ESR2 Is Essential for Gonadotropin-Induced Kiss1 Expression in Granulosa Cells

Abstract

Hypothalamic expression of Kiss1 plays an essential role in the onset of puberty, gonadal development, and ovulation. Estrogens regulate the expression of Kiss1 in the hypothalamus through estrogen receptor-α. Kiss1 is also expressed in the ovary, where its expression correlates with the onset of puberty and progression of the estrous cycle. To date, estrogen regulation of Kiss1 expression in the ovary has not been investigated. We recently observed that gonadotropin-induced Kiss1 expression was absent in Esr2-null rat ovaries even though Esr1 was present. Wild-type granulosa cells abundantly expressed Kiss1 and oocytes expressed the Kiss1 receptor. We characterized estrogen receptor-β (ESR2) regulation of Kiss1 expression in granulosa cells by identifying granulosa cell–specific transcript variants and potential regulatory regions. The Kiss1 promoter, an upstream enhancer, and a downstream enhancer all possessed conserved estrogen response elements (EREs) and showed active histone marks in gonadotropin-stimulated granulosa cells. The transcriptionally active Kiss1 promoter, as well as the enhancers, also revealed enrichment for ESR2 binding. Furthermore, activity of a Kiss1 promoter construct was induced after overexpression of ESR2 and was blocked upon mutation of an ERE within the promoter. Finally, pregnant mare serum gonadotropin and human chorionic gonadotropin administration induced phosphorylation of ESR2 and upregulated the AP-1 proteins FOSL2 and JUNB in granulosa cells. Activated MAPK ERK2 was associated with the ESR2 phosphorylation in granulosa cells, and AP-1 factors could synergistically activate the Kiss1 promoter activity. These gonadotropin-induced changes paralleled Kiss1 expression in granulosa cells. We conclude that gonadotropin-stimulated Kiss1 expression in granulosa cells is dependent on both the activation of ESR2 and the upregulation of AP-1.

Kisspeptins are essential gatekeepers for the onset of puberty (1, 2) and critical regulators of ovulation (3–5). Kisspeptins bind to KISS1 receptor (KISS1R/GPR54) in the hypothalamus and within the hypothalamic-pituitary axis and confer the upstream signals to GnRH release that subsequently regulates gonadotropin secretion (1). The peripheral action of gonadotropins at the level of the gonads leads to estrogen production, and estrogens in turn regulate hypothalamic Kiss1 gene expression (6–8).

Kiss1 is expressed within the hypothalamic anteroventral periventricular nucleus (AVPV), arcuate nucleus (ARC), periventricular nucleus, and anterodorsal preoptic nucleus (9, 10). Studies have shown that Kiss1 expression is also widely detected throughout the central nervous system and other organs including ovary, placenta, testes, prostate, liver, lung, kidney, and pancreas (11–13). The potential roles of extrahypothalamic kisspeptins are diverse (14), but it remains unknown whether Kiss1 expression in extrahypothalamic tissues is also regulated by estrogen signaling.

In addition to the pivotal role of kisspeptins in hypothalamic control of reproductive function, a putative role of kisspeptin signaling in the direct control of ovarian function, including follicular development, oocyte maturation, steroidogenesis, and ovulation, has been suggested (4, 15–19). Expression of Kiss1 in the ovary shows changes with estrous cyclicity (15), and kisspeptin concentration in follicular fluid correlates with follicular as well as serum estrogen levels (18). It has been suggested that intrafollicular kisspeptins may play an important role in follicle maturation (4, 18). Recent studies have demonstrated that administration of exogenous kisspeptin-54 can induce egg maturation in women undergoing in vitro fertilization (20–22). Kisspeptins can also enhance the in vitro maturation of oocytes (23). Moreover, Kiss1r haploinsufficiency led to premature ovarian failure in mutant mice, which was not rescued by gonadotropin replacement, further suggesting an important role of kisspeptin signaling within the ovary (16). Kiss1r-mediated signaling has been reported as one of the factors contributing to activating PLC/IP3-dependent calcium mobilization, required for oocyte survival and maintenance of follicular integrity (17).

Several studies have investigated the molecular mechanisms regulating Kiss1 gene expression within hypothalamic nuclei (4, 24, 25). It has been reported that estrogen receptor-α (ESR1) but not estrogen receptor-β (ESR2) regulates the expression of Kiss1 in hypothalamic neurons (6, 8, 26). Previous studies have suggested that estrogens may play a role in regulating the expression of ovarian kisspeptins (15, 18). However, the potential regulatory mechanisms have not yet been investigated. We have recently observed that gonadotropin-induced Kiss1 gene expression in granulosa cells was absent in Esr2-null (Esr2^−/−) rats (27), suggesting an essential regulatory role for ESR2. In the current study, we identified a granulosa cell–specific Kiss1 promoter and characterized the promoter regulation by ESR2 and the potential role of ESR2 in gonadotropin-induced Kiss1 expression in granulosa cells.

Materials and Methods

Animal models

All procedures were performed in accordance with the protocols approved by the University of Kansas Medical Center Animal Care and Use Committee. Wild-type and Esr2^−/− Holtzman Sprague-Dawley rats were included in this study. Esr2^−/− rats were generated by targeting exon 3 in the Esr2 gene, as described earlier (28). Deletion of exon 3 resulted in a frameshift and null mutation in the ESR2 coding sequence (28). All animals were screened for presence of the mutation by PCR using tail-tip DNA samples (RED Extract-N-Amp Tissue PCR Kit; Sigma-Aldrich, St. Louis, MO) and primers targeting the flanking intron sequences (28).

Collection of granulosa cells, oocytes, and thecal interstitial tissue

Four-week-old Esr2^−/− and age-matched wild-type female rats were used to evaluate gonadotropin-induced follicular development and ovulation. Synchronized follicular growth was performed by intraperitoneal injection of 30 IU pregnant mare serum gonadotropin (PMSG; Lee Biosolutions, Maryland Heights, MO). Forty-eight hours after the PMSG injection, 30 IU of human chorionic gonadotropin (hCG; Lee Biosolutions) was injected intraperitoneally. Animals were euthanized before and after PMSG injections, as well as 4 and 10 hours after hCG injections, and ovaries were dissected and collected in M199 media (Hyclone; GE Healthcare Life Science, Pittsburgh, PA). After the oviducts, ovarian fat pad, and membranes were removed, ovaries were washed with M199 media and placed in a 35-mm noncoated sterile Petri dish containing the media with protease and phosphatase inhibitor cocktails (Sigma-Aldrich). Ovarian follicles were punctured under stereomicroscopic observation with 25-G needles fitted to 1 mL syringe and pressed to release the oocytes and the granulosa cells. Thecal interstitial tissues were separated, washed with M199 media in a microcentrifuge tube, and immediately frozen at −80°C until RNA or protein extraction. Cumulus granulosa cells were removed from the oocytes by repeated pipetting followed by repeated capillary suction under an inverted microscope. After the oocytes were removed in a microcentrifuge tube and stored at −80°C, remaining granulosa cells were passed through a 40-µm strainer (Fisher Scientific, Lenexa, KS) and collected by centrifugation. Washed granulosa cells were either frozen −80°C until RNA or protein extraction or processed for chromatin immunoprecipitation (ChIP) assays.

Detection of gene expression at mRNA level

Gene expression at the mRNA level was evaluated by conventional RT-PCR, quantitative RT-PCR (RT-qPCR), and RNA sequencing (RNA-seq) analyses. Total RNA was isolated from the granulosa cells with TRI Reagent (Sigma-Aldrich) and cDNAs were prepared from 2 µg of total RNA with oligo random primers and Superscript II reverse transcriptase (Thermo Fisher Scientific, Grand Island, NY). Conventional PCR amplification of cDNA was done in a 25 μL reaction volume by using DreamTaq Green DNA polymerase (Thermo Fisher Scientific). RT-qPCR amplification of cDNAs was carried out in a 20-μL reaction mixture containing Applied Biosystems Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). Amplification and fluorescence detection of RT-qPCR were carried out on Applied Biosystems QuantStudio Flex 7 Real Time PCR System (Thermo Fisher Scientific). The ΔΔCT method was used for relative quantification of target mRNA normalized to 18S RNA. A list of quantitative PCR (qPCR) primer sequences is shown in Table 1.

Table 1.

Primers Used in qRT-PCR Studies

Symbol	Reference mRNA	Forward Primer	Reverse Primer	Amplicon
Kiss1	NM_181692.1	26F-TGCTGCTTCTCCTCTGTGTG	174R-AGGCTTGCTCTCTGCATACC	149 bp
Kiss1r	NM_001301151	502F-CTGGGAGACTTCATGTGCAA	614R-GGGAACACAGTCACGTACCA	113 bp
Esr1	NM_012689.1	44F-TTCGAGCACATTCCTTCCTT	235R-GCTTTGGTGTGAAGGGTCAT	191 bp
Esr2	NM_012754	1101F-GAAGCTGAACCACCCAATGT	1310R-CAGTCCCACCATTAGCACCT	209 bp
Erk2	NM_053842	274F-GCCGCGCTACACTAATCTCT	464R-TGCCGATGATGTTCTCATGT	190 bp
Fosl2	NM_001013146	107F-CTCCCGAAGAGGAGGAGAAG	332R-GGACTGATTTTGCACACAGG	226 bp
JunB	NM_021836	1148F-TGGAGGACAAGGTGAAGACA	1436R-GCCAGAGTCCAGTGTGTGAG	289 bp
Rn18s	NR_046237.1	1622F-GCAATTATTCCCCATGAACG	1744R-GGCCTCACTAAACCATCCAA	123 bp

RNA-seq data were previously generated and analyzed (27, 29). Briefly, granulosa cells isolated 10 hours after hCG treatment of PMSG-primed immature rats were used for the RNA-seq analysis (27, 29). Granulosa cells were isolated as described above, and total RNA was purified with TRI Reagent (Sigma-Aldrich). We used 500 ng of total RNA for the RNA-seq library preparation. Libraries were prepared with the TruSeq standard mRNA kit (Illumina, San Diego, CA) according to the manufacturer’s instructions. The cDNA libraries were sequenced at the Molecular Biology Core Laboratory of Mayo Clinic (Rochester, MN). RNA-seq data were analyzed with the CLC Genomics Workbench (Qiagen Bioinformatics, Germantown, MD) to identify the differentially expressed genes. For this study, reads per kilobase million values were extracted from data deposited to Sequence Read Archive, under accession number SRX4060980-SRX4060980.

Identification of Kiss1 regulatory sequences in granulosa cells

The Kiss1 transcription start site in rat granulosa cells was detected by a modified 5′ rapid amplification of cDNA ends (RACE) PCR and sequencing of the PCR products (30, 31). Briefly, 2 μg total RNA from granulosa cells was reverse transcribed with a gene-specific primer located on the last exon of Kiss1 gene. The 3′ end of the first strand of cDNA was polyadenylated, and a second strand of cDNA was synthesized by template switching (TS) PCR with a TS oligo with poly dT sequences. Then the double-stranded cDNA products were PCR amplified with TS oligo and gene-specific primers and cloned into a TA cloning vector (Promega, Madison, WI) and sequenced (Genewiz, South Plainfield, NJ). This step was complemented by conventional RT-PCR with variant specific forward primers and a common reverse primer. All the primers used in RT, RACE-PCR, and RT-PCR processes are shown in Tables 2 and 3. After we determined the transcription start site, Kiss1 proximal promoter and distant enhancer sequences were compared with known promoter and enhancer sequences (25), and bioinformatic analyses (rVista 2.0, MULTITF) (32) were done to identify the potential binding sites for ESR2 and other transcriptional regulators.

Table 2.

Primers for 5′ RACE PCR to Determine the Kiss1 Transcription Start Site

Exon	Chromosome Location	Forward Primer	Reverse Primer/Gene-Specific Primer	Application
Exon 3	Ch13: 50529847	Not applicable	3R-CTTTTGCCAGGCATTAACGA	First strand cDNA synthesis
TSS	Not applicable	QT.Fd-AGCAGTGGTATCAACGCAGAA-TTTTTTTTTTTTTTTTTT	Not applicable	Second strand/5′ cDNA end synthesis
TSS-Exon 3	Not applicable; Ch13: 50529847	QO.Fd-AGCAGTGGTATCAACGCAGAA	3R-CTTTTGCCAGGCATTAACGA	5′ cDNA end amplification

Abbreviations: Ch, chromosome; TSS, transcription start site.

Table 3.

Primers for Conventional RT-PCR to Detect Kiss1 Transcript Variants

Exon	Chromosome Location	Forward Primer	Reverse Primer	Amplicon
Exon 2-3	Ch13: 50529847-50532103	2F-ATGATCTCGCTGGCTTCTTG	3R-CTTTTGCCAGGCATTAACGA	147 bp
Exon 1-3	Ch13: 50529847-50535078	1F-CTCAGTGTGCTCCAACTACC	3R-CTTTTGCCAGGCATTAACGA	322 bp
				247 bp

Abbreviation: Ch, chromosome.

Transcriptionally active histone marks within the Kiss1 locus

Kiss1 promoter and enhancer sites were screened for active histone marks of H3K27ac and H3K4Me3 enrichment by ChIP. ChIP assays were performed on granulosa cells isolated from wild-type rat ovaries 48 hours after PMSG followed by 4 hours after hCG administration. Briefly, granulosa cells were isolated from ovarian follicles as described above and fixed with 0.75% formaldehyde for 10 minutes at room temperature and quenched with 0.125 M glycine for 5 minutes. Fixed cells were washed twice with cold PBS containing 0.5% IGEPAL CA-630 and 0.5% Triton X-100 and resuspended in cold Lysis Buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40; catalog no. sc-45000; Santa Cruz Biotechnology, Dallas, TX) in the presence of phenylmethylsulfonyl fluoride and protease inhibitor cocktail (Sigma-Aldrich) and kept on ice for 15 minutes. Crude nuclear extracts were collected by microcentrifugation at 4°C (2000g) for 5 minutes and resuspended in Lysis Buffer High Salt (1XPBS; 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS; catalog no. sc-45001; Santa Cruz Biotechnology) in the presence of phenylmethylsulfonyl fluoride and protease inhibitor cocktail (Sigma-Aldrich) and sonicated for 60 cycles (20 seconds on, 59 seconds off) at 70% amplitude to produce an average fragment size range of 300 to 600 bp. Immunoprecipitation was performed with 5 µg antibody [anti-H3K27ac , catalog no. 8173, RRID: AB_10949503 (33); anti-H3K4me3, catalog no. 9751, RRID:AB_2616028; (34); and normal rabbit IgG, catalog no. 2729, RRID:AB_1031062 (35) all from Cell Signaling Technology, Danvers, MA] conjugated to 20 µL protein A/G magnetic beads (Dynabeads; Thermo Fisher Scientific) overnight. Bead-chromatin complexes were washed with Low Salt Buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), High Salt Buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl), LiCl Buffer (0.25 M LiCl, 1% IGEPAL, 1% deoxycholic acid, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1), and TE Buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), with each wash performed twice for 5 minutes. Cell lysis, sonication, immunoprecipitation, and cleanup steps were all performed at 4°C. Finally, chromatin DNA was eluted from the magnetic beads with 200 µL of elution buffer (1% SDS, 0.1 M NaHCO₃), treated with RNase and proteinase K, and protein-DNA crosslinks were reversed with the addition of 12 µL 5M NaCl and heating in a shaker incubator overnight and purified with Qiaquick columns (Qiagen). DNA was eluted in 100 µL of 10 mM Tris-HCl pH 8.0, and 2.5 µL aliquots were used in qPCR analyses. qPCR primers for the target sites are shown in Table 4.

Table 4.

Primers for ChIP-qPCR for 5′ Enhancer, Promoter, and 3′ Enhancer Sites in Rat Kiss1 Gene

Target	Chromosome Location	Forward Primer	Reverse Primer	Amplicon
5′ Enhancer	Ch13: 50552612-50552768	GCGAAAGGCTCATACACACA	CAGTCACCTGCCCAGATTTC	157 bp
Promoter site 1	Ch13: 50535655-50536033	CCTCCACCAGAATTGACTCC	CCCCCTTCCTAACAACTGCT	172 bp
Promoter site 2	Ch13: 50535275-50535440	CCATCCAAGGCTGTTCTCAT	TTGGCAGAGAAAGGCAAGTC	166 bp
3′ Enhancer	Ch13: 50526910-50527070	TCAGGTTGTGCTTGCTTACG	GTGCTTCCTCCTTTGCTGAC	161 bp

Abbreviation: Ch, chromosome.

ESR2 regulation of Kiss1 promoter activity

The regulatory role of ESR2 on Kiss1 promoter was determined by its binding to Kiss1 promoter and enhancer sequences and by activation of a Kiss1 promoter-reporter construct. ESR2 binding to Kiss1 promoter or enhancer sequences was detected by ChIP assays (as described above), whereas regulation of promoter activity by ESR2 was assessed by promoter-reporter assays. Reporter assays were performed in a spontaneously immortalized rat granulosa cell line (SIGC) obtained from Prof. Robert C. Burghardt (Texas A&M University, College Station, TX) (36). Wild type or DNA-binding domain deleted (DBD^−/−) Esr2 coding sequences (28) subcloned into a lentiviral vector pLV-EF1a-IRESneo (37) were stably transduced into SIGC cells to assess transcriptional activation potential of Kiss1 promoter by ESR2. A 1.5-kbp or 0.4-kbp fragment of the rat Kiss1 promoter was cloned into the Kpn I and Xho I sites of pGL4.25 firefly luciferase vector (Promega). PCR primers for subcloning the Kiss1 promoter into pGL4.25 vector are listed in Table 5. Potential ESR2 binding sites [estrogen response element (ERE)] in the Kiss1 promoter were identified with rVista 2.0 MULTITF (32). A putative ERE site (AGGTCAgatTGGCCT) within the 1.5-kbp Kiss1 promoter was mutated (ATTAGTgatATGAAT) with Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). Oligonucleotides used for mutagenesis of the promoter are listed in Table 6. For the promoter-reporter assays, 100 ng of the promoter-reporter vectors were transfected into SIGC cells expressing wild-type ESR2, mutant ESR2, or vector control with Lipofectamine 2000 (Thermo Fisher Scientific). A Renilla vector (pGL4.74[hRluc/TK]) was used as an internal control. Twenty-four hours after transfection, cells were stimulated with 10 nM 17β estradiol for an additional 24 hours. Standard dual-luciferase assays were performed on the cell lysates, with dual-luciferase reporter assay reagents (Promega).

Table 5.

PCR Primers for Cloning the Kiss1 Promotor Into pGL4.25 Reporter Vector

Target	Chromosome Location	Forward Primer	Reverse Primer	Amplicon
−0.4 kbp Kiss1 promoter	Ch13: 50535090-50535438	ggtaccGGCAGAGAAAGGCAAGTCAT	ctcgagGCTCCTGGGCTTCCTCTAT	348 bp
−1.5 kbp Kiss1 promoter	Ch13: 50535090-50536569	ggtaccAGCAACCTTGAGGGAAGAA	ctcgagGCTCCTGGGCTTCCTCTAT	1479 bp

Sequences in lowercase letters indicate restriction enzyme sites for cloning.

Abbreviation: Ch, chromosome.

Table 6.

PCR Primers for Mutating the ERE Site in Kiss1 Promoter

Target	Chromosome Location	Forward Primer	Reverse Primer
Kiss1 promoter ERE	Ch13: 50535090-50536569	ATatgaatCCACCAGAATTGACTCCTTG	CactaaTGGCTTCTTTCTCTCAGAGAGG

Sequences in lowercase letters indicate mutant ERE sites.

Abbreviation: Ch, chromosome.

Assessment of hCG/LH/choriogonadotropin receptor signaling in Kiss1 regulation

The link between hCG/LH/choriogonadotropin receptor (LHCGR) stimulation and ESR2-signaling with transcriptional regulation of Kiss1 was studied by assessing changes in MAPK phosphorylation and expression of AP-1 factors. We also investigated the phosphorylation of ESR2 after hCG administration. Expression of mRNAs was detected by RT-qPCR (as described above), whereas proteins were evaluated by Western blotting. For Western blotting, primary granulosa cell lysates were prepared in 1× SDS sample buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 42 mM dithiothreitol, 10% glycerol, and 0.01% bromophenol blue; Cell Signaling Technology), sonicated to shear DNA and reduce viscosity and then heat denatured. Proteins were separated on 4% to 20% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Membranes were blocked with 5% milk and incubated with primary antibodies for 1 hour at room temperature. Membranes were subsequently incubated with the following primary antibodies at the appropriate dilution in blocking buffer: anti-pESR2 (catalog no. ab109122; Assay Biotechnology, Little Rock, AR; RRID: AB_10681401; 1:2000) (38), anti-ESR2 (catalog no. 05-824; EMD Millipore, Burlington, MA; RRID: AB_11212759; 1:5000) (39), anti-pERK2 (catalog no. 4370; Cell Signaling Technology; RRID: AB_2315112; 1:2000) (40), anti-ERK2 (catalog no. 4695; Cell Signaling Technology; RRID: AB_390779; 1:2000) (41), anti-JUNB (catalog no. sc-8051; Santa Cruz Biotechnology; RRID: AB_2130023; 1:1000) (42), anti-FOSL2 (catalog no. TA809661; Origene Technologies Inc., Rockville, MD; RRID: AB_2744660; 1:1000) (43), and anti-ACTB (catalog no. A5441; Sigma-Aldrich; RRID: AB_476692; 1:30,000) (44). ACTB was detected as the loading control. Membranes were washed, blocked, and incubated with peroxidase-conjugated anti-mouse, or anti-rabbit secondary antibodies (Jackson Immunoresearch, West Grove, PA) at a dilution of 1:25,000 to 50,000, and immunoreactivity signals were visualized with Luminata Crescendo Western HRP substrate (Millipore Sigma, Burlington, MA). Western blot signal intensities were quantified by ImageJ analyses (National Institutes of Health, Bethesda, MD; https://imagej.nih.gov/ij/). Phosphorylated estrogen receptor-β (pESR2) signals were normalized with ESR2, and phosphorylated ERK2 (pERK2) signals were normalized with ERK2. ACTB signals were used to normalize the signals of FOSL2 and JUNB. The signal intensities detected in the PMSG-primed hCG 4-hour group were presented as relative fold over the PMSG group.

Activated ERK2 interaction with ESR2

We further investigated whether activated ERK2 targets ESR2 in granulosa cells isolated from PMSG-primed hCG-treated rats. Activated ERK2 interaction with ESR2 was detected by coimmunoprecipitation of pERK1/2 in granulosa cell proteins. Granulosa cells collected from PMSG-hCG treated wild-type rat ovaries in the presence of protease and phosphatase inhibitor cocktails (Sigma-Aldrich) were lysed in nondenaturing buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na₃VO₄, and 1 µg/mL leupeptin) (cell lysis buffer; catalog no. 9803; Cell Signaling Technology) for preparation of protein samples. Cell lysates were briefly sonicated to shear genomic DNA. After sonication, the cell lysates were centrifuged (10,000g) at 4°C for 10 minutes, and the supernatants were collected for immunoprecipitation assays. Protein samples were precleared with normal rabbit IgG (catalog no. 2729; Cell Signaling Technology) and protein A magnetic beads (Dynabeads; Thermo Fisher Scientific) to prevent nonspecific binding. An aliquot of the lysates was preserved to use as input, and for each immunoprecipitation reaction, lysates prepared from granulosa cells collected from one animal equivalent in 1 mL of lysis solution was used. Immunoprecipitation was performed overnight with a pERK antibody (catalog no. 4370; Cell Signaling Technologies; 1:50 dilution) or equivalent amount of normal rabbit IgG at 4°C on a rotating device. Then 20 µL of protein A magnetic beads (Dynabeads; Thermo Fisher Scientific) was added to each reaction tube and incubated at 4°C on a rotating device for another 4 hours. The magnetic beads were pelleted out by placing in a magnetic separation rack, and the pellet was washed eight times with cell lysis buffer (catalog no. 9803; Cell Signaling Technologies). After the final wash, the pellets were suspended in 150 µL of 1XSDS sample buffer (catalog no. 7722; Cell Signaling Technology). Immunoprecipitation samples were boiled for 10 minutes and separated from magnetic beads, and Western blot analyses were performed with pERK, ESR2, and pESR2 antibodies as described above.

AP-1 activation of Kiss1 promoter

Potential AP-1 binding sites (AP-1 response element) in the Kiss1 promoter were identified with rVista 2.0 MULTITF (32). Enrichment of JUNB binding within the Kiss1 promoter locus was investigated by ChIP assays with a rabbit monoclonal antibody (catalog no. 3753; Cell Signaling Technology; RRID: AB_2130002; 1:50 dilution) (45). ChIP assays were performed in granulosa cells isolated from wild-type rats 4 hours after hCG treatment as described above. qPCR primers for the target sites are shown in Table 4.

Regulation of Kiss1 promoter activity by AP-1 factors (JUNB and FOSL2) was assessed by promoter-reporter assays. An empty pGL4.25 firefly luciferase vector (Promega) or the pGL4.25 vector containing a 1.5-kbp fragment of the rat Kiss1 promoter was used in the reporter assays. Reporter assays were performed in SIGC cells as described above. Briefly, 100 ng of the empty pGL4.25 firefly luciferase vector or the promoter-reporter vector was cotransfected into SIGC cells with 100 ng of empty vector, JUNB, FOSL2, or both JUNB and FOSL2 expression vectors with Lipofectamine 2000 (Thermo Fisher Scientific). A Renilla vector (pGL4.74[hRluc/TK]) was used as an internal control. Twenty-four hours after transfection, transfection media was replaced with fresh cell culture media and incubated for an additional 24 hours. Standard dual-luciferase assays were performed on the cell lysates, with dual-luciferase reporter assay reagents (Promega).

Statistical analysis

Each experimental group consisted of a minimum of six rats, and the procedures were repeated at least two times for reproducibility of the results. The experimental results are expressed as mean ± SE. The results were analyzed for one-way ANOVA, and the significance of mean differences was determined by Duncan post hoc test, with P ≤ 0.05 considered a significant level of difference. All statistical calculations were done with SPSS 22 (IBM, Armonk, NY).

Results

Gonadotropins stimulate Kiss1 expression in the rat ovary

Kiss1 gene expression was analyzed in ovary samples collected from prepubertal rats treated with exogenous gonadotropins (Fig. 1A). Gonadotropin treatment induced expression of Kiss1 in rat ovaries; however, expression Kiss1r remained unchanged (Fig. 1B). Kiss1 expression increased remarkably 4 hours after hCG injection and remained elevated at 10 hours after hCG (Fig. 1B). Expression of Kiss1 and Kss1r was further examined in theca and granulosa cells, as well as oocytes isolated from gonadotropin treated ovaries. Compared with theca cells, granulosa cells and oocytes expressed higher levels of Kiss1 mRNA (Fig. 1C). In contrast, expression of Kiss1r was detected predominantly in the oocytes (Fig. 1D). Interestingly, expression of Esr2 but not Esr1 correlated with Kiss1 mRNA levels in granulosa cells and oocytes (Fig. 1E and 1F).

Figure 1.

Expression of Kiss1 is induced by gonadotropin administration. (A) Four-week-old wild-type female rats were treated with gonadotropins, and the ovaries were collected at the indicated time points for RNA isolation and qRT-PCR analyses. (B) Kiss1 expression increased significantly 4 h after hCG injection and remained elevated at 10 h after hCG. However, the expression of Kiss1r did not show any changes after gonadotropin stimulation. (C) Ovaries were collected 4 h after hCG administration for the isolation of oocytes, granulosa cells, and thecal-interstitial tissues. qRT-PCR analyses showed that Kiss1 expression was significantly higher in granulosa cells and oocytes compared with theca cells. (D) But expression of Kiss1r was detected exclusively in the oocytes. (E) Expression of Esr1 was significantly higher in theca cells compared with granulosa cells or oocytes. (F) In contrast, expression of Esr2 was significantly higher in granulosa cells and oocytes coinciding with Kiss1 expression. qRT-PCR data are represented as mean ± SEM. n = 6. *P ≤ 0.05. GC, granulosa cell.

Gonadotropins failed to induce Kiss1 expression in the Esr2^−/− rat ovary

RNA-seq results showed that expression of Kiss1 was highly downregulated (−260 fold, false discovery rate P = 0.0002) in gonadotropin-treated Esr2^−/− granulosa cells from PMSG-hCG primed immature animals 10 hours after hCG (Fig. 2A and 2B). Unlike wild-type ovaries, gonadotropin treatment failed to induce Kiss1 expression in Esr2^−/− ovaries (Fig. 2C). Conversely, expression of Kiss1r was slightly higher in the Esr2^−/− ovaries before and after gonadotropin treatment; however, it was not statistically significant (Fig. 2D). Kiss1 expression was absent in Esr2^−/− granulosa cells and oocytes (Fig. 2E) isolated 4 hours after hCG injection. However, expression of Kiss1r in granulosa cells or oocytes was comparable between the wild-type and Esr2^−/− rats (Fig. 2F).

Figure 2.

ESR2 is essential for gonadotropin-induced Kiss1 expression in rat granulosa cells. (A, B) RNA-seq analyses identified Kiss1 as one of the highly downregulated genes [−260 fold, false discovery rate (FDR) P = 0.0002] in gonadotropin-induced rat granulosa cells. (C) Gonadotropin-induced upregulation of Kiss1 expression was absent in Esr2^−/− rat ovaries. (D) Although Kiss1r expression in Esr2^−/− ovaries appeared elevated, it was not statistically significant. (E) Induction of Kiss1 expression was absent in Esr2^−/− granulosa cells and oocytes, but (F) Kiss1r expression was not affected in Esr2^−/− granulosa cells or oocytes after gonadotropin stimulation. qRT-PCR data represent the mean ± SEM. n = 6. *P ≤ 0.05.

Identification of granulosa cell–specific Kiss1 promoter and enhancers

A granulosa cell–specific Kiss1 transcription start site was identified with a modified 5′ RACE PCR. Sequencing of the RACE PCR products showed that the transcription start site is identical to the previously reported Kiss1 transcription start site in kisspeptin neurons from the mouse (25) (Fig. 3A and 3B). Like murine kisspeptin neurons, rat granulosa cells expressed two transcript variants due to an alternative splicing of the second exon (Fig. 3B). RT-PCR using exon-specific primers further verified that granulosa cells express two transcript variants (Fig. 3C). It has previously been reported that the proximal promoter region and the distant 5′ and 3′ enhancers of the murine Kiss1 gene possess conserved ERE sites (25). To evaluate this within the rat gene, ChIP assays were performed on gonadotropin-stimulated (4 hours after hCG) rat granulosa cells with anti-ESR2, anti-H3K27ac, and anti-H2K4me3 rabbit monoclonal antibodies and normal rabbit IgG as a negative control. Both the proximal promoter and the enhancers showed marked enrichment for ESR2 binding (Fig. 3E–3G), which was associated with enriched histone marks of H3K27ac (Fig. 3H–3J) and H2K4me3 (Fig. 3K–3M). These findings suggest that ESR2 can bind to and regulate Kiss1 in rat granulosa cells.

Figure 3.

Assessment of chromatin activation marks and ESR2 binding to Kiss1 regulatory sequences in rat granulosa cells. (A) Schematic presentation of transcription start sites and transcript variants of Kiss1 expressed in rat granulosa cells, which are based on the (B) cDNA sequences obtained by a modified 5′ RACE PCR. (C) Conventional RT-PCR results also confirmed the expression of two transcript variants of Kiss1 in rat granulosa cells. ChIP assays were performed on gonadotropin-stimulated rat granulosa cells with anti-ESR2, anti-H3K27ac, and anti-H2K4me3 rabbit monoclonal antibodies. Normal rabbit IgG was used as a negative control. (D) Schematic representation of Kiss1 gene locus showing a 3′ enhancer region (~8 kbp downstream of the start site), promoter with an ERE site (~0.5 kbp upstream of the start site), and a 5′ enhancer region (~17 kbp upstream of Kiss1 start-site). ChIP-qPCR results demonstrated relative enrichment of (E–G) ESR2, (H–J) H3K27ac, and (K–M) H3K4me3 at the 3′ enhancer, promoter with ERE, and 5′ enhancer sites. ChIP-qPCR data are presented as mean ± SEM. n = 3. *P ≤ 0.05. chr, chromosome; TSS, transcription start site; Var, variant.

Kiss1 promoter regulation by ESR2 in granulosa cells

We further investigated the mechanisms that led to failure of Kiss1 expression in granulosa cells in absence of ESR2 expression. We identified that the Kiss1 proximal promoter possesses an ERE ~0.5 kbp upstream of the transcription start site and subsequently investigated its functional significance. An immortalized rat granulosa cell line (SIGC) was used for Kiss1 promoter-reporter assays. SIGC cells were stably transduced with lentiviral vectors expressing wild-type or DBD^−/− rat ESR2 or a vector control (Fig. 4A and 4B). Kiss1 promoter activity was assessed after transfecting promoter-reporter constructs carrying different lengths of Kiss1 promoters (Fig. 4D–4G) and in the absence or presence of estradiol. Promoter constructs with (−1.5 kb) or without (−0.4 kb) ERE sites exhibited similar reporter activity in SIGC transfected with an empty pLV-EF1a-IRES-Neo vector (Fig. 4D) and were unresponsive to estradiol. Activity of the −1.5 Kb Kiss1 promoter harboring an ERE site was markedly upregulated in SIGC cells expressing wild-type ESR2 and treated with estradiol (Fig. 4E) but not in cells expressing a DBD^−/− ESR2 (Fig. 4F). Importantly, a promoter construct with a mutant ERE sequence failed to exhibit any such promoter induction in SIGC cells expressing the wild-type ESR2 (Fig. 4G).

Figure 4.

ESR2 regulation of Kiss1 promoter activity in rat granulosa cells. An SIGC was used for Kiss1 promoter-reporter assays. SIGC cells were stably transduced with lentiviral vectors expressing wild-type or DBD^−/− rat ESR2. (A) qRT-PCR and (B) Western blot analyses confirmed the ectopic expression of Esr2 in rat SIGC cells. (C) Schematic diagram of Kiss1 promoter indicating presence of a potential ESR2 binding site (ERE). (D, E) Luciferase assays were performed after transfection of the empty pGL4.12 vector or pGL4.25 reporter constructs carrying different lengths of Kiss1 promoters, as shown in the left panels. Promoter constructs with or without ERE sites exhibited similar reporter activity in (D) SIGC transfected with the empty pGL4.12 vector, whereas it was markedly upregulated in (E) SIGC cells expressing wild-type ESR2 but not in (F) cells expressing a DBD^−/− ESR2. However, promoter constructs harboring a mutant ERE site did not exhibit such upregulation in (G) SIGC cells expressing wild-type ESR2. Luciferase activity data are presented as fold induction relative to that of empty pGL4.12 vector. Light and dark yellow bars indicate the absence and presence of estradiol in culture media. Each bar represents mean ± SEM of four independent experiments. Luc, luciferase; Wt, wild-type.

Gonadotropin-induced Kiss1 expression in granulosa cells

Finally, we explored the link between hCG/LHCGR signaling and ESR2 activation that induces Kiss1 expression in rat granulosa cells. We observed that although the expression of ESR2 (Fig. 5A and 5B) or ERK2 (Fig. 5D and 5E) did not change after hCG administration, gonadotropin stimulation resulted in phosphorylation of ESR2 (Fig. 5B and 5C) and ERK2 (Fig. 5E and 5F) in granulosa cells. hCG also markedly induced the expression of the AP-1 transcription factors FOSL2 (Fig. 5G–5I) and JUNB (Fig. 5J–5L).

Figure 5.

Establishing a link between hCG/LHCGR signaling and ESR2 activation that induces Kiss1 expression in rat granulosa cells. Four-week-old wild-type female rats were injected with 30 IU PMSG, and 48 h after PMSG administration, 30 IU of hCG was injected intraperitoneally. Granulosa cells were isolated 48 h after PMSG treatment or 4 h after hCG treatment in PMSG-primed rats. (A, D, G, and J) Total RNAs purified from granulosa cells were used for RT-qPCR analyses, and (B, E, H and K) protein extracts were subjected to Western blot analyses. Western blot data from three different Western blots performed on six independent samples were quantified by (C, F, I and L) ImageJ analyses. (A, B) Esr2 mRNA and protein levels in wild-type rat granulosa cells 48 h after PMSG injection did not show any significant difference from that of 4 h after hCG injection in PMSG-primed rats. (B, C) However, pESR2 (S105) protein levels were significantly higher 4 h after hCG injection. (D, E) Erk2 mRNA and protein levels in wild-type rat granulosa cells 48 h after PMSG injection were also not different from those of 4 h after hCG injection in PMSG-primed rats. (E, F) However, pERK2 (T185/Y187) protein levels were significantly higher after hCG injection. In contrast, expression of Fosl2 and JunB was markedly upregulated in granulosa cells after hCG injection at both (G, J) mRNA and (H, I, K, L) protein levels. RT-qPCR and Western blot signal quantification data are presented as mean ± SEM. n = 6. *P ≤ 0.05.

We observed that pERK2 interacted with ESR2 in granulosa cells isolated from PMSG-hCG–treated rats (Fig. 6A). Presence of pESR2 was also detected in the pERK2 interactome complex (Fig. 6A). Direct binding of the AP-1 transcription factor JUNB was detected in the Kiss1 promoter locus of granulosa cells isolated from PMSG-hCG–treated rats (Fig. 6B). Furthermore, activity of the −1.5 Kb Kiss1 promoter harboring an AP-1 RE site was markedly upregulated in SIGC cells expressing either JUNB or FOSL2 (Fig. 6E). Remarkably, expression of both JUNB and FOSL2 together resulted in a synergistic upregulation of Kiss1 promoter activity (Fig. 6E).

Figure 6.

Activated ERK2 interacts with ESR2, and AP-1 factors can activate Kiss1 promoter. Protein complex formation was determined by a coimmunoprecipitation assay using protein extracts prepared from granulosa cells isolated from PMSG-primed, hCG-treated immature rats. Immunoprecipitation was performed with a rabbit monoclonal antibody to pERK1/2 or normal rabbit IgG. The immunoprecipitates were then subjected to Western blot analyses with pERK1/2, ESR2, and pESR2 antibodies. (A) We observed that pERK2 was coimmunoprecipitated with ESR2. (B) ChIP assays were performed on gonadotropin-stimulated rat granulosa cells with an anti-JUNB rabbit monoclonal antibody. Normal rabbit IgG was used as a negative control. ChIP-qPCR results demonstrated a relative enrichment of JUNB at the Kiss1 promoter. (C) Schematic diagram of Kiss1 promoter indicating presence of a potential ESR2 binding (ERE) and AP-1 binding sites. Luciferase assays were performed after cotransfecting (D) the empty pGL4.12 luciferase vector or (E) pGL4.25 vector carrying 1.5 kb of the Kiss1 promoter along with AP-1 factors JUNB or FOSL2 into SIGC cells. (D, E) Empty pGL4.12 vector exhibited a minimal induction of luciferase activity after either JUNB or FOSL2 overexpression, whereas (E) the relative luciferase activity of the reporter constructs with 1.5 kb of Kiss1 promoter harboring an AP-1 RE site showed a marked upregulation when both JUNB and FOSL2 were cotransfected. Relative luciferase data are presented as mean ± SEM of three independent experiments in duplicate wells. n = 6. *P ≤ 0.05. Luc, luciferase.

Discussion

Estrogen signaling can regulate hypothalamic Kiss1 by either activating or repressing gene expression (6–8). In the AVPV nucleus, estrogens activate Kiss1 expression, whereas in the ARC, estrogens repress it (24, 25, 46, 47). Both negative and positive regulation of hypothalamic kisspeptin neurons is mediated by ESR1 (6, 46, 48, 49). In contrast to what is occurring in the hypothalamus, we discovered that gonadotropin-induced Kiss1 expression in granulosa cells is dependent on and induced by ESR2.

Administration of gonadotropins, particularly hCG, stimulates Kiss1 gene expression in the ovary; however, the expression of Kiss1r remains unchanged. Previous reports have shown that Kiss1 and Kiss1r receptor are expressed in all the cellular compartments in the ovary (19, 50). In contrast, we detected Kiss1 expression in rat granulosa cells and oocytes, and Kiss1r only in the oocytes, suggesting that intraovarian kisspeptins may act on oocytes during follicle maturation but only during and after the LH surge. This possibility is supported by previous studies reporting that kisspeptins produced in the ovaries may regulate oocyte growth and maturation (16, 17). We identified that expression of Kiss1 correlates with the expression of Esr2 in granulosa cells and oocytes but not with Esr1 expression. This finding is highly suggestive of an important regulatory role for ESR2 in gonadotropin-induced Kiss1 expression in the ovary that cannot be achieved by ESR1. Our RNA-seq data also demonstrated that Esr2^−/− granulosa cells did not induce Kiss1 expression, even though estrogen is being produced by the follicles (27). This finding was corroborated in the current study in that expression of Kiss1 could not be induced in rat granulosa cells or oocytes in the absence of ESR2 expression. In this regard, regulation of ESR1-dependent Kiss1 expression in AVPV or ARC nuclei (6, 46, 48, 49) differs from that of granulosa cells or oocytes.

The Kiss1 gene has been reported to use alternative transcription start sites and express multiple transcript variants through alternative splicing (25, 51, 52). In this study, we identified the granulosa cell–specific transcription start site of Kiss1. Interestingly, this transcription start site was identical to the Kiss1 start site reported in kisspeptin neurons of the mouse (25). We detected two different transcript variants of Kiss1 in rat granulosa cells, which are in line with the observations in mouse kisspeptins neurons (25). These transcripts have differing 5′ untranslated sequence but encode the same primary amino acid sequence. The rat Kiss1 promoter also showed a high degree of homology with the mouse promoter, including a conserved ERE site in the proximal promoter, an upstream 5′ enhancer, and a downstream 3′ enhancer sequence (25). Enrichment of active histone marks including H3K4me3 and H3K27Ac was detected in the Kiss1 promoter, as well as both enhancer sites in gonadotropin-stimulated rat granulosa cells. These regions were also associated with enriched binding of ESR2 (Kiss1 promoter and enhancer sites) and indicate that the Kiss1 gene locus is a direct target of ESR2. Binding to these cognate ERE sites, ESR2 plays an essential regulatory role in gonadotropin-induced Kiss1 expression in granulosa cells. Because of the similarity in the conserved ERE sites, we speculate that the molecular mechanisms used by ESR2 may have similarities to the mechanisms that have been shown for ESR1-mediated positive or negative regulation of Kiss1 expression in AVPV or ARC nuclei (24–26, 47, 53, 54). Nonetheless, it is highly likely that ESR1 and ESR2 recruit and interact with different cohorts of nuclear proteins in the hypothalamus and ovary.

To further confirm the role of ESR2 in Kiss1 promoter regulation, luciferase reporter assays were performed in an immortalized rat granulosa cell line (SIGC). Although a 0.4-kbp proximal promoter exhibited a basal level of promoter activity (greater than that of a promoterless control), it was independent of ESR2 expression and induction by estradiol. In contrast, the 1.5-kbp fragment of the Kiss1 promoter harboring an ERE site showed marked upregulation of reporter activity upon ESR2 overexpression and exposure to estradiol. Our results are in line with the human Kiss1 promoter, where maximum activity was detected with reporter construct containing 1.0 kbp of upstream promoter sequence (55). Loss of estradiol induced promoter activity in SIGC cells expressing DBD-mutant ESR2, and after mutating the ERE site within the promoter highlights the critical role played by ESR2 in regulating the Kiss1 promoter in granulosa cells.

Although the expression of Kiss1 in granulosa cells or oocytes is ESR2 dependent, our data indicate that it is induced only after the hCG administration. To explore the link between hCG/LHCGR signaling and ESR2 regulation of Kiss1 expression, we evaluated changes in gene expression, protein levels, and phosphorylation before and after hCG administration. pESR2 was observed after hCG and correlated with pERK2). We also detected interaction of pERK2 with ESR2 in granulosa cells. This interactome complex also demonstrated the presence of pESR2. These findings suggest a potential role for MAPK-dependent activation of ESR2 in granulosa cells. It has been reported that gonadotropin stimulation can activate the MAPK pathway and specifically MAPK1/3 (ERK1/2) (56). Activated ERK1/2 can phosphorylate ESR2 (57–59), and this phosphorylation of ESR2 increases its transcriptional activation potential (60).

AP-1 binding sites are reported to be present near the ERE sites within the Kiss1 promoter (55, 61). It has also been shown that estrogen receptors can activate gene expression by interacting with AP-1 factors and increasing the transcriptional potential (62–64). We observed that expression of AP-1 factors FOSL2 and JunB was remarkably upregulated in granulosa cells after hCG administration. JUNB was enriched within the Kiss1 promoter locus of granulosa cells isolated from gonadotropin-treated rats. Moreover, AP-1 factors FOSL2 and JunB exhibited a synergistic activation of the Kiss1 promoter activity. AP-1 factors are ubiquitously expressed and activated by Ras-MAP kinase signaling, and in cooperation with other transcriptional regulators they can activate cell type–specific enhancers (65).

We hypothesize that hCG/LHCGR signaling leads to phosphorylation of ERK2, which in turn phosphorylates and activates ESR2 (Fig. 7). Gonadotropin stimulation also leads to marked upregulation of AP-1 factors, which along with activated pESR2 can induce Kiss1 expression in granulosa cells (Fig. 7). However, this effect does not exclude roles for other serine threonine kinases downstream of LHCGR activation. It is important to note that disruption of ESR2 reduces the expression of Lhcgr on granulosa cells (27, 28). Thus, a reduced level of Lhcgr expression in Esr2^−/− granulosa cells may also contribute to the failure of Kiss1 induction.

Figure 7.

Schematic model summarizing our observation. Our findings indicate that hCG/LHCGR signaling leads to phosphorylation of ERK2, which in turn interacts with ESR2. pERK2 can phosphorylate ESR2, but it does not exclude involvement of other serine threonine kinases downstream of LHCGR activation. hCG/LHCGR signaling also increases the expression of AP-1 factors, including FOSL2 and JUNB, which can play a synergistic role in Kiss1 promoter activation. Thus, activated pESR2 along with AP-1 factors induces the expression of Kiss1 in granulosa cells after gonadotropin stimulation. E2, estradiol; P, phosphorylation.

Collectively, our data reveal the essential role played by ESR2 in regulating expression of Kiss1 within granulosa cells. In the absence of ESR2, the Kiss1 gene is unable to respond to the signals from pituitary gonadotropes (FSH and LH) that are responsible for regulating follicular maturation and ovulation. This lack of response occurs even though granulosa cells express ESR1. Thus, ESR1 is incapable of compensating for the loss of ESR2 and maintaining Kiss1 expression in granulosa cells of Esr2^−/− rats. It is also important to highlight the fact that ESR2 alone is insufficient for robust Kiss1 expression in granulosa cells. Expression remains low after PMSG stimulation and at a time when ample ligand (estrogen) for ESR2 is present. Our data indicate that stimulation of LHCGR is necessary to induce Kiss1. We hypothesize that hCG/LH induces ESR2 phosphorylation and the induction of other transcription factors (e.g., AP-1 binding proteins) to elicit an increase in Kiss1 expression. ESR2 is essential in this response and may serve a key role in organizing and promoting the gonadotropin-induced expression of Kiss1 in granulosa cells.

Glossary

Abbreviations:

ARC

arcuate nucleus

AVPV

anteroventral periventricular nucleus

ChIP

chromatin immunoprecipitation, DBD^−/−, DNA-binding domain deleted

ERE

estrogen response element

ESR1

estrogen receptor-α

ESR2

estrogen receptor-β

hCG

human chorionic gonadotropin

KISS1R

KISS1 receptor

LHCGR

LH/choriogonadotropin receptor

pERK2

phosphorylated ERK2

pESR2

phosphorylated estrogen receptor-β

PMSG

pregnant mare serum gonadotropin

qPCR

quantitative PCR

RNA-seq

RNA sequencing

RT-qPCR

quantitative RT-PCR

SIGC

spontaneously immortalized rat granulosa cell line

TS

template switching