Abstract
Primula poissonii (Primulaceae) is a perennial herb, widely distributed in the Hengduan Mountain region of Southwest China. In this study, Roche 454 pyrosequencing was used to isolate microsatellite markers. A total of 4528 unique sequences were identified from 68,070 unique reads. Of these, eighty-seven microsatellite loci were screened for utility using two criteria: successful PCR amplification and variation of these loci within three wild P. poissonii populations. Twenty loci were successfully amplified and exhibited polymorphic alleles. The number of observed alleles ranged from 1 to 9 with an average of 3.5. The observed and expected heterozygosities ranged from 0.087 to 1.000 and from 0.124 to 0.828, respectively. Among these SSR loci, only the P69 locus could not be cross-amplified successfully in two closely related species P. wilsonii and P. anisodora. The microsatellite loci developed in this study will be useful for studying genetic diversity and speciation events between P. poissonii and closely related Primula species.
Keywords: Primula poissonii, 454 pyrosequencing, SSR, genetic diversity, speciation events, transferability
1. Introduction
The Hengduan Mountain region in southwestern China is considered as one of the most important biodiversity hotspots in the world [1]. The total number of spermatophytes in the region totals 8590, with 2783 (32.4%) being endemic to the region [2]. Primula L. (Primulaceae) is comprised of more than 500 species worldwide, with 300 distributed in China [3]. With over 100 Primula species narrowly distributed within the Hengduan Mountains, this region has received considerable attention from biologists [4,5,6,7].
Primula poissonii Franch. is a perennial herb, always found growing in wet areas or inundated meadows, at an average elevation of 2500–3100 m.a.s.l. [3]. It is an endemic species restricted to the Hengduan Mountains [3]. The complex topography of the Hengduan Mountains and climatic oscillation during the Quaternary period might have deeply affected the population structure and genetic diversity of P. poissonii [7]. Studies of P. poissonii with polymorphic markers (e.g., microsatellites) can serve as a model to help illuminate the historical changes of the Hengduan Mountains, just as P. mistassinica has for the boreal regions [8] and P. halleri for the alpine areas [9].
Microsatellite markers have been considered to be effective in assessing the genetic diversity and structure of plant populations [10,11,12,13]. A number of EST-SSR primers for P. poissonii were recommended by Zhang et al. [14]. EST-SSRs are particularly useful in exploring the genome for possible signatures of natural selection, however, they often exhibit non-neutrality [15]. Hence, high polymorphic and neutral genomic SSR markers would be better resources to assess the genetic diversity and differentiation of natural populations of P. poissonii. Recently, next-generation sequencing technology has been widely used in many areas, including the development of novel microsatellite markers [8,10,11]. In this study, we developed a set of variable microsatellite markers using the Roche 454 pyrosequencing platform. These markers will likely to be important tools for investigating genetic diversity, population structure, and speciation history of P. poissonii and closely related taxa.
2. Results and Discussion
Identified unique reads totaled 68,070, ranging from 300 to 600 base pairs. A total of 7615 unique reads contained at least one microsatellite motif, of which 4528 unique sequences were identified with sufficiently large flanking regions suitable for primer design (the sequences in these reads are available upon request). The microsatellite sequencing efficiency using Roche 454 high-throughput sequencing technology in P. poissonii (59.5%) was higher than that in Primula mistassinica (31.2%) [8] or Primula veris (22.2%) [16].
Eighty-seven microsatellite loci were randomly selected to test their performance in PCR amplification to assess polymorphism in three populations of wild P. poissonii. In these loci, perfect dinucleotide repeats were the most abundant (77.0%), with (AC)n/(TG)n/(CA)n/(GT)n being the most common motifs (50.7%).
All primer pairs were tested in nine P. poissonii individuals by using PCR amplification. Successful amplification was checked by running PCR product out on 2% agarose gels. PCR product showing a single, clear band on agarose gels was sequenced to verify the existence of corresponding repeat motifs. Twenty-five primer pairs which could generate clear PCR product of appropriate size (100–300 bp) and with repeat motifs, were resynthesized with fluorescent FAM or HEX labels. Subsequent amplification trials were conducted in all 77 individuals from three wild populations.
Five loci could not be clearly characterized and were therefore discarded in the following analyses. The characters of the remaining 20 polymorphic loci are listed in Table 1. Genetic diversity parameters for three wild P. poissonii populations are shown in Table 2. The number of alleles (A) varied from 1 to 9, with an average of 3.5. Among polymorphic loci, the observed heterozygosity (HO) and expected heterozygosity (HE) ranged from 0.087 to 1.000, 0.124 to 0.828, respectively. The inbreeding coefficient (Fis) ranged from −1.000 to 0.710. Some loci deviated significantly from Hardy-Weinberg equilibrium (HWE) in several populations (Table 2), mainly result of heterozygote deficiency, such as locus P16 in the Lijiang population (LJ). The presence of null alleles, Wahlund effect, and small population size might cause an excess of homozygotes [17]. In this study, only P4, which deviated from Hardy-Weinberg equilibrium in population LGH, can be attributed to the presence of null alleles detected by MICRO-CHECKER (Table 2). The limited sampling ranges of each population is likely the leading cause of the observed excess of homozygotes.
Table 1.
Characteristics of 20 microsatellite loci developed in Primula poissonii.
| Locus | Primer Sequences (5′-3′) | Repeat Motif | Fragment Size Range (bp) | Tm (°C) | GenBank Accession No. |
|---|---|---|---|---|---|
| PP4 | F:TTGAGAGGGGTGTTTTGGTC | (AG)12 | 226–246 | 60 | KU744608 |
| R:CACCTCTCTTCCCCTCTTCC | |||||
| PP10 | F:TCTCGTCTTTTCCGCAAACT | (AT)15 | 238–256 | 60 | KU744609 |
| R:TCATCATCATCACACGCAAA | |||||
| PP13 | F:AATCTTCTAACACGCATTCACTC | (AT)13 | 165–163 | 57.5 | KU744610 |
| R:GGGGTAGATTGAATGTTTCCG | |||||
| PP14 | F:CCAAACCAAACACATTGGAA | (AT)11 | 258–271 | 60 | KU744611 |
| R:GGCATAGGTTGTTCCTGCAT | |||||
| PP16 | F:TCCAGTGACCACTCTGCTTG | (CTT)14 | 280–286 | 60 | KU744612 |
| R:ATGGTGCTTAATTCGTTGCC | |||||
| PP17 | F:GCCTCAATCTGCCACTCAAT | (CA)19 | 168–190 | 55.5 | KU744613 |
| R:AAGCTCCTGGTTGAAAGGGT | |||||
| PP27 | F:TCATGAATTCGGACTGGAGA | (AG)11 | 136–150 | 55.5 | KU744614 |
| R:AGCACTTCATTTGGTGAGCC | |||||
| PP31 | F:TCGGTCTATGATTTGGAATGG | (TG)13 | 146–150 | 59 | KU744615 |
| R:TCAACATGCCTCTACAAGCG | |||||
| PP37 | F:GGAAAATCAATCTTGGGGGT | (AAC)14 | 231–256 | 60 | KU744616 |
| R:TTGTACCCGTCATCGGATTT | |||||
| PP38 | F:TTATCACTGCCATTTGGCTAC | (TTC)14 | 188–223 | 60 | KU744617 |
| R:CATGGCACTTTGTCATTTAGGA | |||||
| PP48 | F:ACTAGCAACAACCCAAACGG | (CA)16 | 288–300 | 60 | KU744618 |
| R:ATAGGGACGTTGATCGCTTG | |||||
| PP49 | F:AGGGAACTACACGTTTGGCA | (TG)16 | 201–211 | 60 | KU744619 |
| R:AACACCTGCCACATCACTTG | |||||
| PP50 | F:TCACAAGCATTTTATCGGCA | (CA)16 | 198–202 | 60 | KU744620 |
| R:AAATGGGTGAGTTTGCGAAG | |||||
| PP52 | F:AAATAGGTCCGCATACGTGC | (AC)15 | 300–310 | 60 | KU744621 |
| R:TTATGAAGTATGTTGTGTATGAAGCA | |||||
| PP62 | F:TTCATCTTGATTAATTGGGGG | (TA)14 | 231–252 | 60 | KU744622 |
| R:TCACCATTTTCACTAGACGCA | |||||
| PP69 | F:GTGAATGGGTAGCGGACAAT | (AT)11 | 336–354 | 60.7 | KU744623 |
| R:GGTGCCGAAGGTGCTTAG | |||||
| PP72 | F:ATCCAAGATGAGCAACTCCG | (TCT)7 | 184–209 | 60 | KU744624 |
| R:CCATTCATCTCAACAATAGATTTCC | |||||
| PP75 | F:CGAGCGTGTCCTGGATATTT | (AT)10 | 210–216 | 60 | KU744625 |
| R:ATTTCTCCGGATTCGTCACA | |||||
| PP81 | F:CCTCCCCCTTCTTCATTCTC | (AG)11 | 140–152 | 60.7 | KU744626 |
| R:ACCTCTCCTCCGTCTTCCTC | |||||
| PP84 | F:TGCTTAGTGCTAAACAACTCATTG | (TGT)8 | 117–120 | 60 | KU744627 |
| R:CCGGAATTCTCTCCTCCTTC |
Table 2.
Population genetic parameters estimated (per nSSR locus) in three populations and two species of Primula section Proliferae.
| Primula poissonii | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Locus | LJ (n = 25) | LGH (n = 23) | YY (n = 29) | Total A | Primula wilsonii | Primula anidosora | |||||||||
| A | Ho | He | Fis | A | Ho | He | Fis | A | Ho | He | Fis | ||||
| P4 | 9 | 0.960 | 0.782 | −0.208 | 7 | 0.261 | 0.453 a,b | 0.442 | 5 | 0.483 | 0.646 b | 0.269 | 13 | + | + |
| P10 | 6 | 0.240 | 0.566 b | 0.590 | 4 | 0.261 | 0.601 b | 0.581 | 3 | 0.759 | 0.514 | −0.463 | 9 | + | + |
| P13 | 1 | NA | NA | NA | 3 | 0.217 | 0.419 | 0.498 | 3 | 0.241 | 0.395 | 0.404 | 3 | + | + |
| P14 | 8 | 0.960 | 0.762 | −0.241 | 7 | 0.957 | 0.739 | −0.274 | 5 | 0.931 | 0.644 | −0.432 | 10 | + | + |
| P16 | 2 | 0.200 | 0.180 a | −0.091 | 3 | 0.696 | 0.480 | −0.431 | 2 | 0.607 | 0.423 | −0.421 | 4 | + | + |
| P17 | 7 | 0.720 | 0.766 | 0.081 | 5 | 0.478 | 0.520 a | 0.028 | 5 | 0.207 | 0.193 a | −0.057 | 8 | + | + |
| P27 | 9 | 0.560 | 0.798 b | 0.317 | 5 | 0.409 | 0.574 | 0.309 | 2 | 0.172 | 0.158 a | −0.077 | 15 | + | + |
| P31 | 4 | 0.160 | 0.403 b | 0.616 | 3 | 0.136 | 0.245 | 0.462 | 3 | 0.862 | 0.609 | −0.400 | 4 | + | + |
| P37 | 7 | 0.640 | 0.743 | 0.159 | 3 | 0.130 | 0.124 a | −0.031 | 3 | 0.517 | 0.595 | 0.147 | 8 | + | + |
| P38 | 8 | 0.360 | 0.696 b | 0.498 | 2 | 0.696 | 0.454 | −0.517 | 8 | 0.828 | 0.828 | 0.018 | 13 | + | + |
| P48 | 2 | 0.680 | 0.449 | −0.500 | 3 | 1.000 | 0.521 | −0.917 | 3 | 0.138 | 0.461 b | 0.710 | 4 | + | + |
| P49 | 3 | 0.619 | 0.441 | −0.383 | 1 | NA | NA | NA | 3 | 0.143 | 0.135 a | −0.044 | 4 | + | + |
| P50 | 3 | 0.800 | 0.563 | −0.404 | 2 | 0.087 | 0.227 b | 0.630 | 3 | 0.552 | 0.469 | −0.159 | 3 | + | + |
| P52 | 4 | 0.304 | 0.268 a | −0.112 | 2 | 0.773 | 0.474 | −0.615 | 2 | 0.552 | 0.400 | −0.366 | 4 | + | + |
| P62 | 3 | 0.320 | 0.274 a | −0.146 | 3 | 0.652 | 0.464 | −0.387 | 4 | 0.241 | 0.221 a | −0.077 | 5 | + | + |
| P69 | 5 | 1.000 | 0.574 | −0.732 | 4 | 1.000 | 0.593 | −0.676 | 3 | 1.000 | 0.624 | −0.579 | 9 | − | − |
| P72 | 4 | 0.160 | 0.151 a | −0.038 | 3 | 0.609 | 0.549 a | −0.086 | 8 | 0.241 | 0.565 b | 0.584 | 11 | + | + |
| P75 | 3 | 0.880 | 0.534 | −0.635 | 2 | 1.000 | 0.500 | −1.000 | 3 | 1.000 | 0.618 | −0.608 | 4 | + | + |
| P81 | 3 | 0.720 | 0.569 | −0.247 | 4 | 0.565 | 0.479 a | −0.158 | 3 | 0.690 | 0.546 a | −0.246 | 6 | + | + |
| P84 | 2 | 0.600 | 0.420 a | −0.412 | 1 | NA | NA | NA | 1 | NA | NA | NA | 2 | + | + |
| Mean | 4.650 | 0.544 | 0.497 | −0.117 | 3.250 | 0.496 | 0.419 | −0.135 | 3.600 | 0.508 | 0.452 | −0.110 | 6.950 | ||
+ = successful PCR amplification; – = unsuccessful PCR amplification; A = number of alleles per locus; He = expected heterozygosity; Ho = observed heterozygosity; Fis = fixation index frequency; a: Significant deviation from Hardy–Weinberg equilibrium (p < 0.05); b: Significant frequency of null alleles.
The P. poissonii species complex is part of a taxonomically challenging group, which consists of P. anisodora Balf. f. et Forr., P. wilsonii Dunn and P. poissonii. This complex is a good system to test species boundary, genetic introgression and speciation events in closely related taxa, especially those that may have experienced rapid evolutionary radiation. Yan et al. [18] confirmed that the P. poissonii complex is resolved as monophyletic with high support by DNA barcodes, but the exact relationships amongst these species is still unclear. Therefore, other reliable molecular markers (such as microsatellites) will facilitate further speciation studies of the complex. We conducted cross-species amplification tests in P. wilsonii and P. anisodora using the successful 20 microsatellite markers. Nineteen of the 20 microsatellite loci were amplified successfully, only the locus P69 failed (Table 2). This result demonstrates that the microsatellite primers developed in this study can be widely used in P. poissonii and its relatives (P. wilsonii and P. anisodora).
3. Experimental Section
3.1. Plant Materials and Genomic DNA Extraction
Seventy-seven individuals of P. poissonii were collected from three wild populations in the Hengduan Mountain region, in Southwest China. LJ (100°10′ E; 27°00′ N; voucher specimen No.: Y2013051) and LGH (100°44′ E; 27°42′ N; voucher specimen No.: Y2013075) populations both located in Yunnan Province, while population YY (101°42′ E; 27°31′ N; voucher specimen No.: Y2013087) is from Yanyuan, Sichuan Province. Leaf materials of P. anisodora (voucher specimen No.: Y2013062) and P. wilsonii (voucher specimen No.: Y2013015) were collected from Zhongdian, Yunnan Province and Ailao Mountain, Yunnan Province, respectively. Voucher specimens were deposited at the herbarium of the South China Botanical Garden (IBSC). Total genomic DNA was extracted following a modified version of the cetyltrimethyl ammonium bromide (CTAB) protocol of Doyle and Doyle [19].
3.2. SSR-Enriched Library Construction and 454 Sequencing
A shotgun library was prepared by shearing 1 μg of genomic DNA using the DNA Library Preparation Kit (Roche Applied Science, Indianapolis, IN, USA) following the GS FLX+ library preparation protocol. The shotgun library was further enriched by the biotin-capture method [20,21]. Eight 5’-biotinylated probes, which were recommended by Toth et al. [20] and Zane et al. [21], were used in this study, namely, (AG)10, (AC)10, (AAC)8, (ACG)8, (AAG)8, (AGG)8, (ACAT)6, and (ATCT)6. The microsatellite-enriched library was sequenced on a Roche 454 GS FLX platform.
3.3. Detection of SSR Markers and Primer Design
MISA software [22] was used to identify unique reads containing microsatellite repeats. The search was performed for six for di-, five for tri- and tetranucleotides repeats, respectively. And the parameter of a minimum product size was set to 100 bp. Primer3 software [23] was applied to design primer pairs. The minimum primer annealing temperature was set to 60 °C, primer size was between 18–22 bp with an optimal size of 20 bp, and other setting were performed with default values.
3.4. Amplification of SSR and Genotyping
PCR reactions were done in a PTC-200 Thermal Cycler (MJ Research, Watertown, MA, USA). Conditions of PCR amplification were as follows: an initial denaturation at 95 °C for 5 min; followed by 30 cycles at 94 °C for 30 s, locus-specific annealing temperature (Table 1) for 45 s, and 72 °C for 50 s; with a final extension at 72 °C for 7 min. All primer pairs were initially tested for successful PCR amplification in nine P. poissonii individuals on 2% agarose gels. PCR products which were single, clear bands on agarose gels were sequenced to check the existence of repeat motifs. Primer pairs in the first trial which could generate clear PCR product with repeat motifs were then resynthesized with a fluorescent dye (FAM or HEX). Subsequent analyses were conducted with the polymorphic markers for all 77 individuals of three wild P. poissonii populations. Thereafter, 1 μL of the PCR product containing the fluorescent dye-labeled fragments was added to 8.8 μL of formamide and 0.2 μL of GeneScan 500 ROXSize Standard (Applied Biosystems, Life Technologies, Woolston, Cheshire, UK) and subsequently run on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).
3.5. Data Analysis
Genotypes were called using Gelguest software (version 3.2.1; SequentiX-Digital DNA processing, Klein Raden, Germany). Genetic diversity parameters, allelic richness (A), observed and unbiased expected heterozygosity (HO, HE), and the inbreeding coefficient, were estimated using GenAlEx 6.5 [24,25]. Deviations from Hardy-Weinberg equilibrium (HWE) at each locus were tested using GENEPOP 4.0.7 [26]. Null alleles were detected by MICRO-CHECKER [27].
3.6. Validity of the Transferability of SSR Markers
Cross-species amplification tests were performed in P. wilsonii and P. anisodora, which are both morphologically close to P. poissonii. Primer transferability was considered successful when one clear distinct band of PCR product in the expected size range was apparent on 2% agarose.
4. Conclusions
In this study, we characterized twenty microsatellite loci for P. poissonii. These markers displayed high levels of polymorphism in three wild populations. Nineteen of these loci could be successfully amplified in the two other closely related Primula taxa (P. anisodora and P. wilsonii). These microsatellite markers will provide insight on population genetic structure and be useful for phylogeographic analyses. They will also help to detect the hybridization and/or genetic introgression between these three taxa in the P. poissonii complex.
Acknowledgments
This study was financially supported by the National Natural Science Foundation of China (31270009, 31500173) and Guangdong Natural Science Foundation (2014A030313759). We thank Zheng-Feng Wang, Zhi-Kun Wu, Xing Wu and Yuan Xu for help in sample collection or data analyses.
Abbreviations
The following abbreviations are used in this manuscript:
| PCR | Polymerase Chain Reaction |
| SSR | Simple Sequence Repeat |
| Mts | Mountains |
| EST-SSR | Expressed Sequence Tag Simple Sequence Repeat |
| HWE | Hardy-Weinberg Equilibrium |
| He | Expected Heterozygosity |
| Ho | Observed Heterozygosity |
| Fis | Fixation Index Frequency |
Author Contributions
H.G., G.-X.J. and Y.-H.F. designed the experiments. H.G., G.-X.J. and Y.-H.F. collected plant materials. L.-Y.J. and Z.-C.Y. performed the SSR experiments. L.-Y.J. and Z.-C.Y. analyzed the data. L.-Y.J., Z.-C.Y. and Y.-H.F. drafted the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Sample Availability: Not Available.
References
- 1.Myers N., Mittermeier R.A., Mittermeier C.G., da Fonseca G.A., Kent J. Biodiversity hotspots for conservation priorities. Nature. 2000;403:853–858. doi: 10.1038/35002501. [DOI] [PubMed] [Google Scholar]
- 2.Zhang D.C., Boufford D.E., Ree R.H., Sun H. The 29° N latitudinal line: An important division in the Hengduan mountains, a biodiversity hotspot in southwest China. Nord. J. Bot. 2009;27:405–412. doi: 10.1111/j.1756-1051.2008.00235.x. [DOI] [Google Scholar]
- 3.Hu C.M., Kelso S. In: Primulaceae. Wu Z.Y., Raven P.H., editors. Volume 15. Science Press; Beijing, China: Missouri Botanical Garden Press; St. Louis, MO, USA: 1996. pp. 99–185. [Google Scholar]
- 4.Li X.W., Li J. A preliminary floristic study on the seed plants from the region of Hengduan Mountain. Acta Bot. Yunnanica. 1993;15:217–231. [Google Scholar]
- 5.Yan H.F., Zhang C.Y., Wang F.Y., Hu C.M., Ge X.J., Hao G. Population expanding with the phalanx model and lineages split by environmental heterogeneity: A case study of Primula obconica in subtropical China. PLoS ONE. 2012;7:e4135. doi: 10.1371/journal.pone.0041315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang F.Y., Ge X.J., Gong X., Hu C.M., Hao G. Strong genetic differentiation of Primula sikkimensis in the East Himalaya–Hengduan Mountains. Biochem. Genet. 2008;46:75–87. doi: 10.1007/s10528-007-9131-9. [DOI] [PubMed] [Google Scholar]
- 7.Song S.M., Le W.P., Sun H., Li Z.M. Phylogeographical study on Primula poissonii (Primulaceae) from Hengduan Mountains. Plant Divers. Resour. 2011;33:91–100. [Google Scholar]
- 8.Matheny H., Edwards J., Maroja L.S. High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) Appl. Plant. Sci. 2013 doi: 10.3732/apps.1300002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhang L.R., Conti E., Keller B., Nowak M.D. Development of 12 polymorphic microsatellite loci in the high alpine perennial Primula halleri (Primulaceae) Appl. Plant. Sci. 2013 doi: 10.3732/apps.1300052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Schlautman B., Fajardo D., Bougie T., Wiesman E., Polashock J., Vorsa N., Steffan S., Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.) Molecules. 2015;20:2001–2013. doi: 10.3390/molecules20022001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Geng Q.F., Liu J., Sun L., Liu H., Ou-Yang Y., Cai Y., Tang X.S., Zhang H.W., An S.Q. Development and characterization of polymorphic microsatellite markers (SSRs) for an endemic plant, Pseudolarix amabilis (Nelson) Rehd. (Pinaceae) Molecules. 2015;20:2685–2692. doi: 10.3390/molecules20022685. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Powell W., Machray G.C., Provan J. Polymorphism revealed by simple sequence repeats. Trends. Plant. Sci. 1996;1:215–222. doi: 10.1016/S1360-1385(96)86898-0. [DOI] [Google Scholar]
- 13.Weising K., Nybom H., Pfenninger M., Wolff K., Kahl G. DNA Fingerprinting in Plants: Principles, Methods, and Applications. CRC Press; Boca Raton, FL, USA: 2005. pp. 1–444. [Google Scholar]
- 14.Zhang L., Yan H.F., Wu W., Yu H., Ge X.J. Comparative transcriptome analysis and marker development of two closely related Primrose species (Primula poissonii and Primula wilsonii) BMC Genom. 2013;14:329. doi: 10.1186/1471-2164-14-329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Li C., Sun Y., Huang H., Cannon C. Footprints of divergent selection in natural populations of Castanopsis fargesii (Fagaceae) Heredity. 2014;113:533–541. doi: 10.1038/hdy.2014.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bickler C., A’Hara S., Cottrell J., Rogers L., Bridle J. Characterisation of thirteen polymorphic microsatellite markers for cowslip (Primula veris L.) developed using a 454 sequencing approach. Conserv. Genet. Resour. 2013;5:1185–1187. doi: 10.1007/s12686-013-9997-2. [DOI] [Google Scholar]
- 17.Yan H.F., Ge X.J., Hu C.M., Hao G. Isolation and characterization of microsatellite loci for the ornamental plant Primula obconica Hance (Primulaceae) Hortscience. 2010;45:314–315. [Google Scholar]
- 18.Yan H.F., Liu Y.J., Xie X.F., Zhang C.Y., Hu C.M., Hao G., Ge X.J. DNA barcoding evaluation and its taxonomic implications in the species-rich Genus Primula L. in China. PLoS ONE. 2015;10:e0122903. doi: 10.1371/journal.pone.0122903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Doyle J.J., Doyle J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987;19:11–15. [Google Scholar]
- 20.Tóth G., Gáspári Z., Jurka J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res. 2000;10:967–981. doi: 10.1101/gr.10.7.967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zane L., Bargelloni L., Patarnello T. Strategies for microsatellite isolation: A review. Mol. Ecol. 2002;11:1–16. doi: 10.1046/j.0962-1083.2001.01418.x. [DOI] [PubMed] [Google Scholar]
- 22.Thiel T., Michalek W., Varshney R., Graner A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theor. Appl. Genet. 2003;106:411–422. doi: 10.1007/s00122-002-1031-0. [DOI] [PubMed] [Google Scholar]
- 23.Rozen S., Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Misener S., Krawetz S., editors. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press; Totowa, NJ, USA: 2000. pp. 365–386. [DOI] [PubMed] [Google Scholar]
- 24.Peakall R., Smouse P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes. 2006;6:288–295. doi: 10.1111/j.1471-8286.2005.01155.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Peakall R., Smouse P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics. 2012;28:2537–2539. doi: 10.1093/bioinformatics/bts460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Rousset F. genepop’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 2008;8:103–106. doi: 10.1111/j.1471-8286.2007.01931.x. [DOI] [PubMed] [Google Scholar]
- 27.Van Oosterhout C., Hutchinson W.F., Wills D.P., Shipley P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes. 2004;4:535–538. doi: 10.1111/j.1471-8286.2004.00684.x. [DOI] [Google Scholar]