In Silico development of new SSRs primer for aquaporin linked to drought tolerance in plants

ABSTRACT

Plants are exposed to various stress factors including biotic and abiotic stresses. Drought is a limiting factor that minimizes the development and growth of several plants in arid and semi-arid regions. Stress response is usually occur at different levels, Morphological, physiological and biochemical while at the molecular level a large number of genes are involved. This study aims at developing a new SSR primer for aquaporin related to drought stress in plants. A total of 177 complete coding sequences (CDS) available in the NCBI database are downloaded. After analyzing with BLAST, 163 sequences are selected. 1294 SSR derived from these sequences are characterized with MISA and indicating that all sequences contained SSRs. The most abundant SSR has been tetra-nucleotide repeat motif (36%) and among all the tetra-nucleotide repeats, the motif AAAG/CTTT was the most common type, whereas in tri-nucleotide, the motif CCG/CGG has been the predominate type. By using Primer3, 1120 primer pairs are generated and after analyzing, only 735 non redundant primer pairs that present the good characteristics are selected. Among them, some of the pairs of primers are randomly selected and validated on DNA of various species using PCR and agarose gel.

Introduction

Plants are exposed during their life-cycle to several environment stresses. Drought is one of the most abiotic stress factors that alters plants physiology, growth and the productivity of crop plants.¹

Various responses to drought stress are suggested including tolerance strategies and complex survival that are capable of changing gene expression at the molecular level. Many alternatives are produced in protein synthesis, and therefore in their biological functions.² Several genes have been already identified in various plants like, cereals, vegetables, and particularly in the model plant, Arabidopsis thaliana L.³

Aquaporins are integral membrane proteins, which facilitates the passive movement of water through cells and play a crucial role in plant water relations.^4-6 They have been shown to be involved in numerous physiological responses, particularly in water uptake and radial water transport.^6-8 Responses of aquaporins to drought stress are very diverse and depend on the investigated species, tissue, subfamily, isoform, and the level of stress used in the study. Aquaporins are outstandingly involves to various abiotic stresses and a number of studies have been conducted regarding the impact of salinity, cold, and drought on these proteins.^9-11 In olive (Olea europaea L.), two PIP (Plasma membrane Intrinsic Proteins) genes (OePIP1,1 OePIP2,1) and one TIP (Tonoplast Intrinsic Proteins) gene OeTIP1,1 showed a significant decrease at the transcript levels in leaves, roots, and twigs.^12,13 In the root of tobacco (Nicotiana tabacum L.), drought stress significantly reduced PIP transcript levels of two investigated genes, NtPIP1;1 and NtPIP2;1.^11,14,15

Aquaporins (AQPs) belong to the great family of conserved proteins termed MIPs (Major Intrinsic Proteins), and they exhibit a high diversity in numerous organisms.¹⁶ In plants, the aquaporin family is particularly abundant and have a high diversity of isoforms.¹⁷ Based on the sequence homology and sub-cellular localization, the higher plant aquaporins have been divided in five main homologous subfamilies; PIPs (Plasma membrane Intrinsic Proteins), TIPs (Tonoplast Intrinsic Proteins), NIPs (Nodulin 26-like Intrinsic Proteins), SIPs (Small Intrinsic Proteins) and XIPs (X Intrinsic Proteins).¹⁸ All MIPs (Major Intrinsic Proteins)include two highly conserved NPA (Asn-Pro-Ala) motifs that play a crucial role in selective water conduction in aquaporin water channels.¹⁹

Recent developments in molecular biology have resulted in the development of molecular markers such as RAPD (Randomly Amplified polymorphic DNA),²⁰ AFLP(Amplified Fragment Length Polymorphism),²¹ SSR(Simple Sequence Repeat),²² ISSR (Inter-Simple Sequence Repeat),²⁰ SRAP (Sequence Related Amplified Polymorphism),²³ that are used in various studies like, genetic diversity, fingerprinting and elucidation of the genetic origin of various species. Due to their many advantages, including co-dominance, high polymorphism, relative abundance and reproducibility, efficiency and simplicity, SSR markers were considered relevant markers for several studies such as plant cultivar identification, genetic linkage map construction, genetic diversity analysis, and comparative genomics.²⁴

Recently, the number of gene sequences as well as the complete genome of different plant species have increased significantly and are available online in various databases. In silico analysis of these sequences is crucial for the functional annotation of genes. In this context, the objectives of the present study are:

• Identifying a large number of aquaporin genes associated with drought stress;

• Comparing the abundance, distribution and dominant repeat motifs among SSR markers;

• Developing a new set of SSR-primers from various species, and testing some of the primers designed on four DNA accessions using PCR and agarose gel.

This resource will help the researchers in obtaining experimental data for the tolerance of drought of a large species.

Results and discussion

Frequency and distribution of genic SSR

Based on the complete CDS (coding Sequence), a total of 163 nucleotide sequences of aquaporins candidate genes were retrieved. These sequences are divided into four sub-families (PIP1, PIP2, TIP1 and TIP2) for drought stress response in various species (woody and herbaceous) (Supplementary Table1). The aquaporin PIP2 is the most abundant sub-family with 32 and 34 sequences in the woody and herbaceous plants, followed by PIP1, TIP1 and TIP2 sub-families (Figure 1).

Figure 1.

The number and type of aquaporin sequence in different species.

Using a tool known as MISA (MIcroSAtellite), 1294 microsatellites were detected from 163 nucleic acid sequences (179696bp). Out of the 1294 microsatellites, 162 had more than SSR and 84 SSRs present in compound formation (Table 1). Single repeat types of SSR represented 94.7% and compound repeats represented 5.3%.

Table 1.

Results of microsatellite search.

Total number of sequences examined	Total size of examined sequences (bp)	Total number of identified SSRs	Number of SSR containing sequences	Number of sequences containing more than 1 SSR	Number of SSRs present in compound formation
163	179696	1294	163	162	84

In this study, a total of 1294 SSRs containing repeats from mono- to hexa-nucleotides, being 1210 SSRs single (94%) and 84 SSRs compound formation (6%) for all studied species. Due to their repeat compositions, all simple-sequence repeats identified have been classified (Figure 2). The tetra-nucleotide repeat were most abundant (466) and accounted for 36% of the total SSRs, followed by tri-nucleotide repeats 19% (242), penta-nucleotides 18% (229), hexa-nucleotides 15% (189), mono- and di-nucleotides represent successively 6% (73) and 1% (11).

Figure 2.

Frequency distribution of different SSR repeat type.

The frequency and abundance of different motif repeats have been reported to show variable and uneven distribution among different organisms. The predominant type in the present study has been tetra-nucleotide, similar to previous studies with other plants, including sugar cane and cucumber.^25,26 However, this result is in contrast to earlier studies showing that type of motif repeats predominates in mushroom is mononucleotide,²⁷ in citrus tri-nucleotide²⁸ and in cotton penta-nucleotide.²⁹ The variation of this predominance of repeat motifs can be explained by the source of the DNA sequences (EST, cDNA, or gene sequences) used in each study. The di-nucleotide repeats were also the most frequent class of SSR derived from genomic DNA of various species, including melon, bean, peanut and quinoa.^30–34

Among the tri-nucleotide repeat units, CCG/CGG code which stands for proline and arginine, was the most abundant with frequency of 4.8% (67) followed by ACC/GGT code (60, 4.3%) which stands for threonine and glycine (Figure 3). These results are in line with the studies in Pyropia haitanensis wherein the GCC/CCG was the most common trinucleotide repeat, accounting for 60.07%.³⁵ Parekh, Kumar, Zala, Fougat, Patel, Bosamia, Kulkarni and Parihar³⁶ reported that AAG/CTT and ATC/ATG were the most common tri-nucleotide repeat in diploid cotton. Each triplet of nucleic acid describes a specific amino acid, which plays a crucial role in many cellular, biological, and metabolic processes in plants.³⁷

Figure 3.

Types and frequency of most common repeat motifs.

Of the tetra-nucleotide, the motifs AAAG/CTTT, AAAC/GTTT, ACCC/GGGT and AAGT/ATTC were the most frequent with frequencies of 4.6% (63), 3.5% (48), 3.2% (44) and 3% (42), respectively (Figure 3, Table 2). For the same reason, AAAG and ACCC were the most common motif types detected in cucumber genomic data. For di-nucleotide repeats, AG/CT was the most frequent with 1% (9) (Figure 3). Similar results were reported for C. canephora, wherein AG/CT was the most common motifs.³⁸ In monocots plants, the motifs CG/GC and CCG/CGG are the most abundant, whereas dicotyledonous plants have a low frequency.^39,40 In 5ʹ and/or 3ʹ UTR (untranslated) regions, dinucleotide repeats are the most abundant but occasionally produce in coding regions.⁴¹ Parekh, Kumar, Zala, Fougat, Patel, Bosamia, Kulkarni and Parihar³⁶ proposed that the generation of informative markers based on EST-SSR is made from long motif SSRs, like tetra-nucleotide repeat motif, which appeared to be polymorphic in their study.

Table 2.

Number and frequency of SSR from sequences of aquaporin gene.

	Class	Nombre of repeats (n)
	Repeats	2	3	4	5	6	7	8	9	10	> 10	Total	%
Mon-o-nucleotide
	A/T	-	-	-	-	-	-	-	-	11	67	78	5,6%
Di-nucleotide
	AC/GT	-	-	-	-	-	1	1	-	-	-	2	0,1%
	AG/CT	-	-	-	-	3	2	1	1		2	9	1%
Tri-nucleotide
	AAC/GTT	-	10	-	-	1	-	-	-	-	-	11	0,8%
	AAG/CTT	-	23	5	1	-	-	-	-	-	-	29	2,1%
	AAT/ATT	-	4	3	-	-	-	-	-	-	-	7	0,5%
	ACC/GGT	-	57	1	1	1	-	-	-	-	-	60	4,3%
	ACG/CTG	-	8	-	-	-	-	-	-	-	-	8	0,6%
	ACT/ATG	-	11	6	-	-	-	-	-	-	-	17	1,2%
	AGC/CGT	-	11	2	2		-	-	-	-	-	15	1,1%
	AGG/CCT	-	25	1	-	-	-	-	-	-	-	26	1,9%
	AGT/ATC	-	20	3	2	1	-	-	-	-	-	26	1,9%
	CCG/CGG	-	64	3	-	-	-	-	-	-	-	67	4,8%
Tetra-nucleotide
	AAAC/GTTT	42	5	1	-	-	-	-	-	-	-	48	3,5%
	AAAG/CTTT	60	3	-	-	-	-	-	-	-	-	63	4,6%
	AAAT/ATTT	24	-	-	-	-	-	-	-	-	-	24	1,7%
	AACC/GGTT	19	-	-	-	-	-	-	-	-	-	19	1,4%
	AACG/CTTG	15	3	-	-	-	-	-	-	-	-	18	1,3%
	AACT/ATTG	12	-	-	-	-	-	-	-	-	-	12	0,9%
	AAGC/CGTT	14	-	-	-	-	-	-	-	-	-	14	1,0%
	AAGG/CCTT	26	-	-	-	-	-	-	-	-	-	26	1,9%
	AAGT/ATTC	42	-	-	-	-	-	-	-	-	-	42	3,0%
	AATC/AGTT	7	-	-	-	-	-	-	-	-	-	7	0,5%
	AATG/ACTT	17	-	-	-	-	-	-	-	-	-	17	1,2%
	AATT/AATT	17	1	-	-	-	-	-	-	-	-	18	1,3%
	ACAG/CTGT	21	-	-	-	-	-	-	-	-	-	21	1,5%
	ACAT/ATGT	20	-	-	-	-	-	-	-	-	-	20	1,4%
	ACCC/GGGT	44	-	-	-	-	-	-	-	-	-	44	3,2%
	ACCG/CTGG	8	-	-	-	-	-	-	-	-	-	8	0,6%
	ACCT/ATGG	7	-	-	-	-	-	-	-	-	-	7	0,5%
	ACGC/CGTG	8	-	-	-	-	-	-	-	-	-	8	0,6%
	ACGG/CCTG	12	-	-	-	-	-	-	-	-	-	12	0,9%
	ACGT/ATGC	14	-	-	-	-	-	-	-	-	-	14	1,0%
	ACTC/AGTG	9	-	-	-	-	-	-	-	-	-	9	0,7%
	ACTG/ACTG	4	-	-	-	-	-	-	-	-	-	4	0,3%
	AGAT/ATCT	7	1	-	-	-	-	-	-	-	-	8	0,6%
	AGCC/CGGT	15	-	-	-	-	-	-	-	-	-	15	1,1%
	AGCG/CGCT	11	1	-	-	-	-	-	-	-	-	12	0,9%
	AGCT/ATCG	8	2	-	-	-	-	-	-	-	-	10	0,7%
	AGGC/CCGT	3	-	-	-	-	-	-	-	-	-	3	0,2%
	AGGG/CCCT	5	-	-	-	-	-	-	-	-	-	5	0,4%
	AGGT/ATCC	3	1	-	-	-	-	-	-	-	-	4	0,3%
	AGTC/AGTC	3	-	-	-	-	-	-	-	-	-	3	0,2%
	CCCG/CGGG	11	-	-	-	-	-	-	-	-	-	11	0,8%
	CCGG/CCGG	16	-	-	-	-	-	-	-	-	-	16	1,2%
(Pentanucleotide))		269	6	-	-	-	-	-	-	-	-	275	19,9%
(Hexa-nucleotide)n)		211	1	-	-	-	-	-	-	-	-	212	15,3%
Total		1004	257	25	6	6	3	2	1	11	69	1384

Design of SSR primers

The definition of primer pairs was made from the flanking sequences of SSRs. A total of 1120 primer pairs (for 85.8% of total SSR motifs) including the redundant were generated from the 1294 SSRs present in all sequences.

From the 1294 SSRs developed, there was a large proportion of primer pairs on tetra-nucleotide 37% (411), tri- nucleotide 19,9% (221), penta- nucleotide 18,9% (210) and hexa-nucleotide 16.1% (180) repeats, while compound (75), mono- (10) and di-nucleotide (5) repeats together represented less than 7% of the total primer pairs (Figure 4).

Figure 4.

Distribution of SSR primers including redundant.

In all 1120 primer pairs flanking the SSR repeat patterns, only non-redundant primer were analyzed by a free program online (Multiple Primer Analyzer). After analyzing, only 735 non-redundant primer pairs that present the good characteristics, which may open the possibilities for marker assisted selections. This molecular marker will be used for genetic studies such as identification and characterization genes associated with drought stress.

Further information on these 735 optimal SSR primer pairs designed for aquaporins is presented in Table 3, including primer sequence (forward and reverse) and their names, annealing temperature, % of CG, SSR repeat motifs, start and end of each primer and product size.

Table 3.

Primer pairs selected for amplification.

Primer	Repeats	Forward primer (5ʹ−3ʹ)	Reverse primer (3ʹ−5ʹ)	Tm ºC	Product size (bp)
DT_1	(TTTG) 2	TGCTGAGGAAAAGAGCCATT	CATCCTCTTCCTTTCCCTCC	53	102
DT_2	(TTGT) 2	AAGAGCAGGGCTTAAGAGGG	CAAAGGTTGGAAACTGAAGCA	54	139
DT_3	(GGGAGT)2	GTCACCAACGGCCAGACTAC	AGACCAGTCCGAACGTCATC	57	100
DT_4	(CCAG) 2	GAGATCATCGGCACCTTTGT	GGCATGCTGCTTGTTGTAGA	57	213
DT_6	(CCTT) 2	CATGGTCGTTTTACAGGGCT	TAGAAAACCGCCCTTGTCAG	53	262
DT_8	(GAAA)3	TTTCGAGTATTCCAAAAACCTCA	GATTTCTTCACGGTTTCCGA	53	119

Validation of the SSR primers

6 SSR primer pairs were selected, synthesized (Table 4), and tested by PCR on 3 genotypes of 4 species, Argan tree (Argania spinosa L.), Balanites (Balanites aegyptiaca L.), Wheat (Triticum æstivum L.), Shorgum (shorgum bicolor L.). After numerous optimizations of annealing temperature, all primers showed a generated right and reproducible amplified product.After numerous optimizations of annealing temperatures, DT_1, DT_2, DT_3, DT_4 and DT_6 primers showed a generated right and reproducible amplified product. For DT_8 no amplification was indicated. An example of amplification patterns obtained by DT_1 and DT_2 in different species was shown in Figure 5.

Figure 5.

Band patterns amplified by SSR primers DT_1 and DT_2, on genomic DNA of 4 species. Lane M (Marker Molecular 1kp), Ba (Balanites aegyptiaca L.), Aa (Argania spinosa L.), Sb(Shorgum bicolor L.), Ta (Triticumæstivum L.), Lane NC (Negative Control).

Generally, SSRs are known by its specificity at locus and, therefore, it is expected that each amplification could yield one or two bands with SSR primer pair. However, in the present study, most of the primer pairs produced more than 2 bands. Generation of multiple bands can be explaining probably by duplication events in species genomes during its evolution history.⁴² This suggests the non-use of these primers for diversity studies. However, we can use them for the eventual detection of “aquaporin” expression gene polymorphism and highlight the transferability of these markers in related species.

Materials and methods

In Silico detection of aquaporin sequences

Full length aquaporin sequences from several species including woody and herbaceous plants, were obtained from Genbank database (National Center for Biotechnology Information, (http://www.ncbi.nlm.nih.gov/) which were analyzed using BLAST toolto eliminate similar and redundancy sequences.

SSR detection and development of primer pairs designing

The MISA (MIcroSAtellite) was used for detecting SSR in the aquaporin sequences based on criteria such as: minimum number of 2 repeats for tetra-,penta-, and hexa-nucleotide motifs, 3 repeats for tri- nucleotide motif, 6 repeats for di- nucleotide motif and 10 repeats for mono- nucleotide motif. The primers flanking SSRs were designed using the primer3 with length of 18–27 pb, annealing temperature of 57–61°C, and GC content from 26 to 67%. All primers designed were checked for desired characteristics like hairpin structure, primer dimer using oline tool, Multiple Primer Analyzer, ThermoFisher scientific (http://www.thermofisher.com/ma/en/home.html). The primers were named with prefix DAS (Drought_Aquaporin_SSR) followed by an order number.

Evaluation of the SSR markers

In order to test the effectiveness of the SSR, some primer pairs were selected for testing of DNA accession from 4 species. To validate the SSR markers, genomic DNA was extracted from young leaves using ISOLATE Plant Mini Kit (Bioline, USA) following the manufacturer’s protocol.

Standard PCR was carried out in a reaction volume of 25µl using MyTaq^TM HS Mix (Bioline, USA) according to the manufacturer’s instructions. PCR amplification was performed by thermocycler gradient (Applied Biosystem ® Veriti ® Thermal Cycler) using the following profile: 95°C for 1 min, followed by 30 cycles of 95°C for 15 s, appropriate annealing temperature for 15 s, 72°C for 15 s, and a final extension at 72°C for 1 min. Amplified products were electro-phoresed in 1.5% agarose gel.

Conclusion

Here, we used a candidate gene approach to identify a set of SSR markers in plants genes for drought stress and design the primer pairs associated with the markers developed. A total of 1294 microsatellites in 163 complete CDSs (coding sequences) of aquaporins in many species were identified, indicating all of sequences containing SSRs. The most abundant SSR was tetra-nucleotide (36%) repeat motif, and among all the tetra-nucleotide repeats, the motif AAAG/CTTT (4.6%) was the most abundant type. A total of 735 SSR primers were designed and selected with good criteria. From all SSR primers identified, 6 pairs of primers were selected and validated on 4 accessions genomic DNA. Five primers were given positive and reproducible results with a multi-band profile. These primer pairs may potentially serve as a new molecular marker, including polymorphism search for genes expressed in different species and highlight the transferability of these markers in related species. Thus, they may be used as markers of aquaporin genes in tolerance studies to dehydration plants and can also be employed in functional studies to mark the level of gene expression of these genes in new species.

Acknowledgments

This work was realized in the framework of conducting the project ArganBiogen and funded by Hassan II Academy of Science and Technology (Morocco) and The Ministry of Higher Education, scientific Research and Professional Training Of Morocco.

Compliance with ethics requirements

It is declared that this article is in entire compliance with the research ethics.

Supplemental material

Supplemental data for this article can be accessed here.