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). At 70% confluency, cells were trypsinized with 1 ml of 1X trypsin-EDTA at 37°C for 5 min. The cell pellets were collected and centrifuged at 2,000 rpm for 3 min and subsequently used for DNA extraction.

HPV16 and HPV18 integration status assay

Plasmids containing the whole genomes of HPV16, HPV18, HPV45 and HPV58 (PBR322 for HPV16 and HPV58, PGM4 for HPV18 and HPV45) were provided by Professor Pientong from the Department of Microbiology, Faculty of Medicine, Khon Kaen University. Purified recombinant plasmid copy numbers were estimated by a spectrophotometer concentration measurement (NanoDrop 2000; Thermo Fisher Scientific, Inc.). The DNA calculation formula was 6.02×1023 (copies/mol) xA260 (ng/ml)/(DNA length ×660)=copies/ml. Plasmid DNA was then diluted with sterile water to obtain between 106 and 102 copies, and was used to establish calibration curves for measuring E2 and E6 by multiplex qPCR using a TaqMan® probe assay (Bioneer Corporation, Daejeon, Korea). The oligonucleotide sequences of primers and probes were followed as previously described (20,21), with modifications to the quencher and reporter fluorescent dyes (Table I). E2 and E6 DNA were amplified using a qPCR thermocycler (Exicycler™; Bioneer Corporation). Each 50 µl reaction mixture contained a premix (AccuPower® DualStar™; Bioneer Corporation) with 0.4 µM probes and primers. The PCR reaction was initiated at 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 63°C for 60 sec. Reactions lacking DNA template were used as negative controls as previously described. Quantification of E2 and E6 genes were analyzed using the calibration curve plotted between the quantification cycle (Cq) on the x-axis and the logarithm of the standard copy number on the y-axis (102−106 copies). Linear regression equations were estimated as indicated in Fig. 1. The obtained Cq from samples were used to calculate E2 and E6 copies from these equations. Amplification efficiency was determined from the slope of log-linear calibration curve (10−1/slope−1) (22).

Table I.

Oligonucleotide sequences and TaqMan® probes used for amplification of E2 and E6 genes of HPV16 and HPV18.

HPV type Name Sequence (5′-3′) Amplified product length (bp) (Refs.)
HPV16 HPV16 E2 Forward primer AACGAAGTATCCTCTCCTGAAATTATTAG 82 Peitsaro et al, 2002 (20)
HPV16 E2 Reverse primer CCAAGGCGACGGCTTTG
HPV16 E2 Probe (TAMRA)-CACCCCGCCGCGACCCATA-(BHQ)
HPV16 E6 Forward primer GAGAACTGCAATGTTTCAGGACG 81
HPV16 E6 Reverse primer TGTATAGTTGTTTGCAGCTCTGTGC
HPV16 E6 gene Probe (Texus red)-CAGGAGCGACCCAGAAAGTTACCACAGTT-(BHQ)
HPV18 HPV18 E2 Forward primer AGAAGCAGCATTGTGGACCT 167 Damay et al, 2009 (21)
HPV18 E2 Reverse primer GGTCGCTATGTTTTCGCAAT
HPV18 E2 Probe (TeT)-TCAACC-CACTTCTCGGTGCAGC-(BHQ)
HPV18 E6 Forward primer TCACAACATAGCTGGGCACT 91
HPV18 E6 Reverse primer CTTGTGTTTCTCTGCGTCGT
HPV18 E6 Probe (FAM)-GCCATTCGTGCTGCAACCGA-(BHQ)

HPV, human papillomavirus; bp, base pairs.

Figure 1.

Figure 1.

Standard curves of multiplex quantitative polymerase chain reaction for E2 and E6 genes of HPV16 and HPV18. The analytical range was revealed to be 103 to 106 copies. HPV, human papillomavirus; SD, standard deviation.

Optimization of temperature for multiplex qPCR

Multiplex qPCR temperature for HPV16 (E2 and E6 genes) and HPV18 (E2 and E6 genes) was optimized. A mixture of 105 copies of plasmids containing the whole genomes of HPV16 and HPV18 was used to optimize the annealing temperature from 55 to 64°C. The temperature that produced the lowest Cq was selected as the optimal annealing temperature.

Evaluation of multiplex qPCR performances

Multiplex qPCR analytical range

Ten-fold dilutions of mixed HPV16 and HPV18 whole genomic DNA (from 102 to 106 copies) were used as templates for determining the analytical range.

Multiplex qPCR analytical imprecision

Within-run and between-run precision were each determined using low (103 copies) and high (106 copies) concentrations of whole genome HPV16 and HPV18 DNA mixtures.

Multiplex qPCR analytical specificity

Cross-reactivity with two other HPV genotypes, HPV45 and HPV58, was tested. No fluorescent signal indicated a lack of cross-reaction, and uninfected HPV DNA was used as a negative control.

Competitive effect of HPV16 and HPV18 in multiplex qPCR

A mixture of unequal concentrations of HPV16 and HPV18 DNA (from 103 to 106 copies) was used to evaluate competitive effects in multiplex qPCR. E2 and E6 copies obtained from unequal HPV16 and HPV18 templates (test) were compared to those determined using a single template of HPV16 or HPV18 (control) by a paired t-test. No significant difference (P>0.05) indicated no competitive effect.

Evaluation of physical status using multiplex qPCR in clinical samples

The cut-off value for an episomal form (complete E2 and E6 sequence) was first determined using plasmid DNA containing whole HPV16 and HPV18 genomes. The E2/E6 ratio was calculated by the 95% confidence interval (CI) and used to interpret physical status in clinical samples as previously described (18). To verify the accuracy of the multiplex qPCR of HPV16 and HPV18, 105 copies of Caski and HeLa cells containing pure integrated HPV16 and HPV18, respectively, were prepared according to the DNA calculation formula and used as internal standards for the integrated form. A total of 105 copies of whole plasmid genome HPV16 and HPV18 were used as internal standards for the episomal form. The two cell lines were provided by Professor Pientong. A total of 20 cervical samples with single and mixed infection were used to compare the copy number and physical status between the simplex and multiplex qPCR using paired t-tests and χ2 tests.

Statistical analysis

The linear regression equation was estimated from standard curves between viral copy number (y-axis) and cycle time (x-axis). The percentage of efficiency between 80–120% and correlation (R2) >0.98 were used to determine the standard curve. The comparison of viral copy number between multiplex and simplex was performed using paired t-tests, while physical status was compared by χ2 test. P<0.05 was considered to indicate a statistically significant difference. Statistical analysis was performed using SPSS 19 software (IBM Corp., Armonk, NY, USA) under a Khon Kaen University license.

Results

Multiplex qPCR performance for the detection of HPV16 and HPV18 (E2 and E6 genes)

The optimization of Cq was performed under annealing temperatures from 55 to 64°C, as demonstrated in Fig. 2. The optimal Cq for the E2 and E6 genes of HPV16 was 63°C, whereas the optimal Cq for HPV18 was between 55 and 64°C. Therefore, 63°C was used to construct a standard curve for HPV16 and HPV18 multiplex qPCR, as demonstrated in Fig. 1. According to the guidelines for validation of quantitative PCR methods, linear regression and correlation (R2) analyses for each gene revealed an acceptable efficiency of 109–115% (23). The analytical range was verified at 1,000-1,000,000 copies for HPV16 and HPV18, with average imprecision from 0.42 to 0.50% CV as demonstrated in Fig. 1. The imprecision of measured HPV copies is presented in Table II. The average CV of within-run and between-run was 10.2 and 12.1, respectively. No cross reactivity was observed with HPV58 and HPV45 (Fig. 3).

Figure 2.

Figure 2.

Optimization for (A) E2 and (B) E6 genes of HPV16, and (C) E2 and (D) E6 genes of HPV18. The optimal Cq for HPV16 and HPV18 was selected at 63°C. HPV, human papillomavirus; Cq, quantification cycle.

Table II.

Analytical imprecision of the HPV16 (E2 and E6 genes) and HPV18 (E2 and E6 genes) measurement using multiplex quantitative polymerase chain reaction.

HPV16 E2 gene HPV16 E6 gene


Precision Mean ± SD (CV%) Cq Mean ± SD (CV%) Copy number Mean ± SD (CV%) Cq Mean ± SD (CV%) Copy number
Within-run (n=12)a
Low levelc 32.41±0.18 (0.54) 961±127.1 (13.23) 33.67±0.17 (0.52) 1,084±149.1 (13.74)
High leveld 23.11±0.08 (0.35) 952,490±59,040.35 (6.19) 24.59±0.10 (0.39) 1,097,119±81,784.1 (7.45)
Between-run (n=15)b
Low levelc 32.61±0.20 (0.60) 973±141.36 (14.53) 34.26±0.19 (0.54) 929±137.45 (14.79)
High leveld 23.37±0.14 (0.59) 911,140±91,626.87 (10.06) 25.04±0.14 (0.55) 1,040,597±112,028.74 (10.77)

HPV18 E2 gene HPV18 E6 gene


Precision Mean ± SD (CV) Cq Mean ± SD (CV) Copy number Mean ± SD (CV) Cq Mean ± SD (CV) Copy number

Within-run (n=12)a
  Low levelc 33.47±0.17 (0.52) 1,159±160.1 (13.81) 34.83±0.18 (0.52) 1,067±144.35 (13.52)
  High leveld 24.61±0.07 (0.29) 1,123,790±60,126.32 (5.4) 25.73±0.11 (0.44) 1,023,242±86,472.54 (8.45)
Between-run (n=15)b
  Low levelc 34.03±0.19 (0.57) 996±147.1 (14.76) 34.77±0.19 (0.53) 958±134.18 (14.00)
  High leveld 25.00±0.11 (0.43) 992,011±81,890.14 (8.25) 25.42±0.13 (0.51) 1,054,498±101,053.01 (9.58)
a

12 replicates per experiment

b

Triplicate in 5 independent experiments

c

103 copies of HPV16 and HPV18 DNA

d

106 copies of HPV16 and HPV18 DNA. HPV, human papillomavirus; Cq, quantification cycle.

Figure 3.

Figure 3.

Analytical specificity of multiplex quantitative polymerase chain reaction. No cross reactivity was observed with 104 copies of HPV45 and HPV58. Uninfected HPV DNA was used as a negative control. HPV, human papillomavirus.

Evaluation of competitive effect of unequal HPV16 and HPV18 template concentrations in multiplex qPCR

To mimic the presence of HPV16 and HPV18 co-infection up to 1,000-fold difference in the same sample, measurement of mixed HPV16 and HPV18 DNA was compared in parallel with that of single HPV16 and HPV18. Different concentrations of HPV16 and HPV18 exhibited no effect on the quantification of E2 (P=0.319 and P=0.526, respectively) and E6 genes (P=0.347 and P=0.146, respectively), as demonstrated in Tables III and IV. Therefore, our established multiplex qPCR platform provided an accurate measurement for the presence of HPV16 and HPV18 co-infection.

Table III.

Competitive effect of unequal DNA copies between HPV16 and HPV18 on the measurement of HPV16 E2 and E6 genes using multiplex quantitative polymerase chain reaction.

HPVE2 gene HPVE6 gene


Unequal mixture HPV16 and HPV18 Single HPV16 Unequal mixture HPV16 and HPV18 Single HPV16
Copy Ratio Measured Copy of Measured copies Copy Ratio Measured Copy Measured copies
(HPV16:HPV18) copies (Test)a HPV16 (Control)a (HPV16:HPV18) copies (Test)a of HPV16 (Control)a
106:103 945,367 106 1,026,287 106:103 979,497 106 1,039,326
106:104 901,450 106 915,772 106:104 900,328 106 913,776
106:105 921,335 106 897,221 106:105 914,673 106 911,439
106:106 979,241 106 980,160 106:106 1,039,326 106 964,189
105:103 89,554 105 90,112 105:103 87,556 105 89,341
105:104 95,749 105 103,356 105:104 91,586 105 98,371
105:105 96,968 105 105,065 105:105 97,092 105 103,174
105:106 94,159 105 92,332 105:106 112,708 105 100,329
104:103 8,832 104 9,149 104:103 11,219 104 10,439
104:104 8,836 104 10,626 104:104 9,175 104 9,303
104:105 8,913 104 9,319 104:105 8,641 104 10,322
104:106 11,347 104 10,861 104:106 10,989 104 9,018
103:103 1,143 103 1,200 103:103 1,039 103 1,153
103:104 867 103 912 103:104 907 103 865
103:105 881 103 1,122 103:105 848 103 973
103:106 848 103 901 103:106 846 103 908
a

Non-significant differences between test and control for HPV16 E2 (P=0.319; paired Student's t-test) and HPV16 E6 (P=0.347; paired Student's t-test). HPV, human papillomavirus.

Table IV.

Competitive effect of unequal copies between HPV16 and HPV18 on the measurement of HPV18 E2 and E6 genes using multiplex quantitative polymerase chain reaction.

HPVE2 gene HPVE6 gene


Unequal mixture HPV18 and HPV16 Single HPV18 Unequal mixture HPV18 and HPV16 Single HPV18
Copy ratio Measured copies Copy of Measured copies of Copy ratio Measured copies Copy of Measured copies of
(HPV18:HPV16) of HPV18E2 (Test)a HPV18 HPV18E2 (Control)a (HPV18:HPV16) of HPV18E6 (Test)a HPV18 HPV18E6 (Control)a
106:103 1,135,661 106 1,075,620 106:103 1,015,464 106 1,107,241
106:104 1,097,976 106 1,181,450 106:104 1,107,170 106 1,125,579
106:105 877,385 106 1,135,265 106:105 911,742 106 893,768
106:106 1,092,086 106 993,922 106:106 965,678 106 1,040,114
105:103 104,611 105 96,998 105:103 90,546 105 94,778
105:104 101,164 105 113,785 105:104 97,952 105 113,933
105:105 105,464 105 101,469 105:105 110,175 105 87,996
105:106 102,760 105 113,715 105:106 87,492 105 107,587
104:103 9,129 104 8,789 104:103 10,201 104 9,746
104:104 9,550 104 9,443 104:104 9,732 104 10,395
104:105 8,639 104 9,988 104:105 10,403 104 8,665
104:106 10,700 104 9,812 104:106 8,910 104 10,550
103:103 912 103 1,120 103:103 937 103 1,056
103:104 936 103 1,078 103:104 910 103 938
103:105 849 103 831 103:105 901 103 833
103:106 896 103 1,168 103:106 869 103 1,063
a

Non-significant difference between test and control for HPV18E2 (P=0.526; paired t-test) and HPV18E6 (P=0.146; paired t-test). HPV, human papillomavirus.

Evaluation of physical status in clinical samples

Cut-off values for viral status were calculated as previously described by Wanram et al (18) and are shown in Table V. The E2/E6 ratio was identified as 0.78–1.10 and 0.85–1.18 for HPV16 and HPV18, respectively. An E2/E6 ratio of 0 was defined as the absolute integrated form, whereas E2/E6 >0 and less than the cut-off value was interpreted as the mixed form of episomal and integrated HPV (18). Comparisons of HPV16 and HPV18 copy numbers between the simplex and multiplex qPCR in CXCA samples are summarized in Table VI. No significant difference between simplex and multiplex qPCR was observed for HPV16 E2 and E6 (P=0.307 and P=0.288; paired t-test) and HPV18 E2 and E6 genes (P=0.396 and P=0252; paired t-test). The physical status obtained from multiplex qPCR was also compared with that from the simplex qPCR. The cut-off value for the episomal form of HPV16 (0.79–1.10) and HPV18 (0.85–1.18) was calculated as previously described for multiplex qPCR. Interpretation of physical status was similar in 95% (19/20) of cases between multiplex and simplex qPCR assays, and differed in one case, CX-1 (P=0.372; χ2 test; Table VI).

Table V.

Estimation of cut-off values (E2 and E6 ratios) for the interpretation of physical status using various concentrations of whole genome plasmid DNA from 104 to 106 copies.

HPV16 HPV18


No. Mixture of equal concentration of HPV16 and HPV18 E2 gene (copy) E6 gene (copy) E2/E6 E2 gene (copy) E6 gene (copy) E2/E6
1 103 1,115 1,103 1.01 1,153 1,233 0.94
2 103 1,115 1,185 0.94 1,019 1,210 0.84
3 103 908 1,044 0.87 1,193 1,211 0.99
4 103 1,168 1,169 1 1,155 1,134 1.02
5 103 1,038 1,047 0.99 1,146 1,179 0.97
6 104 8,882 10,814 0.82 10,760 9,858 1.09
7 104 8,789 10,438 0.84 9,187 9,408 0.98
8 104 9,019 10,379 0.87 8,703 9,062 0.96
9 104 9,233 9,268 1 8,513 8,220 1.04
10 104 9,117 9,337 0.98 9,687 11,622 0.83
11 105 94,603 105,819 0.89 110,462 107,970 1.02
12 105 108,055 108,928 0.99 107,699 102,882 1.05
13 105 88,246 100,449 0.88 106,389 98,269 1.08
14 105 87,938 105,370 0.83 114,166 112,276 1.02
15 105 106,246 100,978 1.05 109,971 113,442 0.97
16 106 1,098,531 1,059,641 1.04 1,086,195 991,320 1.1
17 106 926,410 982,153 0.94 1,097,976 996,524 1.1
18 106 912,783 1,076,185 0.85 1,085,161 927,645 1.17
19 106 1,020,080 931,143 1.1 1,086,195 1,005,826 1.08
20 106 940,240 997,234 0.94 1,146,435 1,142,588 1
Mean 0.94 Mean 1.01
SD 0.08 SD 0.08
Mean ± 2SD 0.78–1.10 Mean ± 2SD 0.85–1.18

HPV, human papillomavirus; SD, standard deviation.

Table VI.

Comparison of viral copy number and physical status determination between multiplex qPCR (test) and simplex qPCR (control) in 20 cervical tissues samples harboring single and co-infection of HPV16 and HPV18.

Simplex qPCR (Control) Multiplex qPCR (Test)


Copies/ng DNA Physical status Copies/ng DNA Physical status Copies/ng DNA Physical status Copies/ng DNA Physical status








CXCA samples (HPV) HPV16 E2 HPV16 E6 E2/E6 ratio (0.79)a Interpretation HPV18 E2 HPV18 E6 E2/E6 ratio (0.81)b Interpretation HPV16 E2 HPV16 E6 E2/E6 ratio (0.78)c Interpretation HPV18 E2 HPV18 E6 E2/E6 ratio (0.85)d Interpretation
PCX 1 (16) 5,139 498,762 0.01 Mixed 4,196 470,492 0.01 Mixed
PCX 2 (16) 312 32,190 0.01 Mixed 203 30,613 0.01 Mixed
PCX 3 (16) 5,815 6,087 0.96 Episomal 5644.39 6196.23 0.91 Episomal
PCX 4 (18) 191,065 0 Integrated 153,540 0 Integrated
PCX 5 (18) 9,380 0 Integrated 11,897 0 Integrated
CX 1 (16) 118,584 157,522 0.75 Mixed 108,968 133,776 0.81 Episomal
CX2 (16) 30,353 26,353 1.15 Episomal 32,588 24,118 1.35 Episomal
CX 3 (16) 24,237 0 Integrated 26,814 0 Integrated
CX 4 (16) 38,041 44,122 0.86 Episomal 38,788 48,108 0.81 Episomal
CX 5 (16) 6,209 6,721 0.92 Episomal 6,879 7,395 0.93 Episomal
CX 6 (18) 15,649 45,455 0.34 Mixed 16,857 42,240 0.4 Mixed
CX 7 (18) 73,929 0 Integrated 70,912 0 Integrated
CX 8 (18) 74,237 56,271 1.32 Episomal 71,243 54,039 1.32 Episomal
CX 9 (16+18) 855 3,468 0.25 Mixed 326 521 0.63 Mixed 1,014 3,919 0.26 Mixed 205 420 0.49 Mixed
CX 10 (16+18) 39,350 123,420 0.32 Mixed 266 410 0.65 Mixed 36,000 155,429 0.23 Mixed 113 237 0.48 Mixed
CX 11 (16+18) 2,834,887 6,008,765 0.47 Mixed 4,090 3,087 1.32 Episomal 2,592,857 5,571,429 0.47 Mixed 3,064 2,414 1.27 Episomal
CX 12 (16+18) 4,122 14,979 0.28 Mixed 403 478 0.84 Episomal 3,305 17,360 0.19 Mixed 371 356 1.04 Episomal
CX 13 (16+18) 120 277 0.43 Mixed 219 415 0.53 Mixed 92 227 0.41 Mixed 197 339 0.58 Mixed
CX 14 (16+18) 9,124 24,510 0.37 Mixed 1,034 0 Integrated 8,733 20,600 0.42 Mixed 853 0 Integrated
CX 15 (16+18) 512,980 0 Integrated 981 0 Integrated 488,500 0 Integrated 741 0 Integrated
Internal control
HPV16; Caski 0 95,859 0 Integrated 0 0 0 0 91,791 0 Integrated 0 0 0
HPV18; HeLa 0 0 0 0 102,825 0 Integrated 0 0 0 0 110,275 0 Integrated
Whole plasmid HPV16 109,334 102,675 1.06 Episomal 106,445 105,988 1.00 Episomal
Whole plasmid HPV18 99,545 98,9655 1.01 Episomal 100,599 99,453 1.01 Episomal

The cut-off value of physical status interpretation for

a

HPV16

b

HPV18 using simplex qPCR; for

c

HPV16

d

HPV18 using multiplex qPCR. There was no significant difference in copy numbers between simplex and multiplex qPCR for HPV16 E2 gene (P=0.307; paired t-test); HPV16 E6 gene (P=0.288; paired t-test). There was no significant difference in copy numbers between simplex and multiplex qPCR for HPV18 E2 gene (P=0.396; paired t-test); HPV18 E6 gene (P=0.252; paired t-test). There was no significant difference in physical status from multiplex qPCR compared with simplex qPCR (P=0.372; χ2 test). Caski and HeLa cell lines containing 100,000 copies of E6 gene were used as internal standard for integrated HPV16 and HPV18/Whole plasmid HPV16 and HPV18 100,000 copies of E2 and E6 genes were used as internal standard for episomal HPV16 and HPV18. qPCR, quantitative polymerase chain reaction; HPV, human papillomavirus; PCX, pre-cancerous cervical tissues; CX, cervical cancer tissues.

Discussion

Multiple HR-HPV infection, particularly HPV16 and HPV18 co-infection, is now a concern due to its effects on cervical neoplasia development. The failure rate of treatment was previously reported to be increased by 5-fold in multiple infection (57%), compared with single infection (12%) (24). Therefore, a suitable risk assessment among patients with persistent multiple HR-HPV infection is required. To assess the risk, viral load and viral physical status may be used for cancer prognosis. In the present study, a one tube qPCR assay for HPV16 and HPV18 co-infection was successfully established with acceptable performance in terms of specificity, accuracy and precision.

Upon performing a literature search for multiplex qPCR of 4 genes in one tube, one study by Zhao et al (25) was identified. The authors reported detection of 4 viral DNAs: HPV16 (E6 gene), HPV18 (E6 gene), HSV1 and HSV2, with an improved detection limit at 10 copies compared with the present study. The difference in the detection limit may result from the different size of viral DNA standard. Small fragments of viral DNA (66–139 bp) were used as standard in the study undertaken by Zhao et al, whereas the whole HPV genome (10728–12267 bp) was used in the present study. Accordingly, the small size template has an advantage for amplification when compared with the whole genome. Therefore, our established technique better represents the real viral infection in a clinical setting. To resolve this limitation, more DNA template may be adjusted. The accuracy of interpretation, including possible cross reactivity, was verified using DNA of known viral status from cervical Caski and HeLa cell lines. HPV58 and HPV45 were selected for cross reactivity according to the top 4 common HR-HPV types (HPV 16, 18, 45 and 58), covering 90% of cases among Thai women (26). Accurate quantification was not only demonstrated via comparison with simplex qPCR, but it was also revealed that there was no competitive effect of an unequal mixed HPV DNA template from 10- to 1,000-fold (Tables III and IV).

Furthermore, the comparison of viral physical status between simplex and multiplex qPCR in clinical samples achieved 95% (19/20 samples) agreement in the results of viral physical status. The different physical status of CX1 was caused by the variation of E2/E6 ratio between simplex (0.75) and multiplex (0.81) which closed to the cut-off value for episomal form (0.79 and 0.78) resulting in discrepancy results as mixed form and episomal form, respectively. This limitation of accuracy occurred at values close to the cut-off values.

In conclusion, the increased incidence of HPV16 and HPV18 co-infection is a high-risk factor for CXCA progression in patients with persistent HR-HPV infection. Therefore, the successful development of multiplex qPCR for detecting HPV16 and HPV18 viral load and physical status in a single tube would provide a significant benefit in terms of cost effectiveness and shorter assay time in the clinic. To assess the potential of using this assay as a risk assessment for cancer progression in patients with single and co-infection with HPV16 and HPV18, a larger sample size with clinical outcome data should be included in future studies. In particular, pre-cancerous and early cancerous cases harboring high risk factors should be followed up frequently with monitoring of risk factors.

Acknowledgements

Clinical stage of samples were provided by Dr Metee Wongsena (Chief of Gynecologic Cancer Department, Ubonratchathani Cancer Center, Ubonratchathani, Thailand) and Dr Pissamai Yuenyao (Srinagarind Hospital, Khon Kaen, Thailand).

Glossary

Abbreviations

CXCA

cervical cancer

HR-HPV

high risk human papillomavirus

qPCR

quantitative polymerase chain reaction

CV

coefficient of variation

Funding

The present study was supported by the Targeted Research Fund of Khon Kaen University from the The National Research Council of Thailand (Khon Kaen, Thailand) and the Post-doctoral training program for MW (grant no. 58330) from the Graduate School of Khon Kaen University, Thailand.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

PJ supervised, designed and assisted in the coordination of the present study. PP performed the research, the analysis and prepared data for the first draft of manuscript. TL and CL made substantial contributions in the conception and experimental design. MW was involved in data analysis, interpretation of data and drafting the final manuscript. PT assisted with data interpretation and revising the final manuscript. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethical Committee of Ubonratchathani Cancer Hospital (approval no. CE012/2013; Ubonratchathani, Thailand) and Khon Kaen University (approval no. HE562296; Kho Kaen, Thailand).

Patient consent for publication

All patients provided written informed consent for the publication of the present study.

Competing interests

The authors declare that they have no competing interests.

References

  • 1.Bruni L, Barrionuevo-Rosas L, Albero G, Serrano B, Mena M, Gómez D, Muñoz J, Bosch FX, de Sanjosé S. ICO information centre on HPV and cancer (HPV Information Centre). Human papillomavirus and related diseases in the World. Summary Report. 2017 Jul 30; [Google Scholar]
  • 2.Bruni L, Barrionuevo-Rosas L, Albero G, Serrano B, Mena M, Gómez D, Muñoz J, Bosch FX, de Sanjosé S. ICO information centre on HPV and cancer (HPV Information Centre). Human papillomavirus and related diseases in Asia. Summary Report. 2017 Jul 27; [Google Scholar]
  • 3.Li N, Franceschi S, Howell-Jones R, Snijders PJ, Clifford GM. Human papillomavirus type distribution in 30,848 invasive cervical cancers worldwide: Variation by geographical region, histological type and year of publication. Int J Cancer. 2011;128:927–935. doi: 10.1002/ijc.25396. [DOI] [PubMed] [Google Scholar]
  • 4.Wu EQ, Yu XH, Zha X, Zhang GN, Wang JH, Fan Y, Tang YY, Zhao ZX, Wu YG, Kong W. Distribution of human papillomavirus genotypes in archival cervical lesions in eastern inner Mongolian autonomous region. China Int J Gynecol Cancer. 2009;19:919–923. doi: 10.1111/IGC.0b013e3181a58fef. [DOI] [PubMed] [Google Scholar]
  • 5.Youssef MA, Abdelsalam L, Harfoush RA, Talaat IM, Elkattan E, Mohey A, Abdella RM, Farhan MS, Foad HA, Elsayed AM, et al. Prevalence of human papilloma virus (HPV) and its genotypes in cervical specimens of Egyptian women by linear array HPV genotyping test. Infect Agent Cancer. 2016;11:1750–9378. doi: 10.1186/s13027-016-0053-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Téguété I, Dolo A, Sangare K, Sissoko A, Rochas M, Beseme S, Tounkara K, Yekta S, De Groot AS, Koita OA. Prevalence of HPV 16 and 18 and attitudes toward HPV vaccination trials in patients with cervical cancer in Mali. PLoS One. 2017;12:e0172661. doi: 10.1371/journal.pone.0172661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Siddiqa A, Zainab M, Qadri I, Bhatti MF, Parish JL. Prevalence and genotyping of high risk human papillomavirus in cervical cancer samples from Punjab, Pakistan. Viruses. 2014;6:2762–2777. doi: 10.3390/v6072762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Suthipintawong C, Siriaunkgul S, Tungsinmunkong K, Pientong C, Ekalaksananan T, Karalak A, Kleebkaow P, Vinyuvat S, Triratanachat S, Khunamornpong S, Chongsuwanich T. Human papilloma virus prevalence, genotype distribution, and pattern of infection in Thai women. Asian Pac J Cancer Prev. 2011;12:853–856. [PubMed] [Google Scholar]
  • 9.Chaturvedi AK, Katki HA, Hildesheim A, Rodríguez AC, Quint W, Schiffman M, Van Doorn LJ, Porras C, Wacholder S, Gonzalez P, et al. Human papillomavirus infection with multiple types: Pattern of coinfection and risk of cervical disease. J Infect Dis. 2011;203:910–920. doi: 10.1093/infdis/jiq139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Trottier H, Mahmud S, Costa MC, Sobrinho JP, Duarte- Franco E, Rohan TE, Ferenczy A, Villa LL, Franco EL. Human papillomavirus infections with multiple types and risk of cervical neoplasia. Cancer Epidemiol Biomark Prev. 2006;15:1274–1280. doi: 10.1158/1055-9965.EPI-06-0129. [DOI] [PubMed] [Google Scholar]
  • 11.Salazar KL, Zhou HS, Xu J, Peterson LE, Schwartz MR, Mody DR, Ge Y. Multiple human papilloma virus infections and their impact on the development of high-risk cervical lesions. Acta Cytol. 2015;59:391–398. doi: 10.1159/000442512. [DOI] [PubMed] [Google Scholar]
  • 12.Pett M, Coleman N. Integration of high-risk human papillomavirus: A key event in cervical carcinogenesis? J Pathol. 2007;212:356–367. doi: 10.1002/path.2192. [DOI] [PubMed] [Google Scholar]
  • 13.Cricca M, Morselli-Labate AM, Venturoli S, Ambretti S, Gentilomi GA, Gallinella G, Costa S, Musiani M, Zerbini M. Viral DNA load, physical status and E2/E6 ratio as markers to grade HPV16 positive women for high-grade cervical lesions. Gynecol Oncol. 2007;106:549–557. doi: 10.1016/j.ygyno.2007.05.004. [DOI] [PubMed] [Google Scholar]
  • 14.Wu EQ, Zha X, Yu XH, Zhang GN, Wu YG, Fan Y, Ren Y, Kong LQ, Kong W. Profile of physical status and gene variation of human papillomavirus 58 genome in cervical cancer. J Gen Virol. 2009;90:1229–1237. doi: 10.1099/vir.0.008227-0. [DOI] [PubMed] [Google Scholar]
  • 15.Qureshi MN, Bolick D, Ringer PJ, Spagler FL, Zimmerman G. HPV testing in liquid cytology specimens: Comparison of analytic sensitivty and specificity for in situ hybridization and chemiluminescent nucleic acid testing. Acta Cytol. 2005;49:120–126. doi: 10.1159/000326118. [DOI] [PubMed] [Google Scholar]
  • 16.Fujii T, Masumoto N, Saito M, Hirao N, Niimi S, Mukai M, Ono A, Hayashi S, Kubushiro K, Sakai E, et al. Comparison between in situ hybridization and real-time PCR technique as a means of detecting the integrated form of human papillomavirus 16 in cervical neoplasia. Diagn Mol Pathol. 2005;14:103–108. doi: 10.1097/01.pas.0000162755.84026.9f. [DOI] [PubMed] [Google Scholar]
  • 17.Chaiwongkot A, Pientong C, Ekalaksananan T, Vinokurova S, Kongyingyoes B, Chumworathayi B, Patarapadungkit N, Siriaunkgul S, von Knebel Doeberitz M. Detection of the human papillomavirus 58 physical state using the amplification of papillomavirus oncogene transcripts assay. J Virol Methods. 2013;189:290–298. doi: 10.1016/j.jviromet.2013.02.011. [DOI] [PubMed] [Google Scholar]
  • 18.Wanram S, Limpaiboon T, Leelayuwat C, Yuenyao P, Guiney DG, Lulitanond V, Lulitanond V, Jearanaikoon P. The use of viral load as a surrogate marker in predicting disease progression for patients with early invasive cervical cancer with integrated human papillomavirus type 16. Am J Obstet Gynecol. 2009;201:79.e1–e7. doi: 10.1016/j.ajog.2009.03.013. [DOI] [PubMed] [Google Scholar]
  • 19.Sotlar K, Diemer D, Dethleffs A, Hack Y, Stubner A, Vollmer N, Menton S, Menton M, Dietz K, Wallwiener D, et al. Detection and typing of human papillomavirus by E6 nested multiplex PCR. J Clin Microbiol. 2004;42:3176–3184. doi: 10.1128/JCM.42.7.3176-3184.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Peitsaro P, Johansson B, Syrjanen S. Integrated human papillomavirus type 16 is frequently found in cervical cancer precursors as demonstrated by a novel quantitative real-time PCR technique. J Clin Microbiol. 2002;40:886–891. doi: 10.1128/JCM.40.3.886-891.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Damay A, Didelot-Rousseau MN, Costes V, Konate I, Ouedraogo A, Nagot N, Foulongne V, Van de Perre P, Mayaud P, Segondy M. Viral load and physical status of human papillomavirus (HPV) 18 in cervical samples from female sex workers infected with HPV 18 in Burkina Faso. J Med Virol. 2009;81:1786–1791. doi: 10.1002/jmv.21554. [DOI] [PubMed] [Google Scholar]
  • 22.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  • 23.Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Roosens N, Morisset D. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol. 2014;37:115–126. doi: 10.1016/j.tifs.2014.03.008. [DOI] [Google Scholar]
  • 24.Munagala R, Donà MG, Rai SN, Jenson AB, Bala N, Ghim SJ, Gupta RC. Significance of multiple HPV infection in cervical cancer patients and its impact on treatment response. Int J Oncol. 2009;34:263–271. [PubMed] [Google Scholar]
  • 25.Zhao Y, Cao X, Tang J, Zhou L, Gao Y, Wang J, Zheng Y, Yin S, Wang Y. A novel multiplex real-time PCR assay for the detection and quantification of HPV16/18 and HSV1/2 in cervical cancer screening. Mol Cell Probes. 2012;26:66–72. doi: 10.1016/j.mcp.2012.01.003. [DOI] [PubMed] [Google Scholar]
  • 26.Bruni L, Barrionuevo-Rosas L, Albero G, Serrano B, Mena M, Gómez D, Muñoz J, Bosch FX, de Sanjosé S. ICO Information Centre on HPV and Cancer (HPV information centre). Human papillomavirus and related diseases in Thailand. Summary Report. 2017 Jul 27; [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Oncology Letters are provided here courtesy of Spandidos Publications

RESOURCES