Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jul 1.
Published in final edited form as: Entomol Res. 2018 Jul 12;48(4):269–278. doi: 10.1111/1748-5967.12300

Optimization of double-stranded RNAi intrathoracic injection method in Aedes aegypti

Seokyoung Kang 1,*,†, Dongyoung Shin 2,†, Mi Young Noh 3, Jill S Peters 1, Chelsea T Smartt 2, Yeon Soo Han 3, Young S Hong 4,*
PMCID: PMC6261502  NIHMSID: NIHMS947464  PMID: 30505333

Abstract

RNA interference is widely used to analyze gene functions via phenotypic knockdown of target transcripts in mosquitoes, which transmit numerous mosquito-borne diseases. Functional analysis of mosquito genes is indispensable to understand and reduce transmission of mosquito-borne diseases in mosquitoes. Intrathoracic injection of double-stranded RNA (dsRNA) remains the simplest and most customizable method in mosquitoes for functional analysis of the genes of interest. However, achieving consistent and effective knockdown by dsRNAi is often elusive and may require extensive optimization. We tested the effectiveness of gene silencing by intrathoracic injection of four different quantities of dsRNA targeting two Ae. aegypti genes, cysteine desulfurylase (Nfs1) and short-chain dehydrogenase (SDH). We found that Nfs1 gene has a lower expression level upon silencing than SDH gene. In the case of the gene that is easier to silence, Nfs1 gene expression was significantly silenced by all four tested quantities of dsRNA up to 21 d.p.i., but silencing of SDH, the gene that is difficult to silence, was less effective, with knockdown lasting up to 9 d.p.i. only when 1,000 ng of dsRNA was used. Based on our observation, intrathoracic injection of 500 ng of dsRNAs per mosquito is recommended to achieve effective knockdown for well-silenced transcripts such as Nfs1 for up to 3 weeks. This includes most in vivo bioassays involving arboviral infections in Ae. aegypti. The estimated quantities of dsRNA described in this study should be applicable to most Ae. aegypti dsRNAi studies and thus provide a guideline to develop efficient dsRNAi in other experimental investigations.

Keywords: dsRNA interference (dsRNAi), mosquito, intrathoracic injection, gene silencing

Introduction

Aedes aegypti is an important vector of major viral diseases such as dengue, yellow fever, chikungunya and Zika (1). More than half of the global population in over 100 endemic countries are at the risk of dengue infection and the incidence of dengue fever/dengue hemorrhagic fever in those endemic countries is rapidly increasing (2). In order to reverse these trends, effective control of Ae. aegypti is required. Genome sequencing of Ae. aegypti has been an important part of the efforts to genetically control this mosquito, resulting in the annotation of nearly 16,000 genes for the ~1,300 Mbp genome (AaegL1.2; www.vectorbase.org). Nevertheless, many of those annotated genes in the Ae. aegypti genome are still in need of functional characterization, particularly regarding their roles in dengue or yellow fever infection. Recently, efforts have been made to develop genetic approaches to intervene with arboviral transmission by Ae. aegypti (3-7). Toward these efforts, RNA interference (RNAi) has proven to be a promising research tool for functional genomics in mimicking loss-of-function mutations, a process also called gene knockdown (6, 7).

In dsRNAi, extragenous double-stranded RNA (dsRNA) introduced into cells or organisms serve as substrates for cleavage by ribonuclease III-like Dicer proteins, producing 21-25 base pairs of double-stranded small interfering RNAs (siRNAs)(8). Subsequently, siRNAs become single-stranded and integrated into RNA-induced silencing complex (RISC) where they bind to complementary target mRNAs. Once associated with RISC, endogenous target mRNAs are cleaved by the action of Argonaute proteins, which results in translational suppression of the target gene (9). Because of its prompt ability to suppress gene expression without actual genetic mutation, dsRNAi has been adopted as a molecular tool of choice in order to analyze gene function in many organisms including mosquitoes (10, 11). RNAi has been proven to be an effective strategy for reverse genetic studies in Ae. aegypti. Among various RNAi techniques, intrathoracic injection of dsRNA has been most commonly used in gene knockdown studies employing whole mosquitoes (7, 12-14). This is likely because dsRNA can be easily prepared in a standard laboratory setting, and the intrathoracic injection of adult mosquitoes is technically simple to perform.

In this regard, several genome-wide screening efforts using siRNAs have been undertaken using various cell lines including human and insect cells to identify genes whose function may be critical to replication of arboviruses such as dengue and West Nile viruses (15-17). While siRNAs are commonly used in cell culture, in vivo studies with mosquitoes mainly utilize microinjection of dsRNA that are ~500 bp long and complementary to targeted mRNAs (6, 13, 18-21). Phenotypic modifications by dsRNAi can be observed shortly after injection of dsRNA in contrast to knockout approaches that require multiple generations before observation of phenotypic changes. Quantitative optimization of dsRNA delivered into mosquitoes, however, may be required for effective silencing. Excessive amounts of dsRNA may have off-target effects, resulting in cytotoxic side-effects as shown in helminthes (22), while insufficient amounts may not silence target genes. Therefore, quantitative optimization of dsRNAi injection should be determined empirically to achieve successful gene silencing in mosquitoes.

Here, we report the optimal quantities of dsRNAs required for effective silencing of two target mRNAs in female adult Ae. aegypti. Initially, two genes were selected: cysteine desulfurylase (Nfs1, AAEL010743, 3 exons and 1542 bps of the transcript length) and short-chain dehydrogenase (SDH, AAEL008159, 2 exons and 795 bps of the transcript length). In addition, persistence of dsRNAi silencing was monitored in time-course experiments up to 21 days post-injection (d.p.i.). Consequently, it was determined that 500 ng of dsRNA per mosquito is needed to achieve consistent and long-lasting silencing of the most-silenced target gene (Nfs1). However, more than 1,000 ng of SDH (the least-silenced gene) may be required to achieve gene silencing lasting longer than 9 d.p.i. The estimated quantities of dsRNA described in this study should be applicable to most Ae. aegypti dsRNAi studies and thus provide a guideline to develop efficient dsRNAi in other experimental investigations.

Materials and Methods

Mosquitoes

Cohorts of the Ae. aegypti Rockefeller strain were reared at 27°C under a 12 h light: 12 h dark photoperiod. Larvae were fed with bovine liver powder (Cat# 900396, MP Biochemicals, OH) and adults were provided with 10% sucrose solution ad libitum. Female mosquitoes were fed with sheep blood (Hemostat, CA) using an artificial blood feeder (Lillie, GA) pre-warmed to 37°C using a water bath.

Generation of dsRNA

Two Ae. aegypti genes, cysteine desulfurylase (Nfs1) and short-chain dehydrogenase (SDR)were selected for gene silencing by dsRNA. Double-stranded RNAs of each target mRNA were prepared by in vitro transcription using primers containing a T7 promoter sequence (Table 1; 14). The DNA templates for in vitro transcription were synthesized by a two-step method of reverse transcriptase-PCR (RT-PCR) using a SuperScript III reverse transcription kit according to the manufacturer’s instructions (Cat# 18080400; Invitrogen, CA). Briefly, first strand complementary DNAs (cDNAs) were synthesized from mosquito total RNAs using oligo-d(T) primers. Then, gene-specific primers were used to amplify respective target cDNAs of about 500 bp in length (see Table 2 for sequences). In addition, each primer included the linker sequence (GGCCGCGG) to incorporate the T7 promoter sequence at the 5′ end. The T7 promoter sequence was used to add the T7 promoter to all amplified cDNAs, which allowed the T7 polymerase to transcribe in vitro. The PCR conditions were as follows: 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 1 min. The resulting PCR products contained the T7 promoter sequence in both the sense and antisense orientations, allowing simultaneous transcription of both strands of target mRNAs. In vitro transcription was performed using a MegaScript kit according to the manufacturer’s instructions (Cat# AM1334; Ambion, CA). A bacterial gene, β-galactosidase (β-gal), was used to generate a control dsRNA, and dsRNA were quantified using a NanoDrop spectrophotometer at 260 nm (1 OD260 = 40 μg RNA/ml) (Thermo Scientific, MA).

Table 1.

Primer sequences used for synthesis of dsRNA.

ID Primer Sequences (5′ to 3′) dsRNA Length
AAEL010743
(Nfs1)
F: GGCCGCGGTTAAGGGAGTTGCACGGTTC 540 bp
R: GGCCGCGGCTCACAAGCCTCTCCCAGTC
AAEL008159
(SDH)
F: GGCCGCGGATGTGAAGCCATTGGGAAAC 506 bp
R: GGCCGCGGGTCCCAGTGGATGGAACTGT
β-gal
(Control)
F: GGCCGCGGGGTCGCCAGCGGCACCGCGCCTTTC 523 bp
R: GGCCGCGGGCCGGTAGCCAGCGCGGATCATCGG
T7 promoter GAGAATTCTAATACGACTCACTATAGGGCCGCGG N/A

The sequences underlined indicate the linker sequence. F and R denote forward and reverse primers, respectively.

Table 2.

Primer sequences used for qRT-PCR and semi-qPCR assays

ID Primer Sequences (5′ to 3′) Product Length
AAEL010743
(Nfs1)
F: TGAAGTGCTCGACGGAAGGC 129 bp
R: GCGTGCGTTCGAGAATGTGG
AAEL008159
(SDH)
F: TGGGTGCAATCGTCGTTTTG 88 bp
R: GGCTTTTGTTTCCCAATGGCTT
AAEL004175
(Rps17, Internal Control)
F: ACATCTGATGAAGCGCCTGC 101 bp
R: ACACTTCCGGCACGTAGTTGT

F and R denote forward and reverse primers, respectively.

Silencing target genes by dsRNA

Intrathoracic injection of dsRNA was performed by following the method described by Hong et al.(23). Briefly, dsRNA targeting respective endogenous mRNAs were dissolved in phosphate buffered saline buffer (PBS, pH 7.4) and prepared in four different concentrations (0.5, 1, 5 and 10 μg/μl). A volume of 0.1μl for each dsRNA solution was injected into the thorax of cold-shocked three to six-day old females using a microinjector (PV830 Pneumatic Pico Pump, World Precision Instruments, FL). Standard borosilicate glass capillaries with a filament were used as injection needles (OD 1.0 mm; ID 0.58 mm) (World Precision Instruments, FL). The needles were pulled using a PC-10 needle puller (Narishige, Japan) at the following conditions: On setting 52.7 unit at step 1, a total of about 50 female mosquitoes were injected with 50, 100, 500 or 1,000 ng dsRNA of each target transcript (50 females/concentration tested/target transcript). To complete each replication, 200 mosquitoes were used (50 females per concentration × 4 concentrations). For the control, the same amounts (50, 100, 500 and 1,000 ng) of β-gal dsRNA were injected into mosquitoes. As the entire experiments were performed in triplicates, a total of ~1,800 female mosquitoes were used for the study [200 per replicate × 3 treatments (Nfs1, SDH, and control) × 3 replicates]. After injection of Nfs1 or SDH dsRNA and β-gal dsRNA as a control, the resulting mosquitoes were kept in paper cup cases (8.5 cm diameter × 10 cm height) with a cotton wick soaked in 10% sucrose solution. A batch of four mosquitoes was harvested for each treatment at the pre-determined time points (3, 6, 9, 15 and 21 d.p.i.), from which total RNA was extracted as described below.

Reverse-transcription reaction

Total RNAs were extracted from each pool of the harvested mosquitoes using the Trizol reagent (Cat# 15596026; Invitrogen, CA). To remove genomic DNA contaminants, RNA samples were treated with 1.0 μl DNase I according to the manufacturer’s instructions (Cat# 18068015; Invitrogen, CA). First-strand cDNAs were synthesized using a SuperScript III first-strand synthesis supermix according to the manufacturer’s instructions (Invitrogen, CA). Briefly, 500 ng of total RNA was incubated with oligo-d(T) primers at 65°C for 5 min to denature the RNAs and then placed on ice. Superscript III with RNaseOUT enzyme mix was then added to the RNA samples. Reverse transcription reactions were performed at 50°C for 50 min followed by inactivation at 85°C for 5 min.

Quantitative real-time PCR analysis (qRT-PCR)

qRT-PCR and melting curve analyses were performed using an I-cycler (BioRad, CA). All reactions were performed in a total volume of 25 μl containing 12.5 μl of SYBR Green PCR Master Mix (Cat# 1708882; BioRad, CA), 200 nM of each primer and cDNA as a template under the following condition: 95°C for 3 min followed by 50 cycles of denaturation at 95°C for 15 s, annealing and extension at 60°C for 1 min. The PCR data were normalized to the RpS17 gene as an internal control and relative abundance of target mRNAs were presented in comparison to the control mosquitoes that were injected with dsβ-gal (Table 2 for primer sequences) (24).

In silico analysis of gene expression

Tissue specificity of target genes was obtained from UniGene (www.ncbi.nlm.nih.gov/unigene) EST library database. Tissue specificity of SDH was identified in Ae. aegypti cluster and those of other genes (for which data were not available in Aedes aegypti cluster) were indirectly predicted using their Drosophila orthologs in the UniGene D. melanogaster cluster.

Semi-quantitative PCR analysis for analysis of gene expression

To test tissue specificity, semi-quantitative PCRs were performed. Ten adult Aedes aegypti females were prepared for dissection. After salivary glands were dissected using a pair of forceps, heads, midguts and ovaries were sequentially dissected out. Groups of each tissue were washed in PBS and stored in RNAlater solution (Cat# 7024; Ambion, CA) at 4°C. RNAs were extracted from the prepared samples and first-strand cDNAs were synthesized with use of 140 ng of RNAs for each group according to the protocol described above. PCR reactions were performed in a total volume of 10 μl containing 5 μl of Phusion High-Fidelity PCR Master Mix (Cat# M0531S; NEB, MA), 200 nM of each primer and cDNA as a template under the following condition: 98°C for 30 sec followed by 45 cycles of denaturation at 98°C for 10 s, annealing at 71°C for 1 min and extension at 72°C for 1 min with final extension at 72°C for 10min (Table 2 for primer sequences).

Statistical analysis

Statistical analyses of differences in transcript levels compared to the control were performed by Mann-Whitney test (P<0.05) whereas differences of silencing efficiencies among 4 concentrations (50, 100, 500 and 1000ng) of dsNfs1 were compared by analysis of variance (ANOVA; P<0.05) using Stata 10.0 (StataCorp, TX).

Results and discussion

In a pilot study, we tried to knock down 12 target genes of interest and found that the silencing efficiencies of those genes were not comparable to each other (unpublished data). To address this discrepancy in gene silencing, we selected the most- and least-silenced target genes, Nfs1 and SDH respectively. Different amounts of dsRNAs targeting Nfs1 or SDH mRNAs were intrathoracically injected and the effects of gene silencing were evaluated by quantitative real-time PCR (qRT-PCR). The Nfs1 gene in humans and yeast is involved in nitrogen fixation and post-transcriptional thio-modification, and is expressed predominantly in mitochondria (27, 28). Short-chain dehydrogenase belongs to the short-chain dehydrogenases/reductases family that is involved in retinoid and steroid hormone biosynthesis in mammals (29).

Concentration-dependent silencing of dsRNA was compared between the Nfs1 and SDH transcripts that had been intrathoracically injected with four different quantities of dsRNA (50, 100, 500, and 1,000 ng per mosquito). After the injection, the mosquitoes were harvested at 3, 6, 9, 15 and 21 d.p.i.to determine the efficiency of RNAi silencing by each concentration of dsRNA over time. For the Nfs1 gene, all concentrations but two (50 and 100 ng at 3 d.p.i.) significantly knocked down the target transcripts compared to the control (Mann-Whitney test, P<0.05) (Figure 1). Failure of the 50 and 100 ng groups to silence Nfs1 mRNAs at 3 d.p.i. may be due to a combination of low quantities of dsNfs1 and a relatively short period of time for intracellular uptake of dsRNA to become effective throughout mosquito bodies. ANOVA was then performed to compare silencing efficiencies of the 4 groups. The efficiency of the 1,000 ng group was statistically different from the 500 ng samples at 6 d.p.i. and 100 ng samples at 21 d.p.i. (ANOVA, P<0.05). Although there was no significant difference between 500 ng and 1,000 ng at 3, 9, 15 and 21 d.p.i. (ANOVA, P>0.05), the average silencing efficiencies by 1,000 ng was highest at each time point. Thus, at least 500 ng of dsRNA, but preferably 1,000 ng dsRNA per mosquito, is recommended to achieve effective and consistent silencing over a broad range of time. These two effective doses of dsNfs1 reduced the target transcripts by 65% and 80%, respectively, at 21 d.p.i. During the experimental period of 21 d.p.i., the longevity of the gene-silenced mosquitoes was not affected by injection of 500 or 1,000 ng dsRNA, suggesting these amounts can be used without loss of fitness (data not shown). Conversely, silencing of SDH was not consistent under the same dsRNAi conditions as Nfs1 (Figure 2). For example, 50 ng and 100 ng dsSDH knocked down the target gene transcripts only at 9 d.p.i. and 3 d.p.i., respectively (Mann-Whitney test, P<0.05), showing no positive correlation between dsRNA quantities injected and silencing efficiency of the target gene. Meanwhile, 500 and 1,000 ng dsSDH knocked down the target mRNA only up to 6 and 9 d.p.i., respectively (Mann-Whitney test, P<0.05; Figure 2).

Figure 1. Double-stranded RNAi (dsRNAi) silencing of Nfs1 in female Aedes aegypti.

Figure 1

Nfs1 transcripts were knocked down by intrathoracic injection of the four indicated quantities of dsNfs1 per mosquito. Histograms indicate mean residual amounts of Nfs1 mRNAs in three biological replicates after dsRNA silencing in comparison to the control value that is normalized to be 100%. Error bars represent standard errors (SE). The control mosquitoes were injected with dsβ-gal at the same concentrations as dsNfs1. The asterisks (*) denote significant reduction of the Nfs1 transcripts in the silenced mosquitoes compared to their own controls (Mann-Whitney test; * P<0.05). The two different letters (A and B) indicate a statistical difference from each other (ANOVA; AB P<0.05).

Figure 2. Double-stranded RNAi (dsRNAi) silencing of SDH in female Aedes aegypti.

Figure 2

SDH transcripts were knocked down by intrathoracic injection of the four indicated quantities of dsSDH per mosquito. Histograms indicate mean residual amounts of SDH mRNAs in three biological replicates after dsRNA silencing in comparison to the control value that is normalized to be 100%. Error bars represent standard errors (SE). The control mosquitoes were injected with dsβ-gal at the same concentrations as dsSDH. The asterisks (*) denote significant reduction of the SDH transcripts in the silenced mosquitoes compared to their own controls. (Mann-Whitney test; * P<0.05).

The silencing efficiency of Nfs1 and SDH were very distinct from each other. While all quantities of dsNfs1 silenced the target mRNA up to 21 d.p.i., it was only 1,000 ng dsSDH that could silence its cognate mRNA transcript at least at three consecutive time points including 3, 6, and 9 d.p.i. (Figure 3). This suggests that SDH may require higher concentrations of dsRNA than 1,000 ng to obtain substantial gene silencing beyond 9 d.p.i.

Figure 3. Persistence of dsRNA silencing differs.

Figure 3

dsRNAi-mediated gene silencing of Nfs1 (■) lasts up to 21 d.p.i. at all concentrations. In contrast, dsRNAi silencing of SDH ( Inline graphic) lasts up to 9 d.p.i. only when 1,000 ng dsSDH is used. The asterisk (*) denotes significant reduction of target mRNAs in dsRNAi-silenced mosquitoes compared to their own controls that were injected with dsβ-gal in triplicate experiments (Mann-Whitney test; * P<0.05). Error bars represent standard errors (SE).

There are several possible reasons in the discrepancy of silencing efficiencies. First, we speculated the low silencing efficiency and short duration of silencing may have resulted from tissue specificity (25). Expression profiles of Nfs1 by body parts in Ae. aegypti were not available in the UniGene cluster, so its Drosophila ortholog, CG12264, was used to infer its expression sites (UniGene ID: Dm.21103). By inferring from the D. melanogaster EST profiles, the Nfs1 protein is predicted to be expressed in embryonic tissue, head, ovary and testis, suggesting its Ae. aegypti ortholog could be a tissue non-specific gene (Table 3A). In UniGene database at the NCBI, SDH was identified in salivary glands in Ae. aegypti using the UniGene cluster (UniGene ID: Aae.10913) (Table 3B), however RNA sequencing detected a modest level of gene expression in other tissues including antenna, legs, and ovary of Ae. aegypti (26). We next performed semi-quantitative PCR to confirm tissue specificity. We showed the Nfs1 gene is expressed in salivary glands, heads, midguts and ovaries as predicted by EST profiles. Also we confirmed that the SDH was expressed in four different tissues and the intensity of the band was noticeably lower than the Nfs 1 gene (Figure 4).

Table 3.

UniGene profiles of Aedes aegypti cysteine desulfurylase (Nfs1) are not available at the NCBI. Therefore, a Drosophila ortholog of cysteine desulfurylase, CG12264 (UniGene ID: Dm.21103) was used to infer tissue expression of Ae. aegypti Nfs1. B. UniGene profiles of Ae. aegypti short-chain dehydrogenase (SDH; UniGene ID: Aae.10913) can be obtained from the NCBI. This table indicates SDH may be a salivary gland-specific or enriched gene.

EST profile of a Drosophila ortholog of Nfs1, CG12264
cDNA Source Transcripts per Million Gene EST/ Total EST in Pool
blood 0 0/6308
embryonic tissue 207 4/19269
fat body 0 0/9118
gonad 0 0/14984
head 208 6/28744
ovary 177 2/11249
testis 94 3/31708
EST profile of SDH, AAEL008159
cDNA Source Transcripts per Million Gene EST/ Total EST in Pool
corpus allatum 0 0/1307
midgut 0 0/1731
salivary gland 48 1/20440

Figure 4. Expressions of Nfs1 and SDH genes in various tissues of Aedes aegypti.

Figure 4

Transcript level of Nfs1 and SDH were shown using semi-quantitative PCR. Both genes are expressed in all tissues examined (S: salivary glands; H: heads; M: midguts; O: ovaries). However, SDH was less expressed in all tissues except for head compared to Nfs1.

Because the two genes were not tissue-specific genes, another reasonable theory explaining the silencing inefficiency is inhibition of dsRNA uptake. In D. melanogaster, egghead (CG9659), Nina C (CG5125), and CG4572 proteins have been shown to be involved in systemic uptake of dsRNA in the cellular membrane (30). Loss of function mutant flies of these genes lacked RNAi-mediated innate immune response to Sindbis virus and Drosophila C virus infection because cellular uptake of dsRNA was abolished. In addition, there is evidence that scavenger receptors are involved in active uptake of dsRNA through an endocytic pathway in Drosophila S2 cells (31, 32). Thus, silencing can be inefficient due to reduced dsRNA uptake. Last, we can infer that the short life of SDH mRNAs may result in lower silencing efficacy. Short mRNA life caused inefficient silencing by siRNAs/miRNAs in HeLa cells (33). Since SDH was relatively less expressed in all tissues but heads compared to Nfs1, it could have a faster decay rate that may cause inefficient silencing.

One more possible explanation about the discrepancy of silencing efficiencies can be simply transcript abundance. Several studies with siRNA-mediated gene silencing in a human cell line observed a correlation between targeted gene expression level and silencing efficiency (34-36). Those studies pointed out that the level of transcript accumulation is one of the major factors on gene silencing efficiency. Hu et al (35) suspected that the sense and anti sense RNA could have been bound together due to their complement sequences. However, we have similar results with dsRNA. Therefore, genes expressed at lower levels might also be less susceptible to dsRNA mediated transcript degradation within the mosquito.

During the extrinsic incubation time, dengue virus replicates to its peak level between 8 and 9 days after infection in the midgut or leg tissues (37). Therefore, maintaining high levels of gene silencing up to 21 d.p.i. by using 1,000 ng dsRNA should allow gene functional studies to look into dengue-Ae. aegypti interactions via phenotypic knockouts of candidate genes in the midgut. If the target gene is less silenced for some reason, higher concentrations (>1 μg) of dsRNA may be advisable to perform in vivo assays that require more than 7 days. Our observations are supported by previous findings in Ae. aegypti, in which 500 ng of dsRNA was used to knockdown tissue non-specific or midgut-specific genes such as dicer 2, r2d2, argonaute 2, late trypsin, and chymotrypsin, and silencing of these genes was assessed between 2 and 4 d.p.i. (13, 18). However, 500 ng dsRNA is less than a half of what was used for other dsRNAi assays in Ae. aegypti. For example, argonaute 2, relish 2, and target-of-rapamycin (TOR) genes were knocked down with 1 μg dsRNA(6, 19, 21) while phosphatase and tensin homologs (PTENs) were silenced with 2 μg dsRNA (20). Likewise, silencing effects of these genes were determined within 3 to 4 d.p.i. For such relatively prompt assays, high concentrations of dsRNA may not have been necessary. In An. gambiae, intrathoracic injection of 650 ng dsRNA per adult has been shown to silence agglutinin, hsc70B and EF-1α gene expression at 6 d.p.i., which is comparable to our results (14).

To obtain optimum gene silencing, it will be useful to predetermine the ideal quantity of dsRNA for injection into Ae. aegypti or other mosquito vectors. This will be particularly relevant to salivary gland-specific genes because salivary glands are not only refractory to the uptake of dsRNA but also the effect of silencing may not last as long as midgut genes. During an extrinsic incubation time of dengue virus replication, for example, salivary gland-specific genes are expected to require relatively longer observation (> 7 days) than midgut genes before testing phenotypic changes (e.g. viral titers or infection intensities) caused by dsRNA silencing. Often, effectiveness of dsRNA silencing in salivary glands was assessed between 2 to 4 d.p.i. and phenotypic alterations on dengue viral titers were estimated at much later time points between 9 and 17 d.p.i. (6, 13, 18). Therefore, expression profiles of target genes should be considered before physical injections of dsRNAs.

In conclusion, we have found that the efficiency of gene knockdown by dsRNAi may differ between genes. The reason could be ineffective dsRNA uptake. Although, this study was limited to testing only two genes due to the highly demanding nature of the experiments in terms of a large number of intrathoracic injections and subsequent analytical assays for multiple dsRNA concentrations and time points, nevertheless, our findings suggest that at least 500 but preferably 1,000 ng dsRNA should be used for general dsRNAi experiments, but for ineffectively silenced genes, more than 1,000 ng dsRNA will yield more consistent and long-lasting silencing effects. Therefore, quantitative and temporal analysis of double-stranded RNAi should be a prerequisite before actual experiments. Based on such information, one can attempt to optimize dsRNA silencing experiments in Ae. aegypti and other mosquito vectors whose genome annotations are available.

Acknowledgments

This work was supported in part by Tulane Research Enhancement Fund, NIH/NIAID grant (1R21AI076774), and Applied Mosquito Research grant (P0047017).

Footnotes

Conflicts of Interest

The authors declare no conflict of interest.

References

  • 1.Kyle JL, Harris E. Global spread and persistence of dengue. Annual Review of Microbiology. 2008;62:71–92. doi: 10.1146/annurev.micro.62.081307.163005. [DOI] [PubMed] [Google Scholar]
  • 2.WHO. Fact Sheet. World Health Organization; 2009. Dengue and dengue haemorrhagic fever. [Google Scholar]
  • 3.Myles KM, Wiley MR, Morazzani EM, Adelman ZN. Alphavirus-derived small RNAs modulate pathogenesis in disease vector mosquitoes. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:19938–19943. doi: 10.1073/pnas.0803408105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sarkar A, Yardley K, Atkinson PW, James AA, O’Brochta DA. Transposition of the Hermes element in embryos of the vector mosquito, Aedes aegypti. Insect Biochemistry and Bolecular Biology. 1997;27:359–363. doi: 10.1016/s0965-1748(97)00018-0. [DOI] [PubMed] [Google Scholar]
  • 5.Higgs S, Rayner JO, Olson KE, Davis BS, Beaty BJ, Blair CD. Engineered resistance in Aedes aegypti to a West African and a South American strain of yellow fever virus. The American Journal of Tropical Medicine and Hygiene. 1998;58:663–670. doi: 10.4269/ajtmh.1998.58.663. [DOI] [PubMed] [Google Scholar]
  • 6.Franz AWE, Sanchez-Vargas I, Adelman ZN, et al. Engineering RNA interference-based resistance to dengue virus type 2 in genetically modified Aedes aegypti. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:4198–4203. doi: 10.1073/pnas.0600479103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Travanty EA, Adelman ZN, Franz AWE, et al. Using RNA interference to develop dengue virus resistance in genetically modified Aedes aegypti. Insect Biochemistry and Molecular Biology. 2004;34:607–613. doi: 10.1016/j.ibmb.2004.03.013. [DOI] [PubMed] [Google Scholar]
  • 8.Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409:363–366. doi: 10.1038/35053110. [DOI] [PubMed] [Google Scholar]
  • 9.Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science. 2001;293:1146–1150. doi: 10.1126/science.1064023. [DOI] [PubMed] [Google Scholar]
  • 10.Ueda R. Rnai: a new technology in the post-genomic sequencing era. Journal of Neurogenetics. 2001;15:193–204. doi: 10.3109/01677060109167376. [DOI] [PubMed] [Google Scholar]
  • 11.Sanchez-Vargas I, Travanty EA, Keene KM, et al. RNA interference, arthropod-borne viruses, and mosquitoes. Virus Research. 2004;102:65–74. doi: 10.1016/j.virusres.2004.01.017. [DOI] [PubMed] [Google Scholar]
  • 12.Campbell CL, Keene KM, Brackney DE, et al. Aedes aegypti uses RNA interference in defense against Sindbis virus infection. BMC Microbiology. 2008;8:47. doi: 10.1186/1471-2180-8-47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sánchez-Vargas I, Scott JC, Poole-Smith BK, et al. Dengue virus type 2 infections of Aedes aegypti are modulated by the mosquito’s RNA interference pathway. PLos Pathogens. 2009;5:e1000299. doi: 10.1371/journal.ppat.1000299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sim C, Hong YS, Tsetsarkin KA, Vanlandingham DL, Higgs S, Collins FH. Anopheles gambiae heat shock protein cognate 70B impedes o’nyong-nyong virus replication. BMC Genomics. 2007;8:231. doi: 10.1186/1471-2164-8-231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sessions OM, Barrows NJ, Souza-Neto JA, et al. Discovery of insect and human dengue virus host factors. Nature. 2009;458:1047–1050. doi: 10.1038/nature07967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Krishnan MN, Ng A, Sukumaran B, et al. RNA interference screen for human genes associated with West Nile virus infection. Nature. 2008;455:242–245. doi: 10.1038/nature07207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bhattacharya D, Mayuri, Best SM, Perera R, Kuhn RJ, Striker R. Protein kinase G phosphorylates mosquito-borne flavivirus NS5. Journal of Virology. 2009;83:9195–9205. doi: 10.1128/JVI.00271-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Brackney DE, Foy BD, Olson KE. The effects of midgut serine proteases on dengue virus type 2 infectivity of Aedes aegypti. The American Journal of Tropical Medicine and Hygiene. 2008;79:267–274. [PMC free article] [PubMed] [Google Scholar]
  • 19.Hansen IA, Attardo GM, Park J-H, Peng Q, Raikhel AS. Target of rapamycin-mediated amino acid signaling in mosquito anautogeny. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:10626–10631. doi: 10.1073/pnas.0403460101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Arik A, Rasgon J, Quicke K, Riehle M. Manipulating insulin signaling to enhance mosquito reproduction. BMC Physiology. 2009;9:15. doi: 10.1186/1472-6793-9-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Antonova Y, Alvarez KS, Kim YJ, Kokoza V, Raikhel AS. The role of NF-[kappa]B factor REL2 in the Aedes aegypti immune response. Insect Biochemistry and Molecular Biology. 2009;39:303–314. doi: 10.1016/j.ibmb.2009.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Geldhof P, Vissera A, Clarka D, et al. RNA interference in parasitic helminths: current situation, potential pitfalls and future prospects. Parasitology. 2007;134:609–619. doi: 10.1017/S0031182006002071. [DOI] [PubMed] [Google Scholar]
  • 23.Hong YS, Ton LQ, Collins FH. On methods of germ-line transformation and RNA interference in African malaria mosquito, Anopheles gambiae. Journal of Asia-Pacific Entomology. 2003;6:111–117. [Google Scholar]
  • 24.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Boisson B, Jacques JC, Choumet V, et al. Gene silencing in mosquito salivary glands by RNAi. FEBS Letters. 2006;580:1988–1992. doi: 10.1016/j.febslet.2006.02.069. [DOI] [PubMed] [Google Scholar]
  • 26.Matthews BJ, McBride CS, DeGennaro M, Despo O, Vosshall LB. The neurotranscriptome of the Aedes aegypti mosquito. BMC Genomics. 2016;17:32. doi: 10.1186/s12864-015-2239-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Andrew AJ, Song J-Y, Schilke B, Craig EA. Posttranslational regulation of the scaffold for Fe-S cluster biogenesis, Isu. Molecular Biology of the Cell. 2008;19:5259–5266. doi: 10.1091/mbc.E08-06-0622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Biederbick A, Stehling O, Rosser R, et al. Role of human mitochondrial Nfs1 in cytosolic iron-sulfur protein biogenesis and iron regulation. Molecular and Cellular Biology. 2006;26:5675–5687. doi: 10.1128/MCB.00112-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kallberg Y, Oppermann U, Jörnvall H, Persson B. Short-chain dehydrogenases/reductases (SDRs) European Journal of Biochemistry. 2002;269:4409–4417. doi: 10.1046/j.1432-1033.2002.03130.x. [DOI] [PubMed] [Google Scholar]
  • 30.Saleh M-C, Tassetto M, van Rij RP, et al. Antiviral immunity in Drosophila requires systemic RNA interference spread. Nature. 2009;458:346–350. doi: 10.1038/nature07712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Saleh MC, van Rij RP, Hekele A, et al. The endocytic pathway mediates cell entry of dsRNA to induce RNAi silencing. Nature Cell Biology. 2006;8:793–802. doi: 10.1038/ncbl439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ulvila J, Parikka M, Kleino A, et al. Double-stranded RNA is internalized by scavenger receptor-mediated endocytosis in Drosophila S2 cells. Journal of Biological Chemistry. 2006;281:14370–14375. doi: 10.1074/jbc.M513868200. [DOI] [PubMed] [Google Scholar]
  • 33.Larsson E, Sander C, Marks D. mRNA turnover rate limits siRNA and microRNA efficacy. Mol Syst Biol. 2010;6 doi: 10.1038/msb.2010.89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hong SW, Jiang Y, Kim S, Li CJ, Lee DK. Target gene abundance contributes to the efficiency of siRNA-mediated gene silencing. Nucleic Acid Ther. 2014;24:192–198. doi: 10.1089/nat.2013.0466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hu X, Hipolito S, Lynn R, Abraham V, Ramos S, Wong-Staal F. Relative gene-silencing efficiencies of small interfering RNAs targeting sense and antisense transcripts from the same genetic locus. Nucleic Acids Res. 2004;32:4609–4617. doi: 10.1093/nar/gkh790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Krueger U, Bergauer T, Kaufmann B, et al. Insights into effective RNAi gained from large-scale siRNA validation screening. Oligonucleotides. 2007;17:237–250. doi: 10.1089/oli.2006.0065. [DOI] [PubMed] [Google Scholar]
  • 37.Richardson J, Molina-Cruz A, Salazar MI, Black W. Quantitative analysis of dengue-2 virus RNA during the extrinsic incubation period in individual Aedes aegypti. The American Journal of Tropical Medicine and Hygiene. 2006;74:132–141. [PubMed] [Google Scholar]

RESOURCES