Skip to main content
NCBI home page
Human Reproduction (Oxford, England) logoLink to Human Reproduction (Oxford, England)
. 2017 Jan 23;32(2):409–417. doi: 10.1093/humrep/dew316

Bisphenol-A exposure and gene expression in human luteinized membrana granulosa cells in vitro

Abdallah Mansur 1,#, Ariel Israel 1,2,#, Catherine M H Combelles 3, Michal Adir 1, Catherine Racowsky 4, Russ Hauser 5, Andrea A Baccarelli 6, Ronit Machtinger 1,✉
PMCID: PMC6260419  PMID: 27979917

Abstract

STUDY QUESTION

Does bisphenol-A (BPA) affect gene expression in human membrana granulosa cells (MGC)?

SUMMARY ANSWER

In vitro, short exposure to supra-physiological concentrations of BPA alters human MGC gene expression.

WHAT IS KNOWN ALREADY

Exposure to BPA may interfere with reproductive endocrine signaling. In vitro studies, mostly in animal models, have shown an inverse correlation between exposure to BPA and follicular growth, meiosis, and steroid hormone production in granulosa cells.

STUDY DESIGN, SIZE, DURATION

Primary cultures of MGC obtained from 24 patients undergoing IVF (for PGD, male factor infertility or unexplained infertility) were exposed to various concentrations of BPA (0, 0.02, 0.2, 2 or 20 µg/ml) for 48 h.

PARTICIPANTS/MATERIALS, SETTING, METHODS

The study was conducted in a university-affiliated hospital. Microarray analysis was used to identify genes exhibiting expression changes following BPA exposure. Genes significantly altered were identified based on changes greater than 2-fold relative to the control group (not treated by BPA) and a Student's t-test P-value <0.05. Statistical significance was adjusted for multiple comparisons using the Benjamini–Hochberg method. Alterations in the expression of genes that are involved in the enriched functional annotations altered by BPA at the concentration of 20 µg/ml were confirmed by real-time PCR.

MAIN RESULTS AND THE ROLE OF CHANCE

A distinct pattern of gene expression was observed in primary cultures of MGC exposed to the highest BPA concentration compared with untreated cells. We identified 652 genes that exhibited at least 2-fold differences in expression after BPA exposure (all P < 0.05 versus untreated). These genes were significantly enriched for annotations related to cell cycle progression, segregation of chromosomes, steroid metabolism, apoptosis, lipid synthesis, oocyte maturation and chromosomal alignment. No significant changes in gene expression were found at the lower doses of BPA most relevant to human exposure.

LARGE SCALE DATA

N/A.

LIMITATIONS, REASONS FOR CAUTION

Human exposure to BPA in vivo occurs over long periods of time. In this in vitro model, cells were exposed to the chemical for 48 h only. Thus, the effects of BPA on the human follicle might be underestimated.

WIDER IMPLICATIONS OF THE FINDINGS

As BPA exposure is ubiquitous, understanding the effects of the chemical on the ovary, specifically in women of reproductive age, has public health significance. The clinical evidence to date points to an association between BPA exposure and impaired IVF outcome, although not all studies have shown negative effects. Our study adds valuable mechanistic information showing that exposure to BPA alters granulosa cell gene expression at high and supra-physiological doses.

STUDY FUNDING/COMPETING INTEREST(S)

This study was supported by grant number 1936/12 from the ISF. The authors have nothing to disclose.

Keywords: bisphenol-a, mural granulosa cells, cell cycle, microarray, ovarian physiology, reproductive endocrine signaling

Introduction

Bisphenol-A (BPA) is a synthetic substance produced at one of the highest volumes in the plastic industry, and there is ubiquitous exposure of the general population (Vandenberg et al., 2007; Calafat et al., 2008; Ye et al., 2015). Sources of BPA exposure include the lining of cans used for food and beverages, polycarbonate bottles, thermal receipts, etc. (Vandenberg et al., 2007; Talsness et al., 2009). Exposure to this chemical has been found to interfere with reproductive endocrine signaling mainly in animal models (Vandenberg et al., 2007; Caserta et al., 2008).

BPA has been detected in human biofluids including urine, serum, amniotic fluid, and follicular fluid (Ikezuki et al., 2002). According to the National Health and Nutrition Examination Survey (NHANES) of the US Centers for Disease Control reported in 2015, the geometric mean urinary concentrations of BPA measured were 1.83 µg/l (CDC, 2015). BPA was previously detected in follicular fluid at concentrations of 1–2 ng/ml (Ikezuki et al., 2002). However, these follicular fluid measurements should be interpreted with caution as the fluid was collected during oocyte retrieval from patients who were fasting overnight. The primary route of BPA exposure is considered dietary (Wilson et al., 2007) and, given its short half-life (6 h), levels would be expected to be lower as a result of fasting (Volkel et al., 2002; Teeguarden et al., 2005; Thayer et al., 2015).

In vitro and in vivo studies have shown an inverse correlation between BPA exposure and follicular growth, oocyte maturation, spindle formation and steroid hormone production in granulosa cells; these findings were mainly in animal studies (Hunt et al., 2003; Can et al., 2005; Eichenlaub-Ritter et al., 2008; Peretz et al., 2011), but human model systems also exhibit significant effects often at supra-physiological levels (Kwintkiewicz et al. 2010; Ehrlich et al., 2013; Machtinger et al., 2013; Mansur et al., 2016; reviewed by Machtinger and Orvieto 2014; reviewed by Peretz et al., 2014). We have recently shown that BPA exposure at supra-physiological concentrations (≥2 µg/ml) impairs steroidogenesis in human granulosa cells in vitro using qRT-PCR and western blotting (Mansur et al., 2016). The aim of this study was to expand our previous work and to identify changes in the global gene expression profile (using a microarray approach and confirmation by quantitative RT-PCR [qRT-PCR]) in primary cultures of human membrana granulosa cells (MGCs) treated with a range of BPA concentrations. To assess if BPA impairs gene expression in doses relevant to human exposure, the lowest concentration tested was equivalent to that previously detected in human follicular fluid and urine (Ikezuki et al. 2002; Ye et al., 2015).

Materials and Methods

Study participants

This study was approved by our local institutional review board, and all participants provided written informed consent. MGC, which are typically discarded, were collected from patients undergoing IVF. Inclusion criteria were patients aged 37 years or younger, BMI ≤ 30 kg/m², who were undergoing fertility treatments for male infertility factor or unexplained infertility, as well as fertile couples undergoing IVF for PGD of autosomal recessive diseases. Patients with polycystic ovary syndrome, diminished ovarian reserve or endometriosis, which might impair granulosa cell gene expression, were excluded.

Cell collection and preparation

MGC were collected from follicular aspirates from 24 patients, 3 of whom contributed cells to our previous study (Mansur et al., 2016). Cells were prepared and purified as described previously (Ferraro et al., 2012; Mansur et al., 2016).

Treatment protocol

Cells were cultured in 12-well plates (250 000 and 100 000 live cells/well for microarray and real-time PCR, respectively) for 48 h at 37°C as previously described (Mansur et al., 2016).

The number of cells differed for the microarray and real-time PCR experiments since higher concentrations of RNA were needed for the assessment of the quality and integrity of the RNA before microarray, as compared with those required for PCR analyses. Granulosa cells were treated with androstene-3, 17 dione as an androgenic substrate for the production of estradiol. The medium was then replaced by the same medium formulation containing FSH (Merck Serono, Switzerland) (final concentration of 73.3 ng/ml) and different concentrations of BPA: 0, 0.02 µg/ml, 0.2 µg/ml, 2 µg/ml or 20 µg/ml for 48 h (Kwintkiewicz et al., 2010; Mansur et al., 2016). The lowest BPA concentration was equivalent to that previously detected in human follicular fluid (Ikezuki et al., 2002); supra-physiological concentrations matched those tested in previous in vitro studies (Grasselli et al., 2010; Peretz et al, 2011; Machtinger et al., 2013). Dimethylsulphoxide (DMSO) 99% (AMRESCO, Canada) served as a vehicle with a final DMSO concentration of 0.05%. The control contained the same concentration of 0.05% DMSO.

RNA extraction and microarray analysis

After treatment, cells were lysed in 300 µl of RNA lysis buffer according to the manufacturer's instructions (Quick-RNA Microprep Kit; Zymo Research, Orange, CA, USA). The concentration of isolated RNA was determined using a NanoDrop 2000 C spectrophotometer (Thermo Scientific, Waltham, MA, USA). The RNA extracts were stored at −80°C until analysis. The quality and integrity of RNA samples were analyzed using Gel Agarose (Lonza Inc., Allendale, NJ, USA) in a gel electrophoresis system (Mini Gel Migration Trough; Cosmo Bio, CA, USA). Only samples containing RNA that was not degraded were included.

Microarray analysis was used to identify significant differences in gene expression after BPA treatment. Total RNA was extracted from MGC using a Quick-RNA Microprep Kit (Zymo Research) according to the manufacturer's instructions. RNA was isolated from each well of MGC after exposure of cells to one of five concentrations of BPA, with 100 ng of RNA used for this analysis. This experiment was performed three times using cells collected from seven different women. Biotinylated target RNA was prepared according to the manufacturer's instructions with minor modifications. Briefly, the RNA isolated from the MGC was used to generate first-strand cDNA with a T7-linked oligo (dT) primer; next, a second strand of cDNA was produced and in vitro transcription was performed with biotinylated UTP and CTP, resulting in an ~300-fold amplification of the RNA (GeneChip® 3′ IVT Express Kit; Affymetrix, Cat. No. 901253., USA). GeneChip prime view human (Affymetrix, Cat. No. 901837., USA) was used in the microarray experiments, and the target cDNA generated from each sample was processed per the manufacturer's recommendations using an Affymetrix GeneChip Instrument System. Spike controls were added to 15 µg fragmented cRNA before overnight hybridization at 45°C and rotated at 60 rpm according to the manufacturers' instructions (http://media.affymetrix.com/support/downloads/manuals/3_ivt_express_kit_manual.pdf). Arrays were then washed and stained with streptavidin–phycoerythrin before being scanned on an Affymetrix GeneChip scanner. After scanning, array images were assessed by eye to confirm scanner alignment and the absence of bubbles or scratches on the chip surface. The 3′/5′ ratios for GAPDH and β-actin were confirmed to be within acceptable limits, and BioB spike controls were found to be present on all chips, with BioC, BioD and CreX also present in increasing intensity. qRT-PCR was used to validate RNA samples. Analysis of data was performed by RMA (Partec Inc., St. Louis, MO, USA) software in the Department of the Cancer Research in our hospital.

Measurement of gene expression by real-time PCR

For the qRT-PCR, we used both pooled samples (2–3 patients) and individual samples that were collected from another 17 independent patients who fulfilled the inclusion criteria and did not contribute cells to the microarray experiments. We selected eight genes for validation: Baculoviral IAP Repeat-Containing 5 (BIRC5), Budding Uninhibited by Benzimidazoles 1 (BUB1B), Cyclin B1 (CCNB1), Cell Division Cycle 20 (CDC20), hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), insulin-like growth factor binding protein 1 (IGFBP1), Mitotic Arrest Deficient-Like 1 (MAD2L1) and tribbles homolog 3 (TRIB3). Candidate genes were selected for validation according to their involvement in the enriched functional annotations altered by BPA at the concentration of 20 µg/ml representing high fold-changed genes. Each assay was replicated eight or nine times in different cultures. Total RNA was extracted from MGC using a Quick-RNA Microprep Kit (Zymo Research) according to the manufacturer's instructions. RNA concentrations were assessed using a NanoDrop 2000 C spectrophotometer (Thermo Scientific, Waltham, MA, USA). Twenty-five nanograms of RNA were added to the reverse transcription reaction mix to produce 10 μl cDNA by high-capacity cDNA RT kit (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer's instructions. Fluorescent SYBR Green PCR mix (Applied Biosystems) was used to quantify PCR products. Specific primers (final concentration of 0.4 µM) for the genes (Table I) were added, and a final volume of 10 µl was used for the PCR reaction. β-actin was used as a reference gene for each sample. Primers were generated using the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/nucleotide) and were all intron–exon spanning to avoid genomic DNA contamination. Amplification and detection were performed using the StepOnePlus real-time PCR system (Zymo Research) with the following profile: 1 cycle at 95°C for 20 seconds, 40 cycles each at 95°C for 3 seconds and 60°C for 30 seconds. One microliter of cDNA was used per reaction in a 10-µl total reaction volume. All samples were run in triplicate. The same qRT-PCR protocol was used for all genes analyzed. The 2−ΔΔCt method was used to obtain the relative gene expression data (fold change with respect to non-treated sample) (Adnan et al., 2011).

Table I.

Genes selected and the primer sequences used in quantitative RT-PCR analysis of human membrana granulosa cells after exposure to bisphenol-A in vitro

Gene Gene symbol Primer sequences (5′-3′) Accession number
Forward Reverse
Beta-actin Actb 5′-CCTGGACTTCGAGCAAGAGA -3′ 5′-CAGCGGAACCGCTCATTGCCA-3′ NM_001101
Mitotic arrest deficiency 2 MAD2L 5′- CATTCGGCATCAACAGCATT -3′ 5′-CAAGCAAGGTGAGTCCGTATTTC-3′ NM_002358.3
Baculoviral IAP repeat-containing protein 5 BIRC5 5′- TCGTCCGGTTGCGCTTT -3′ 5′- TTCTCTGTCCAGTTTCAAAAATTCA -3′ NM_001168 NM_001012270 NM_001012271
Cell division cycle protein 20 CDC20 5′- CGGAAGACCTGCCGTTACAT -3′ 5′- CCACAAGGTTCAGGTAATAGTCATTTC -3′ NM_001255
Budding uninhibited by benzimidazoles 1 BUB1B 5′- CTGCAAATTGCTTCCGAGTCT -3′ 5′- CCAAATGTTCTCCGCAAGTGA -3′ NM_001211
Cyclin B1 CCNB1 5′- TGAATGGACACCAACTCTACAACA -3′ 5′- CCTTGATTTACCATGACTACATTCTTAGC -3′ NM_031966.3
Homo sapiens insulin-like growth factor binding protein 1 IGFBP1 5′- GCACAGGAGACATCAGGAGAAGA -3′ 5′- CATCCATGGATGTCTCACACTG -3′ NM_000596.2
Homo sapiens tribbles pseudokinase 3 TRIB3 5′- CGTGCTCTTCCGCCAGATG –3′ 5′- CTCCAGCACCAGCTTCTTCCT –3′ NM_021158.4
Homo sapiens 3-hydroxy-3-methylglutaryl-CoA synthase 1 HMGCS1 5′- ACGTGGTACTTAGTTAGGGTGGA –3′ 5′- GGCAGGGCTTGGAATATGCTC -3′ NM_002130.7
Open in a new tab

Statistical analysis

Sets of genes significantly and differentially expressed after exposure to each concentration of BPA were identified based on changes greater than 2-fold relative to the control group and a Student's t-test P-value <0.05. Only genes that were changed >2-fold were included in the statistical analysis. Statistical significance was adjusted for multiple comparisons using the Benjamini–Hochberg method.

For the qRT-PCR, data were analyzed using SPSS statistical software version 23.0 (SPSS Inc., Chicago, IL, USA). Data were expressed as mean ± SE, and results for each different BPA concentration were compared against control by Student's t-test. Adjustments were made to the alpha level for multiple comparisons between the groups by applying Bonferroni correction (four comparisons). P < 0.05 was considered statistically significant.

The set of differentially expressed genes was used to identify functional annotations and pathways most likely to be involved in the observed gene expression changes. Genes were identified using QIAGEN's Ingenuity® Pathway Analysis (IPA®, Qiagen Inc. Valencia, CA, USA).

Results

The primary cultures of MGC used in this study were collected from 24 women, ranging from 22.7 to 36.3 years of age (31.1 ± 3.7 years, mean ± SD). Participants underwent IVF for PGD (54.1%), male factor infertility (33.3%), or unexplained infertility (12.5%). Seventy-nine percent of the participants underwent controlled ovarian hyper-stimulation with a GnRH antagonist, and 21% underwent a long-term GnRH agonist suppressive protocol. Ovidrelle (Merck Serono) was used as the pre-ovulatory hCG trigger in 22/24 of the cases (92%), and GnRH agonist (Decapeptyl 0.2 mg, Ferring, Switzerland) in another two cases (8%).

Figure 1 displays principal components analysis plots of gene expression, observed in the three different experiments. This analysis shows that samples from the same experiment display related gene expression patterns, except for samples exposed to the highest concentration of BPA, which appear as a separate group. When compared to untreated cells, exposure to 20 µg/ml BPA resulted in significant differences in expression of 721 transcripts (>2-fold; P < 0.05). These transcripts corresponded to 652 distinct genes. No significant differences in gene expression were observed for the lower doses of BPA (0.02, 0.2 and 2 µg/ml) compared with controls. Figure 2 presents a gene expression heatmap of the transcripts differentially expressed when exposed to 20 µg/ml BPA, with a hierarchical clustering dendrogram for samples and genes.

Figure 1.

Figure 1

Open in a new tab

Principal components analysis (PCA) plot showing the distinction between membrana granulosa cell (MGC) samples based on gene expression.

Each MGC sample is represented by a colored shape, with color indicating the bisphenol-A (BPA) concentration to which the sample was exposed, and shape indicating the cell extract origin (P1 = Experiment 1, P2 = Experiment 2, P3 =Experiment 3). Samples exposed to the highest concentration of BPA appear as a separate group (surrounded by a black ellipse), samples exposed to lesser concentrations display gene expression patterns primarily reflecting the cell extract origin (grouped inside the colored ellipses).

Figure 2.

Figure 2

Open in a new tab

Hierarchical clustering heatmap of mRNA transcripts differentially expressed in MGC at high BPA concentration (up- or down-regulated >2 fold; t-test P-value 0.05). Expression levels in each experiment are color-coded according to values normalized (Z-score) for each row.

Expression levels in each experiment are color-coded according to values normalized (Z-score) for each row. Transcripts up- or down-regulated >2-fold; Student's t-test: P-value 0.05.

Functional annotations of differentially expressed genes

We used ingenuity pathway analysis (IPA) to identify enrichment of functional annotations and to determine cellular functions most likely to be affected by the changes in gene expression observed following BPA exposure. We identified significant enrichment in 652 genes with at least 2-fold change and P < 0.05 following BPA exposure at 20 µg/ml. Among the most enriched functional annotations were cell cycle progression (P = 4.52 × 10−11), proliferation of cells (P = 6.96 × 10−11), apoptosis (P = 9.22 × 10−11), lipid and steroid metabolism (P = 2.19 × 10−10), segregation of chromosomes (P = 3.9 × 10−9), mitosis (P = 8.45 × 10−9), alignment of chromosomes (P = 3.8 × 10−8), M-phase (P = 6.77 × 10−8), segregation of sister chromatids (P = 4.6 × 10−5), oocyte maturation (P = 8.7 × 10−5), interphase (P = 1.5 × 10−4), organization of mitotic spindle (P = 7.3 × 10−4), and attachment of spindle fibers (P = 3.7 × 10−3) (Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Functional groups altered by the changes in mRNA expression level following exposure to 20 µg/ml BPA.

Changes in MGC mRNA expression were analyzed with ingenuity pathway analysis (IPA) to identify affected cellular functions. Functional groups identified by IPA had enrichment in 652 genes with at least a 2-fold change following BPA exposure at 20 µg/ml. The length of the bar is proportional to the negative log of the (Benjamini–Hochberg FDR corrected) enrichment P-value (This represents the IPA score, thus a longer bar equals a higher score).

Confirmation of BPA-induced changes in expression by qRT-PCR

Selection criteria for the validation of candidate genes were: a high fold change after exposure to BPA at the highest concentration of 20 µg/ml; hybridization intensity; and biological relevance to the most enriched functional annotations described above. Specifically, we chose to focus our analysis on genes involved in cell cycle progression, mitosis, M-phase, chromosomal segregation, steroid, lipid metabolism and spindle formation. Candidate genes with significant fold changes and known functions in these processes (BIRC5, BUB1B, CCNB1, CDC20, HMGCS1, IGFBP1, MAD2L1 and TRIB3) were selected for validation. Expression changes (increases and decreases) observed by microarray analysis were indeed confirmed by qRT-PCR (Figs 4 and 5).

Figure 4.

Figure 4

Open in a new tab

The effect of BPA on mRNA expression levels in MGC.

Levels of mRNA for (a) Cyclin B1 (CCNB1), (b) Budding uninhibited by benzimidazoles 1 (BUB1B), (c) Mitotic arrest deficiency 2 (MAD2L1), (d) Baculoviral IAP repeat-containing protein 5 (BIRC5) and (e) Cell division cycle protein 20 (CDC20) were analyzed by quantitative RT-PCR (qRT-PCR), normalized against b-actin. Data are mean ± SE. Treatment of 20 μg/ml BPA significantly decreased (*P < 0.0001 compared with controls) the mRNA levels of all five genes.

Figure 5.

Figure 5

Open in a new tab

The effect of BPA on MGC mRNA expression levels.

Changes in mRNA levels were analyzed by qRT-PCR and normalized against b-actin. Data are mean ± SE. Compared to controls, treatment of 20 μg/ml BPA increased the levels of tribbles pseudokinase 3 (TRIB3 *P = 0.03) and insulin-like growth factor binding protein 1 (IGFBP1 ***P = 0.0003) and decreased the levels of 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1 **P = 0.007).

Discussion

Our results show that in vitro exposure to a high supra-physiological level of BPA (20 µg/ml) alters genes that are involved in cell cycle progression, cell death and survival, apoptosis, lipid and steroid metabolism, mitosis, segregation and alignment of chromosomes and oocyte maturation. We confirmed by qRT-PCR the effect of BPA on a selection of eight representative genes.

The most pronounced changes after BPA exposure that are also relevant to ovarian physiology were an increase in TRIB3 and IGFBP1 and a decrease in HMGCS1. Brisard et al. (2014) recently described higher levels of TRIB3 in cumulus cells from mature compared to immature oocytes and suggested that this gene can be involved in the regulation of lipid metabolism via control of peroxisome proliferator-activated receptor gamma (PPARG) activity. These results are in line with Kwintkiewicz et al. (2010) who showed that BPA was associated with overexpression of PPARG in granulosa cell lines. Moreover, TRIB3 is a key mediator of insulin signaling (Prudente et al., 2012).

IGFBP1 is involved in glucose metabolism (Crossey et al., 2000). In female reproduction, IGFBP1 is important for follicular growth, ovulation, steroidogenesis and implantation (Fowler et al., 2000).

Finally, HMGCS1 is important for the synthesis of cholesterol from acetyl CoA (Kessler et al., 2014). A decrease in HMGCS1 is in line with our recent findings that supra-physiological concentrations of BPA affect steroid hormone synthesis in MGC (Mansur et al., 2016). The effects of BPA on these genes associated with glucose and lipid metabolism are relevant to other reports that BPA plays a role in obesity, as previously reviewed (Heindel, 2015).

Oocytes depend on granulosa cells for their growth and for the regulation of meiosis. Since experimentation with human oocytes is limited by sample availability, the use of primary cultures of MGC system can serve as a model to understand the effects of BPA on meiotic targets in the oocyte. We previously showed that BPA exposure impairs oocyte maturation, meiotic spindle structure and chromosome alignment in vitro (Machtinger et al., 2013). These results indicate that BPA exposure affects the expression of genes in MGC that are related to cell cycle control and chromosome segregation (BIRC5, BUB1B, CCNB1, CDC20 and MAD2L1). The microarray findings for these genes were thus confirmed using qRT-PCR. Interestingly, all of the genes with confirmed expression changes are known regulators of oocyte maturation. Furthermore, IPA revealed that these candidate genes interact in a network related to oocyte maturation, spindle formation and chromosome segregation. BIRC5 is essential for tubulin interaction and stabilization of chromosomes (Lamers et al., 2011). BUB1 participates in chromosome alignment and segregation of oocytes during meiosis (Yin et al., 2006). MAD2L1, BUB1B and CDC20 play a role in the arrest of meiosis and mitosis by preventing the onset of anaphase in the event of altered chromosome-kinetochore connections, damaged spindles or misaligned chromosomes (Niault, et al., 2007; Luo and Yu, 2008; Chen et al., 2010). Finally, CCNB1 (cyclin B1) regulates the promotion of meiosis from the germinal vesicle (arrest of Meiosis I) stage to Meiosis II and also plays a role in the condensation of chromosomes (Li et al., 1995; Ookata, et al., 1995; Brunet and Maro, 2005). Spindle and chromosomal abnormalities are considered crucial factors leading to infertility, aneuploidy and fetal loss (Hunt and Hassold, 2008; Selesniemi et al., 2011). While the effects of BPA on MGC gene expression were significant only at 20 µg/ml, we previously reported significant effects of BPA on oocytes in lower doses (Machtinger et al., 2013). The difference can indicate that oocytes are more susceptible to BPA compared to granulosa cells. Therefore, we suggest to further test the effects of BPA on cumulus cells, as a subtype of granulosa cells in direct communication with the oocyte.

Apoptosis was among the most enriched functional annotations impaired by BPA. Although validation of these results by RT-PCR were beyond the scope of this study, these findings are in line with previous animal experiments that showed that BPA exposure induced apoptosis and cell G2-to-M arrest in mouse granulosa cells (Xu et al., 2002) and increased follicular atresia in rats and mice (Peretz et al., 2012; Lee et al., 2013).

A strength of this in vitro study is the inclusion of primary cultures of cells mostly from fertile women. Such inclusion helps to overcome the possible bias and potential variability that may be associated with infertility. Potential inter-patient variability in the sensitivity to BPA and/or metabolism of the chemical is also relevant to consider. In our study, samples from the same experiment (i.e. granulosa cells pooled from the same group of patients) display related gene expression patterns, except for samples exposed to the highest concentration of BPA, which have distinct characteristics (Figure 1). As the number of discarded biological samples is inherently limited, it is possible that the microarray analyses and quantitative PCR used in this study cannot confirm minor changes in gene expression that might occur at low concentrations of the chemical. An increased sample size may provide adequate power to reveal more subtle effects.

Our study has several limitations. First, the duration of exposure to BPA was 48 h in vitro, which is in line with previous similar studies (Kwintkiewicz et al., 2010; Mansour et al., 2016); however, this duration may not accurately mimic exposure to BPA in vivo. Specifically, human exposure likely occurs over long periods of time, and it is possible that, after an extended duration of exposure to BPA, the effects found in this study might be heightened. A second limitation is related to the in vitro approach. The presence of serum in the culture medium may interfere with the bioavailability and metabolism of BPA, perhaps masking and altering the biological effect. However, no experimental evidence for such interference yet exists. It is also relevant to note that a BPA exposure paradigm in the presence of serum may not be significantly different from the situation in the follicle in vivo, given that the granulosa cells are bathed in a protein-rich complex liquid environment, the follicular fluid, which is a serum exudate. Another possible limitation, resulting from experimentation with clinically discarded material, was the use of only luteinized granulosa cells after exposure to follicular stimulation and the ovulatory trigger of hCG. As such, the findings may not apply to either non-luteinized granulosa cells from earlier stages of follicular development or cumulus cells. Nonetheless, evaluating the effects of BPA in luteinized cells has biological relevance in view of the critical role of the corpus luteum in endometrial priming and support of early pregnancy.

In conclusion, in vitro exposure of granulosa cells to BPA led to a marked alteration in gene expression at a high and supra-physiological dose. Given the very limited data on follicular fluid levels of BPA and the lack of knowledge of the doses of BPA that actually reach the cells in vitro, it is difficult to put these results into the perspective of human health. Recently, increased concern for the effects of BPA has led to the partial replacement of this chemical with other phenols such as bisphenol-S, F, B and AF (Sartain and Hunt, 2016). Further studies will evaluate if chronic exposure to low levels of BPA or its substitutes both in vitro and in vivo have different effects, and if the transcriptional differences translate to protein differences.

Acknowledgements

We thank Mrs Jasmin Jacob-Hirsch and Chen Gefen-Dor for their help with the microarray analyses.

Authors’ roles

A.M. participated in study design, analysis and manuscript drafting. A.I. participated in data analysis. C.M.C. participated in manuscript revisions and critical discussion. M.A. participated in study design and experiments. C.R. participated in critical discussion and manuscript revisions. A.A.B. participated in critical discussion and manuscript revisions. R.H. participated in critical discussion and manuscript revisions. R.M. participated in study design, manuscript revisions and critical discussion.

Funding

Israeli Science Foundation (grant number 1936/12); Center for Environmental Health in Northern Manhattan (P30 ES009089) and HSPH-NIEHS Center for Environmental Health (P30 ES000002).

Conflict of interest

None declared.

References

  1. Adnan M, mORTON G, Had S. Analysis of rpoS and bolA gene expression under various stress-induced environments in planktonic and biofilm phase using 2(-ΔΔCT) method. Mol Cell Biochem 2011;357(1-2):275–82. [DOI] [PubMed] [Google Scholar]
  2. Brisard D, Chesnel F, Elis S, Desmarchais A, Sanchez-Lazo L, Chasles M, Maillard V, Uzbekova S. Tribbles expression in cumulus cells is related to oocyte maturation and fatty acid metabolism. J Ovarian Res 2014;7:44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brunet S, Maro B. Cytoskeleton and cell cycle control during meiotic maturation of the mouse oocyte: integrating time and space. Reproduction 2005;130:801–811. [DOI] [PubMed] [Google Scholar]
  4. Calafat AM, Ye X, Wong LY, Reidy JA, Needham LL. Exposure of the U.S. population to bisphenol A and 4-tertiary-octylphenol: 2003-2004. Environ Health Perspect 2008;116:39–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Can A, Semiz O, Cinar O. Bisphenol-A induces cell cycle delay and alters centrosome and spindle microtubular organization in oocytes during meiosis. Mol Hum Reprod 2005;11:389–396. [DOI] [PubMed] [Google Scholar]
  6. Caserta D, Maranghi L, Mantovani A, Marci R, Maranghi F, Moscarini M. Impact of endocrine disruptor chemicals in gynaecology. Hum Reprod Update 2008;14:59–72. [DOI] [PubMed] [Google Scholar]
  7. CDC http://www.cdc.gov/biomonitoring/pdf/FourthReport_UpdatedTables_Feb2015.pdf 2015.
  8. Chen Z, Yu Y, Fu D, Li Z, Niu X, Liao M, Lu S. Functional roles of PC-PLC and Cdc20 in the cell cycle, proliferation, and apoptosis. Cell Biochem Funct 2010;28:249–257. [DOI] [PubMed] [Google Scholar]
  9. Crossey PA, Jones JS, Miell JP. Dysregulation of the insulin/IGF binding protein-1 axis in transgenic mice is associated with hyperinsulinemia and glucose intolerance. Diabetes 2000;49:457–465. [DOI] [PubMed] [Google Scholar]
  10. Ehrlich S, Williams PL, Hauser R, Missmer SA, Peretz J, Calafat AM, Flaws JA. Urinary bisphenol A concentrations and cytochrome P450 19 A1 (Cyp19) gene expression in ovarian granulosa cells: an in vivo human study. Reprod Toxicol 2013;42:18–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Eichenlaub-Ritter U, Vogt E, Cukurcam S, Sun F, Pacchierotti F, Parry J. Exposure of mouse oocytes to bisphenol A causes meiotic arrest but not aneuploidy. Mutat Res 2008;651:82–92. [DOI] [PubMed] [Google Scholar]
  12. Ferrero H, Delgado-Rosas F, Garcia-Pascual CM, Monterde M, Zimmermann RC, Simon C, Pellicer A, Gomez R. Efficiency and purity provided by the existing methods for the isolation of luteinized granulosa cells: a comparative study. Hum Reprod 2012;27:1781–1789. [DOI] [PubMed] [Google Scholar]
  13. Fowler DJ, Nicolaides KH, Miell JP. Insulin-like growth factor binding protein-1 (IGFBP-1): a multifunctional role in the human female reproductive tract. Hum Reprod Update 2000;6:495–504. [DOI] [PubMed] [Google Scholar]
  14. Grasselli F, Baratta L, Baioni L, Bussolati S, Ramoni R, Grolli S, Basini G. Bisphenol A disrupts granulosa cell function. Domest Anim Endocrinol 2010;39:34–39. [DOI] [PubMed] [Google Scholar]
  15. Heindel JJ, vom Saal FS, Blumberg B, Bovolin P, Calamandrei G, Ceresini G, Cohn BA, Fabbri E, Gioiosa L, Kassotis C et al. Parma consensus statement on metabolic disruptors. Environ Health 2015;14:54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hunt PA, Hassold TJ. Human female meiosis: what makes a good egg go bad. Trends Genet 2008;24:86–93. [DOI] [PubMed] [Google Scholar]
  17. Hunt PA, Koehler KE, Susiarjo M, Hodges CA, Ilagan A, Voigt RC, Thomas S, Thomas BF, Hassold TJ. Bisphenol a exposure causes meiotic aneuploidy in the female mouse. Curr Biol 2003;13:546–553. [DOI] [PubMed] [Google Scholar]
  18. Ikezuki Y, Tsutsumi O, Takai Y, Kamei Y, Taketani Y. Determination of bisphenol A concentrations in human biological fluids reveals significant early prenatal exposure. Hum Reprod 2002;17:2839–2841. [DOI] [PubMed] [Google Scholar]
  19. Kessler EC, Gross JJ, Bruckmaier RM, Albrecht C. Cholesterol metabolism, transport, and hepatic regulation in dairy cows during transition and early lactation. J Dairy Sci 2014;97:5481–5490. [DOI] [PubMed] [Google Scholar]
  20. Kwintkiewicz J, Nishi Y, Yanase T, Giudice LC. Peroxisome proliferator-activated receptor-gamma mediates bisphenol A inhibition of FSH-stimulated IGF-1, aromatase, and estradiol in human granulosa cells. Environ Health Perspect 2010;118:400–406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lamers F, van der Ploeg I, Schild L, Ebus ME, Koster J, Hansen BR, Koch T, Versteeg R, Caron HN, Molenaar JJ. Knockdown of survivin (BIRC5) causes apoptosis in neuroblastoma via mitotic catastrophe. Endocr Relat Cancer 2011;18:657–668. [DOI] [PubMed] [Google Scholar]
  22. Lee SG, Kim JY, Chung JY, Kim YJ, Park JE, Oh S, Yoon YD, Yoo KS, Yoo YH, Kim JM. Bisphenol A exposure during adulthood causes augmentation of follicular atresia and luteal regression by decreasing 17beta-estradiol synthesis via downregulation of aromatase in rat ovary. Environ Health Perspect 2013;121:663–669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li J, Meyer AN, Donoghue DJ. Requirement for phosphorylation of cyclin B1 for Xenopus oocyte maturation. Mol Biol Cell 1995;6:1111–1124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Luo X, Yu H. Protein metamorphosis: the two-state behavior of Mad2. Structure 2008;16:1616–1625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Machtinger R, Combelles CM, Missmer SA, Correia KF, Williams P, Hauser R, Racowsky C. Bisphenol-A and human oocyte maturation in vitro. Hum Reprod 2013;28:2735–2745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Machtinger R, Orvieto R. Bisphenol A, oocyte maturation, implantation, and IVF outcome: review of animal and human data. Reprod Biomed Online 2014;29:404–410. [DOI] [PubMed] [Google Scholar]
  27. Mansur A, Adir M, Yerushalmi G, Hourvitz A, Gitman H, Yung Y, Orvieto R, Machtinger R. Does BPA alter steroid hormone synthesis in human granulosa cells in vitro. Hum Reprod 2016;31:1562–1569. [DOI] [PubMed] [Google Scholar]
  28. Niault T, Hached K, Sotillo R, Sorger PK, Maro B, Benezra R, Wassmann K. Changing Mad2 levels affects chromosome segregation and spindle assembly checkpoint control in female mouse meiosis I. PLoS One 2007;2:e1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ookata K, Hisanaga S, Bulinski JC, Murofushi H, Aizawa H, Itoh TJ, Hotani H, Okumura E, Tachibana K, Kishimoto T. Cyclin B interaction with microtubule-associated protein 4 (MAP4) targets p34cdc2 kinase to microtubules and is a potential regulator of M-phase microtubule dynamics. J Cell Biol 1995;128:849–862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Peretz J, Craig ZR, Flaws JA. Bisphenol A inhibits follicle growth and induces atresia in cultured mouse antral follicles independently of the genomic estrogenic pathway. Biol Reprod 2012;87:1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Peretz J, Gupta RK, Singh J, Hernandez-Ochoa I, Flaws JA. Bisphenol A impairs follicle growth, inhibits steroidogenesis, and downregulates rate-limiting enzymes in the estradiol biosynthesis pathway. Toxicol Sci 2011;119:209–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Peretz J, Vrooman L, Ricke WA, Hunt PA, Ehrlich S, Hauser R, Padmanabhan V, Taylor HS, Swan SH, VandeVoort CA, Flaws JA. Bisphenol a and reproductive health: update of experimental and human evidence, 2007–2013. Environ Health Perspect 2014;122:775–786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Prudente S, Sesti G, Pandolfi A, Andreozzi F, Consoli A, Trischitta V. The mammalian tribbles homolog TRIB3, glucose homeostasis, and cardiovascular diseases. Endocr Rev 2012;33:526–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sartain CV, Hunt PA. An old culprit but a new story: bisphenol A and ‘NextGen’ bisphenols. Fertil Steril 2016;106:820–826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Selesniemi K, Lee HJ, Muhlhauser A, Tilly JL. Prevention of maternal aging-associated oocyte aneuploidy and meiotic spindle defects in mice by dietary and genetic strategies. Proc Natl Acad Sci USA 2011;108:12319–12324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Talsness CE, Andrade AJ, Kuriyama SN, Taylor JA, vom Saal FS. Components of plastic: experimental studies in animals and relevance for human health. Philos Trans R Soc Lond B Biol Sci 2009;364:2079–2096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Teeguarden JG, Waechter JM Jr, Clewell HJ III, Covington TR, Barton HA. Evaluation of oral and intravenous route pharmacokinetics, plasma protein binding, and uterine tissue dose metrics of bisphenol A: a physiologically based pharmacokinetic approach. Toxicol Sci 2005;85:823–838. [DOI] [PubMed] [Google Scholar]
  38. Thayer KA, Doerge DR, Hunt D, Schurman SH, Twaddle NC, Churchwell MI, Garantziotis S, Kissling GE, Easterling MR, Bucher JR et al. Pharmacokinetics of bisphenol A in humans following a single oral administration. Environ Int 2015;83:107–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV. Human exposure to bisphenol A (BPA). Reprod Toxicol 2007;24:139–177. [DOI] [PubMed] [Google Scholar]
  40. Volkel W, Colnot T, Csanady GA, Filser JG, Dekant W. Metabolism and kinetics of bisphenol a in humans at low doses following oral administration. Chem Res Toxicol 2002;15:1281–1287. [DOI] [PubMed] [Google Scholar]
  41. Wilson NK, Chuang JC, Morgan MK, Lordo RA, Sheldon LS. An observational study of the potential exposures of preschool children to pentachlorophenol, bisphenol-A, and nonylphenol at home and daycare. Environ Res 2007;103:9–20. [DOI] [PubMed] [Google Scholar]
  42. Xu J, Osuga Y, Yano T, Morita Y, Tang X, Fujiwara T, Takai Y, Matsumi H, Koga K, Taketani Y et al. Bisphenol A induces apoptosis and G2-to-M arrest of ovarian granulosa cells. Biochem Biophys Res Commun 2002;292:456–462. [DOI] [PubMed] [Google Scholar]
  43. Ye X, Wong LY, Kramer J, Zhou X, Jia T, Calafat AM. Urinary concentrations of bisphenol A and three other bisphenols in convenience samples of U.S. adults during 2000–2014. Environ Sci Technol 2015;49:11834–11839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yin S, Wang Q, Liu JH, Ai JS, Liang CG, Hou Y, Chen DY, Schatten H, Sun QY. Bub1 prevents chromosome misalignment and precocious anaphase during mouse oocyte meiosis. Cell cycle 2006;5:2130–2137. [DOI] [PubMed] [Google Scholar]

Articles from Human Reproduction (Oxford, England) are provided here courtesy of Oxford University Press

RESOURCES