Abstract
Two cabbage (Brassica oleracea) cultivars ‘Tekila’ and ‘Kilaherb’ were identified as resistant to several pathotypes of Plasmodiophora brassicae. In this study, we identified a clubroot resistance gene (Rcr7) in ‘Tekila’ for resistance to pathotype 3 of P. brassicae from a segregating population derived from ‘Tekila’ crossed with the susceptible line T010000DH3. Genetic mapping was performed by identifying the percentage of polymorphic variants (PPV), a new method proposed in this study, through bulked segregant RNA sequencing. Chromosome C7 carried the highest PPV (42%) compared to the 30–34% in the remaining chromosomes. A peak with PPV (56–73%) was found within the physical interval 41–44 Mb, which indicated that Rcr7 might be located in this region. Kompetitive Allele-Specific PCR was used to confirm the association of Rcr7 with SNPs in the region. Rcr7 was flanked by two SNP markers and co-segregated with three SNP markers in the segregating population of 465 plants. Seven genes encoding TIR-NBS-LRR disease resistance proteins were identified in the target region, but only two genes, Bo7g108760 and Bo7g109000, were expressed. Resistance to pathotype 5X was also mapped to the same region as Rcr7. B. oleracea lines including ‘Kilaherb’ were tested with five SNP markers for Rcr7 and for resistance to pathotype 3; 11 of 25 lines were resistant, but ‘Kilaherb’ was the only line that carried the SNP alleles associated with Rcr7. The presence of Rcr7 in ‘Kilaherb’ for resistance to both pathotypes 3 and 5X was confirmed through linkage analysis.
Introduction
Clubroot, caused by the obligate pathogen Plasmodiophora brassicae Woronin, attacks several economically important members of the family Brassicaceae, including canola/oilseed rape (Brassica napus L.), broccoli and cabbage (B. oleracea L.)1. The disease has been reported in more than 60 countries, with an estimated annual yield loss globally of 15%2. The pathogen induces the development of characteristic clubbing symptoms on the roots of susceptible plants, which results in wilting, premature yellowing and reduced quality and yield. Clubroot was first reported on canola on the Canadian prairies in 20033, and is spreading across the prairie region4. Crop rotation, increasing soil pH, and fungicide application5 have been recommended to manage clubroot on Brassica vegetables, but the efficacy of these methods is limited. Genetic resistance remains the most effective strategy for clubroot management6,7. Several pathotypes of P. brassicae are present in Canada (pathotypes 2, 3, 5, 5X, 6 and 8), with pathotype 3 being the most prevalent and pathotype 5X being one of the new pathotypes that can overcome the resistance in the current cohort of clubroot resistant cultivars8–11.
B. napus was originated from the interspecific hybridization of B. rapa and B. oleracea. The majority of genes for clubroot resistance that have been identified are from B. rapa subsp. rapifera12. Resistance in B. rapa is conferred by major and minor resistance genes, and resistance from B. rapa has been utilized widely in breeding for resistance to clubroot in B. rapa and B. napus7,13,14. Several clubroot resistance genes have been identified and mapped to chromosomes of B. rapa; CRc15 and Rcr811 on chromosome A02, Crr116 and Rcr911 on chromosome A08, Crr216 on A01, Crr416 on A06, Crr317, CRa18, CRk15, CRbkato19, CRb20,21, Rcr122, Rcr223 and Rcr411 on chromosome A03. CRa, CRbkato and Crr1 have been cloned from B. rapa24–26. They encode toll-interleukin-1 receptor/nucleotide binding site/leucine-rich repeat (TIR-NBS-LRR or TNL) proteins. In contrast to B. rapa, no major clubroot resistance genes or lines with strong resistance have been identified in B. oleracea27.
Molecular mapping of genes in plants is based primarily on polymorphisms in genomic DNA sequences. Transcriptome analysis of short sequences generated from RNA sequencing (RNA-Seq) platforms has been used extensively for gene expression profiling and detection variants in many plant systems28–30.
RNA-Seq is being widely used to identify single nucleotide polymorphisms (SNPs) that can be used as molecular markers31,32. Also, bulk segregant analysis (BSA) has been applied for detecting molecular markers linked to traits of interest, such as disease resistance33. In BSA, bulks of plants with contrasting phenotype are generated. Recent studies have used bulked segregant RNA-Seq (BSR-Seq), a combination of BSA and RNA-Seq approaches23,34–36 to map genes of interest. Recently, BSR-Seq of genome-wide DNA variants in a B. rapa population were used to map clubroot resistance gene Rcr1 onto chromosome A03. More than 70% of the variants between resistant (R) and susceptible (S) bulks were monomorphic in each chromosome except A03, where a significantly higher percentage of polymorphic variants (PPV) were present28. We therefore hypothesized that a gene could be genetically mapped by identifying the PPV in a genome through BSR-Seq.
A previous study identified two cabbage (B. oleracea) cultivars, ‘Tekila’ and ‘Kilaherb’, with strong resistance to the major strains of P. brassicae in western Canada37. The objectives of the current study were: (i) to identify resistance gene in the cabbage cultivars; (ii) to test if identification of PPV could be used for gene mapping; (iii) to characterize transcriptome-wide variation and map the resistance gene; (iv) to develop SNP markers tightly linked to the resistance gene; and (v) to examine DNA variation in the target region and identify the most probable candidates for the gene.
Results
Resistance to clubroot in cultivar ‘Tekila’ is controlled by one dominant gene
The resistant hybrid ‘Tekila’ was crossed with a susceptible doubled-haploid line T010000DH3 to develop an F1 mapping population, which is equivalent to a BC1 population, because the resistant parent was a hybrid. Five weeks after inoculation with pathotype 3 of P. brassicae, the plants were rated for clubroot symptoms. Of the 465 F1 plant tested, 232 plants were resistant (R) and 233 were susceptible (S). The segregation ratio was 1R: 1S (χ2 = 0.7, P = 0.40), which indicated that resistance to pathotype 3 in this cultivar was likely controlled by a single dominant gene, designated as Rcr7 (Resistance to club-root 7).
Sequence alignment and read mapping
Six bulks were generated; three from the R plants and three from the S plants. RNA from each individual bulk was sequenced, resulted in six RNA sequence files. The total sequence counts were over 44 million (M) for R bulks, and 41 M for the S bulks. Approximately 80% and 83% of the total counts were assembled to reference genome in R and S pools, respectively. The total length of coding sequences assigned to chromosomes in the reference genome was 62.6 Mb. The total accumulated length of coding sequences aligned to chromosomes was ~447 Mb for each of the R and S pools. This gives an estimated 7-fold depth of coverage of the gene coding portion of the reference genome38.
Transcriptome haplotytping
A haplotype profile was established based on the alignment between the coding sequences of the reference genome and RNA-Seq from the R and S pools. In total, 89 haplotypes were identified, with 48 biallelic and 41 triallelic types (Supplementary Table S1). Biallelic haplotypes were the most frequent within the coding region, with a genome-wide frequency (GWF) of 145,151. In contrast, triallelic types were rare, with a GWF of 170 (Supplementary Table S1). Also, 34% of variants at triallelic sites were non-synonymous and 66% were synonymous. Chromosome C3 contained the highest number of biallelic haplotypes, with chromosome-wide haplotype frequency (CWF) of 23,906. Chromosome C6 had the lowest number, with a CWF of 11,956. Chromosome C7 had the highest number of triallelic haplotypes, with a CWF of 32, while C6 had the lowest number, with a CWF of 7 (Supplementary Table S1).
Analysis of variants and mapping of Rcr7 through analysis of PPV
Based on alignment with the reference genome, about 156 K variants were detected in either R or S pools, with 154 K SNPs and 2.6 K InDels in each pool (Supplementary Table S2). Also, 36% of variants per pool were nonsynonymous and 64% were synonymous (Supplementary Table S2). Overall, 36.5% of the SNPs and 51.4% of the InDels were polymorphic (Supplementary Fig. S1).
Chromosome C7 carried the highest PPV (42%) compared to the other eight chromosomes (30–34%) (Fig. 1a). This indicated that Rcr7 was likely located on C7, based on PPV. In addition, a PPV peak (56–73%) was found within the physical interval 41–44 Mb (Fig. 1b), which indicated that Rcr7 likely resided in this region of chromosome C7.
Figure 1.
Distribution of percentage of DNA variants. (a) The percentage (%) of monomorphic and polymorphic variants on each chromosome. (b) The percentage of polymorphic variants on chromosome C7.
Confirmation of Rcr7 location and fine mapping
There were 1668 SNP sites identified between physical positions 41–44 Mb of chromosome C7 where Rcr7 was mapped using PPV (Supplementary Table S3). To fine map the gene, 465 F1 plants including 90R and 90S plants for RNA-Seq in the F1 population were analyzed with eight SNP markers at the physical position 41–44 Mb of chromosome C7 using Kompetitive Allele-Specific PCR (KASP) (Table 1, Supplementary Table S3). Rcr7 was flanked by SNP_C7_44 and SNP_C7_56 at 0.4 and 1.1 centi-Morgan (cM) respectively, in an interval of 1.5 cM. Three SNP markers (SNP_C7_34, SNP_C7_43 and SNP_C7_68) co-segregated with Rcr7 (Fig. 2), confirming that Rcr7 is located at the physical position 41–44 Mb of chromosome C7.
Table 1.
List of KASP primers, together with their physical locations and flanking sequences.
Marker ID | Physical location | Flanking sequence |
---|---|---|
SNP_C7_20 | 42111835 | CCATGGAGGAGCTTGTGAGAATGGCTCAAACAGGTGATCCCTTGTGGGTTTCAAGCGATA[G/A]TGCGGTTGAGATTCTCAATGAGGAAGAGTATTTTCGAACGTTCCCTAGGGGAATAGGACC |
SNP_C7_34 | 42889307 | CCGGGAGTCTACGAGATAGGACTAAACTACCTTGATTTCATGGGCAAGAATAGTGGGCCT[C/T]TTTTGGACAATAAGGTTAATGTTACGAAGTGCAACATATTGGATCTCAGGTTCTGCAGAA |
SNP_C7_42 | 42707812 | CGTTCGAAGCATCATATCAAGTCCGAGGGAACCAACTTTCGGCATGTAGTTTCTCATTAT[G/A]TCGTATCTCCCCTGCACATATCACATTATATTAAGATCTCACTGCAAGATCCCACAAAAA |
SNP_C7_43 | 42887446 | TTGTTGAACTGAATCATGAAGCCATCAAGAACCGACTGCGAGTTGTTCTCGAGGAGCATA[C/T]TGTAGAACACTTGACCATCTTGTCGGGTTAATTGAGCGCTAATCTGCAGACCTTGACCGC |
SNP_C7_44 | 42863773 | CATGATCTTCGCACTTGTCTACTGTACTGCCGGAATCTCGGGAGGACACATTAACCCGGC[G/A]GTGACATTCGGTTTGTTCTTGGCGAGGAAGCTTTCTTTGACAAGAACTGTCTTCTACATA |
SNP_C7_45 | 42581612 | GATGGAACTCACAATCTCTCAGCCTGATGATTGGCATCTTCATCTCCGTGACGGCGATCT[T/C]CTTCAGGCTGTTGTTCCCCACAGGTTTATATAACTAGGACCTACAATTTACATGCATATC |
SNP_C7_56 | 43094738 | GCTTTGTTACTTGAGGCGCAAGTTAAGGATTGTTAAGGACCATAAGCTGCAGAAGAAAGG[C/A]GGTATGTCTCCGGAGAAGTTTGATTCGAGGATGGAAGAGGCTAACAACAGGCTGTCTTTC |
SNP_C7_68 | 42888001 | CAAGGTTGAAATATTTGCGAGCAGCTCATCCAGGAGTGACGGCTCAAGTTGATTTGAGTC[G/A]TCAGTAATCACAGGCTTTTCAGCTAAAACAACATCCTTCGCCGCCTAGTCAAAAGAAGAG |
Figure 2.
Mapping of Rcr7 in the F1 population derived from the cross ‘Tekila’ × T010000DH3 with SNP markers using the KASP method. R for resistant, S for susceptible on the right, SNP markers on the top. PCR products amplified from R alleles are denoted in black and those from S alleles in hatched. The recombinants were identified from the F1 population consisting of 465 plants tested with pathotype 3 of P. brassicae.
Identification of variants in the target region
SNP_C7_44 was located in gene Bo7g108740 encoding an Aquaporin protein at site 42,863,773 and SNP_C7_56 in gene Bo7g109090 encoding a Receptor-like protein kinase 1-like protein at site 43,094,738 causing synonymous mutations (Fig. 3). The physical distance between these two markers was 230,966 bases. There were 36 genes, including 6 genes that encoded disease resistance proteins and 1 gene that encoded disease resistance-responsive protein in this region, based on Blast2Go search (Supplementary Table S4). Blast search at http://www.arabidopsis.org/wublast/index2.jsp indicated that all seven disease resistance genes encoded TNL proteins. The number of polymorphic variants (SNP and InDel) uniquely identified from the R bulk was further assessed in the seven genes. Five TNL genes (Bo7g108830, Bo7g108840, Bo7g108850, Bo7g108870 and Bo7g109070) in the region did not show any expression and no short reads were assembled into the reference genome, so no polymorphic variants could be identified in the genes (Table 2). Short reads were identified in two TNL genes, Bo7g108760 and Bo7g109000, in both the R and S bulks (Table 2). The coding region in Bo7g108760 is 2724 bp in length (Table 2). One polymorphic InDel was identified (Table 2, Fig. 3). The coding region in Bo7g109000 is 564 bp in length and no polymorphic SNPs or InDels between the R and S bulks were identified (Table 2).
Figure 3.
Rcr7 location on chromosome C7. (a) Genetic location of Rcr7. (b) Physical locations of the SNP markers and TIR-NBS-LRR disease resistance genes in the Rcr7 target region. The length of the boxes reflects the sizes of the genes. (c) Comparison of polymorphic variants at the Bo7g108760 loci between the reference genome, R pool and S pool.
Table 2.
List of genes encoding disease resistance related proteins in the Rcr7 C-genome target region and homologous regions in A-genome of Brassica rapa.
B. oleracea | Gene length (bp) | No. of SNP | No. of Indel | RPKM in R bulks | RPKM in S bulks | B. rapa homologb |
---|---|---|---|---|---|---|
Bo7g108760 | 2724 | 4 | 1 | 2.420 | 2.433 | Bra019305; A03; 25101681 to 25104380 |
Bo7g108830 | 1032 | 0 | 0 | 0.003 | 0.003 | Bra013698; A01; 7228683 to 7231760 |
Bo7g108840 | 414 | 0 | 0 | 0.003 | 0.003 | Bra001161; A03; 15045523 to 15048954 |
Bo7g108850 | 789 | 0 | 0 | 0.003 | 0.003 | Bra027889; A09; 10044020 to 10045004 |
Bo7g108870 | 900 | 0 | 0 | 0.079 | 0.178 | Bra019297; A03; 25153454 to 25154701 |
Bo7g109000 | 564 | 0 | 0 | 5.811 | 3.577 | Bra019277; A03; 25319404 to 25319967 |
Bo7g109070 | 3009 | 0 | 0 | 0.237 | 0.160 | Bra019273; A03; 25345715 to 25352019 |
aEach of these genes were in the TIR-NBS-LRR class, based in gene sequence blasts at http://www.arabidopsis.org/wublast/index2.jsp.
bGene sequence was blasted at http://brassicadb.org/brad/blastPage.php.
The homologous regions of the A-genome of B. rapa corresponding to the seven TNL genes were searched. Two expressed TNL genes, Bo7g108760 and Bo7g109000, as well as two unexpressed TNL genes, Bo7g108870 and Bo7g109070, were homologous to the B. rapa genes Bra019305, Bra019277, Bra019297 and Bra019273 respectively. All four B. rapa genes reside in the 25 Mb region of chromosome A03. The unexpressed gene, Bo7g108840, was homologous to the B. rapa gene Bra001161 in the 15 Mb region of A03; Bo7g108830 and Bo7g108850 were homologous to the B. rapa genes Bra013698 and Bra027889, which are located at 7 Mb of A01 and 10 Mb of A09 respectively (Table 2).
Genetic mapping of clubroot resistance to pathotype 3 of P. brassicae in ‘Kilaherb’
The two flanking markers and three co-segregating markers (Table 1) were assessed on additional 25 accessions of B. oleracea, including ‘Kilaherb’ (Table 3). Eleven accessions were resistant to pathotype 3 of P. brassicae, with 0 DSI, but only ‘Kilaherb’ carried the SNP alleles associated with Rcr7.
Table 3.
Clubroot severity (disease severity index, DSI) and SNP marker profiles on accessions of Brassica oleracea.
Accession ID | Name | DSI | SNP_C7_ marker | ||||
---|---|---|---|---|---|---|---|
43 | 34 | 68 | 44 | 56 | |||
CN 35413 | White Flowered | 78 | — | — | — | — | — |
Kailaan-Big Boy | Kailaan-Big Boy | 44 | — | — | — | — | — |
CN87022 | Polycaul | 50 | — | — | — | — | — |
CGN14040 | Kailan | 71 | — | — | — | — | — |
CGN14041 | Kailan | 86 | — | — | — | — | — |
Chinese kale | Kialaan–Ii | 0 | — | — | — | — | — |
Chinese kale | Kialaan–I | 0 | — | — | — | — | — |
CK 1312 | Nobel Jade | 38 | — | — | — | — | — |
CHK1058 | Green Jade | 73 | — | — | — | — | — |
MU538B | UI Lan Midwater | 0 | — | — | — | — | — |
MU550B | Green Pearl | 0 | — | — | — | — | — |
422 C | Guy Lon | 100 | — | — | — | — | — |
1004 | 1004 | 0 | — | — | — | — | — |
1005 | 1005 | 30 | — | — | — | — | — |
1006 | 1006 | 0 | — | — | — | — | — |
JL04 | JL04 | 0 | — | — | — | — | — |
JL03 | JL03 | 0 | — | — | — | — | — |
JL02 | JL02 | 24 | — | — | — | — | — |
Jl01 | Jl01 | 50 | — | — | — | — | — |
H03 | H03 | 0 | — | — | — | — | — |
H02 | H02 | 0 | — | — | — | — | — |
H01 | H01 | 33 | — | — | — | — | — |
B04 | B04 | 0 | — | — | — | — | — |
B03 | B03 | 11 | — | — | — | — | — |
DH3 | T010000DH3 | 100 | — | — | — | — | — |
Kilaherb | Kilaherb | 0 | + | + | + | + | + |
Tekila | Tekila | 0 | + | + | + | + | + |
“+” The presence of SNP allele associated with Rcr7; “−” absence of SNP allele associated with Rcr7.
To determine if the clubroot resistance in ‘Kilaherb’ was associated with Rcr7, a segregating population consisting of 50 F1 plants from the cross ‘Kilaherb’ × T010000DH3 was assessed with the eight SNP markers identified previously. The population segregated in a 1:1 ratio (25R and 25S) to pathotype 3 of P. brassicae, indicating that ‘Kilaherb’ carried a single dominant clubroot resistance gene. All eight SNP markers associated with Rcr7 in ‘Tekila’ were also associated with resistance in ‘Kilaherb’ (Fig. 4). Three SNP markers (SNP_C7_34, SNP_C7_43 and SNP_C7_68) that co-segregated with Rcr7 also co-segregated with resistance in ‘Kilaherb’, confirming that ‘Kilaherb’ carries Rcr7.
Figure 4.
Genetic mapping of clubroot resistance in ‘Kilaherb’ × T010000DH3 F1 population for resistance to pathotypes 3 and 5X.
Genetic mapping of resistance to pathotype 5X of P. brassicae in ‘Tekila’ and ‘Kilaherb’
‘Tekila’ and ‘Kilaherb’ were resistant to pathotype 5X of P. brassicae. To test if the resistance to 5X was associated with Rcr7, a subset of the ‘Tekila’ and ‘Kilaherb’ segregating populations comprising 88 F1 plants each were inoculated with pathotype 5X. There were 50 R and 38S plants in the ‘Tekila’ population and 43R and 55S plants in the ‘Kilaherb’ population. Segregation for R and S in both populations was consistent with an expected ratio of 1:1 (χ2 = 1.64 and P = 0.20 in the ‘Tekila’ population and χ2 = 1.47 and P = 0.23 in the ‘Kilaherb’ population). When both populations were test with the eight SNP markers linked to Rcr7, all of the markers co-segregated with resistance to pathotype 5x in ‘Tekila’ and the genetic map for resistance to pathotype 5X for ‘Kilaherb’ was exactly the same as that for resistance to pathotype 3 (Fig. 4).
Discussion
Until recently, genetic mapping to identify genetic loci governing traits of interest was time-consuming and laborious. Development of high throughput sequencing (HTS) technology has made sequencing of whole genomes comparatively quick and affordable. One application of HTS is mapping by sequencing (MBS). MBS has been used to map causal genes in the genomes of organisms such as Arabidopsis thaliana3,39,40, Caenorhabditis elegans41, wheat35 and maize36. A previous study identified a high proportion of PPV on chromosome A03 of B. rapa adjacent to the clubroot resistance gene Rcr128. The current study used NGS and identification of PPV to map a major clubroot resistance gene from B. oleracea, which was designated as Rcr7. A higher PPV was identified within the physical interval 41–44 Mb of chromosome C7 in B. oleracea, which indicated that Rcr7 was likely located in this region. This was confirmed via conventional mapping using linkage analysis. Taken together, these results supported the proposal that identification of PPV could be used for genetic mapping of genes of interest. However, its application and efficacy comparing with other MBS methods still needs to be determined.
Although some QTLs for clubroot resistance in B. oleracea have previously been identified and mapped42, Rcr7 is the first major clubroot resistance gene finely mapped in the B. oleracea genome. Strong resistance to the main pathotypes in Canada (pathotypes 2, 3, 5, 6 and 8) had previously been identified in the A-genome resistance genes Rcr1, Rcr2 and Rc4, but these genes did not confer resistance to pathotype 5X11,23,43. On the other hand, the A-genome resistance genes Rcr8 and Rcr9 conferred resistance to pathotype 5X, but did not confer resistance to pathotypes 2, 3, 5, 6 and 811. In the current study, resistance to pathotypes 3 and 5X was associated with the Rcr7 region. It is likely that resistance to the pathotypes in ‘Tekila’ is controlled by the single dominant gene Rcr7 or tightly linked genes on chromosome C7. Although Rcr7 donors ‘Takila’ and ‘Kilaherb’ also showed complete resistance to 2, 5, 6 and 8, the mapping populations were not tested against these pathotypes due to the availability of the pathotypes and the limited number of seeds in the mapping populations when we performed the study. Our previous studies on Rcr1, Rcr2 and Rc4 indicated that resistance to pathotypes 2, 3, 5. 6 and 8 was associated11,23,28. Further studies are needed to determine if resistance to these pathotypes is associated with Rcr7.
When a set of B. oleracea lines were tested for resistance to pathotype 3 and assessed using the flanking and co-segregating markers associated with Rcr7, ‘Kilaherb’ had the same phenotype and marker profile at all of the marker loci as ‘Tekila’. Segregation analysis of the ‘Kilaherb’ × T010000DH3 F1 population indicated that resistance was controlled by a major dominant resistance gene, similarly to ‘Tekila’. Marker profiling for a set of F1 segregating lines also supported the hypothesis that ‘Kilaherb’ carried Rcr7. Both ‘Tekila’ and ‘Kilaherb’ were developed by Syngenta, so it is possible that the same source of resistance was used in both hybrids.
A patent (http://www.google.com/patents/EP1525317A1?cl=en) on “Clubroot Resistant Brassica oleracea Plants” shows that Syngenta developed a monogenic dominant resistance to the disease clubroot introgressed from B. rapa. Therefore, it is possible that Rcr7 was originated from A-genome of B. rapa. Research in Canada has focused on identification of clubroot resistance genes in B. rapa11,22,23,28,44 and the A-genome of B. napus45–47. Most of the clubroot resistance genes effective against pathotype 3 were mapped into the 24 Mb region of chromosome A03 that contains the cloned clubroot resistance genes CRa/CRbkato, where a cluster of four TNL genes, Bra019413, Bra019412, Bra019410 and Bra019409 are located. However, the genes/alleles do not confer resistance to pathotype 5X11,23,28, while resistance to both pathotypes 3 and 5X was associated with Rcr7. A search of the homologous regions of A-genome corresponding to the seven TNL genes in the Rcr7 target region of chromosome C7 revealed that the homologous genes in chromosome A03 were not in the previous mapped A03 genes (Rcr1/Rcr2/Rcr4/CRa/CRb) region. In addition, gene specific SNP markers associated with Rcr1/Rcr2/Rcr411,23,28 in the F1 population of ‘Tekila’ × T010000DH3 were either monomorphic or not tightly linked to Rcr7 (data not shown). Therefore, Rcr7 is a clubroot resistance gene mapped in the B. oleracea genome, possibly originating from a gene in chromosome A03 of B. rapa, but different from Rcr1/Rcr2/Rcr4 based on the genetic location and resistance specificity. However, the Rcr7 origin and clubroot genes corresponding to Rcr7 in B. rapa require further investigations.
Only 2 of the 7 TNL genes associated with Rcr7 (Bo7g108760 and Bo7g109000) were expressed in this study. No polymorphic variants were identified in Bo7g109000, but one polymorphic InDel was found in Bo7g108760. Therefore, Bo7g108760 is possibly a candidate of Rcr7. However, the profiles of gene expression and DNA variants were not fully captured in this study due to low depth of sequencing, so other candidates may exist. The identity of the TNL gene corresponding to Rcr7 will be addressed after the gene has been cloned.
The transition forms (C → T, G → A) dominated single-base substitutions with the ratio of 1.5 (transition): 1 (tranversion). This ratio was similar to the 2:1 ratio reported from the human genome48,49. Despite the bialleleic nature of most SNPs in the current analysis, some loci with three segregating nucleotides may also exist in certain populations50. Triallelic SNPs were previously reported in the human genome at a very low frequency compared to biallelic variants. Human transcriptome analysis showed that triallelic sites would likely cause non-synonymous48 changes. In the current study, 34% of the triallelic SNPs resulted in non-synonymous variation in the B. oleracea reference genome.
Materials and Methods
Schematic flowchart of the experimental procedure is shown in Supplementary Fig. S2.
Plant mapping population
The study assessed F1 populations derived from crosses of two clubroot- resistant hybrid cabbage cultivars, ‘Tekila’ and ‘Kilaherb’ (Syngenta Canada), with a clubroot- susceptible doubled haploid (DH) line T010000DH3 derived from Chinese kale (B. oleracea) cultivar ‘TO1434’ (Saskatoon Research and Development Centre, Saskatoon, SK, Canada). ‘Tekila’ and ‘Kilaherb’ were completely resistant to pathotypes 2, 3, 5, 6 and 8 of P. brassicae in an initial screening37 and strains of pathotype 5X (F. Yu unpublished data). ‘Tekila’ and ‘Kilaherb’ were vernalized and crossed with T010000DH3. Also, 24 accessions of B. oleracea were assessed in this study (Table 3).
Evaluation of plants for resistance to clubroot
A field population of P. brassicae identified as pathotype 322 and a field population L-G02 of pathotype 5X10 were used for inoculation in this study. Clubroot reaction was assessed in controlled environment studies, as described by Chu, et al.22. Briefly, the plants were assessed for clubroot symptoms at 5 weeks after seeding using a 0 to 3 scale, where 0 = no symptoms and 3 = large galls51. A clubroot rating of 0 was defined as R, 1–3 as S. A disease severity index (DSI)51,52 was computed based on 7-14 plants of each of the B. oleracea accessions.
RNA sequencing, read mapping, variant analysis and gene annotation
At 12 days after seeding, leaf tissue was collected from each F1 plant for RNA extraction. The leaf tissue of each individual plant was stored at −80 °C until after its clubroot reaction had been assessed. Then the F1 plants were separated into resistant and susceptible pools. From each pool, three bulks were randomly generated, with each bulk containing 30 plants. RNA was extracted from each bulk using Qiagen RNA extraction kits as per manufacturer’s instruction (Qiagen, Toronto, ON). A cDNA library for each bulk was constructed following Illumina TruSeq® RNA Sample Preparation v2 Guide (RS-122-9001DOC, Illumina Inc.; San Diego, CA). Sequencing samples were prepared using MiSeq® Reagent Kit V3, as per the manufacturer’s instruction (MS-102-3001, Illumina Inc.). Sequencing was performed at the University of Saskatchewan, Saskatoon, SK using an Illuimna MiSeq® System (Illumina Inc.) with 75 cycles, which resulted in 75 bp pair-end reads. The short sequence reads of the pooled resistance bulks and pooled susceptible bulks were mapped to the nine chromosomes (C1 to C9) of B. oleracea reference genome v2.138 following the pooled sample assembly method described by28 using SeqMan NextGen in DNASTAR.12 software (Lasergene Inc., Madison, WI). For variant analysis, pooled sample assembly (PSA) was selected because it tends to produce a more complete sequence coverage compared to single-sample assembly28.
Variants (SNPs and InDels) analysis was performed using SeqMan Pro 12 in DNASTAR.12 software, utilizing the following parameters: SNP% ≥15%, P not ref ≥50%, Q-call ≥15 and depth ≥5.
Gene annotation was analyzed with Blast2GO53. Further confirmation of the genes with TNL domains was performed with Arabidopsis thaliana WU-BLAST2 Search at http://www.arabidopsis.org/wublast/index2.jsp.
KASP assay and linkage analysis
The sequences flanking the selected SNP sites were used for designing KASP primers (Table 1). DNA oligoes were synthesized at Integrated DNA Technologies Inc. (Coralville, IA, USA). The primers carry standard FAM or HEX tails (FAM tail: 5′GAAGGTGACCAAGTTCATGCT3′; hex TAIL 5′GAAGGTCGGAGTCAACGGATT3′) with the targeted SNP at the 3′ end. KASP assays were performed following the principle and procedure available at http://www.kbioscience.co.uk/reagents/KASP_manual.pdf and http://www.kbioscience.co.uk/download/KASP.swf. The assays were performed using a StepOne Plus real time qPCR system (Applied Biosystem, Mississauga, ON). Linkage analysis was performed using JoinMap V.454.
Electronic supplementary material
Acknowledgements
We thank Dr. I. Parkin for providing the susceptible parental line T010000DH3, L. McGregor, M. Kehler, and Drs. T. Song, and M. Karim for technical assistance. Special thanks go to Dr. Markus Hecker for providing MiSeq facility for sequencing. This work was supported by Canola Agri-Science Cluster of Growing Forward II.
Author Contributions
F.Y., G.P. and K.C.F. conceived of the study. A.D. designed and conducted the study. A.D. and F.Y. analyzed data; X.Z. developed the mapping populations; B.D.G. and S.E.S. provided materials and helped with phenotyping; A.D. and F.Y. drafted the manuscript. All authors reviewed the manuscript and approved the final draft.
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Supplementary information accompanies this paper at 10.1038/s41598-018-36187-5.
References
- 1.Karling, J. S. The Plasmodiophorales 2nd ed. Hafner Publishing Company, Inc., New York (1968).
- 2.Dixon GR. The occurrence and economic impact of Plasmodiophora brassicae and clubroot disease. J. Plant Growth Regul. 2009;28:194–202. doi: 10.1007/s00344-009-9090-y. [DOI] [Google Scholar]
- 3.Tewari JP, et al. Identification of clubroot of crucifers on canola (Brassica napus) in Alberta. Plant Dis. 2005;67:758–762. [Google Scholar]
- 4.Gossen BD, et al. Spread of clubroot on canola in Canada, 2003–2014. Old pathogen, new home. Can. J. Plant Pathol. 2015;37:403–413. doi: 10.1080/07060661.2015.1105871. [DOI] [Google Scholar]
- 5.Donald EC, Porter I. Integrated control of clubroot. J. Plant Growth Regul. 2009;28:289–303. doi: 10.1007/s00344-009-9094-7. [DOI] [Google Scholar]
- 6.Voorrips RE. Plasmodiophora brassicae: Aspects of pathogenesis and resistance in Brassica oleracea. Euphytica. 1995;83:139–146. doi: 10.1007/BF01678041. [DOI] [Google Scholar]
- 7.Diederichsen E, Frauen M, Linders E, Hatakeyama K, Hirai M. Status and perspectives of clubroot resistance breeding in crucifer crops. J. Plant Growth Regul. 2009;28:265–281. doi: 10.1007/s00344-009-9100-0. [DOI] [Google Scholar]
- 8.Xue C, Cao T, Howard RJ, Hwang SF, Strelkov SE. Isolation and variation in virulence of single-spore isolates of Plasmodiophora brassicae from Canada. Plant Dis. 2008;92:456–462. doi: 10.1094/PDIS-92-3-0456. [DOI] [PubMed] [Google Scholar]
- 9.Strelkov SE, et al. Incidence of clubroot in Alberta in 2007. Can. Plant Dis. Surv. 2008;88:101–102. [Google Scholar]
- 10.Strelkov SE, Hwang SF, Manolii VP, Cao T, Feindel D. Emergence of new virulence phenotypes of Plasmodiophora brassicae on canola (Brassica napus) in Alberta, Canada. Eur. J. Plant Pathol. 2016;145:517–529. doi: 10.1007/s10658-016-0888-8. [DOI] [Google Scholar]
- 11.Yu, F. et al. Genotyping-by-sequencing reveals three QTL for clubroot resistance to six pathotypes of Plasmodiophora brassicae In Brassica rapa. Scientific Reports (in press) (2017). [DOI] [PMC free article] [PubMed]
- 12.Buczacki ST, et al. Study of physiologic specialization in Plasmodiophora brassicae: Proposals for attempted rationalization through an international approach. Trans. Br. Mycol. Soc. 1975;65:295–303. doi: 10.1016/S0007-1536(75)80013-1. [DOI] [Google Scholar]
- 13.Gustafsson M, Falt AS. Genetic studies on resistance to clubroot in Brassica napus. Ann. Appl. Biol. 1986;108:409–415. doi: 10.1111/j.1744-7348.1986.tb07663.x. [DOI] [Google Scholar]
- 14.Diederichsen E, Beckmann J, Schondelmeier J, Dreyer F. Genetics of clubroot resistance in Brassica napus ‘Mendel’. Acta Hort. 2006;706:307–311. doi: 10.17660/ActaHortic.2006.706.35. [DOI] [Google Scholar]
- 15.Sakamoto K, Saito A, Hayashida N, Taguchi G, Matsumoto E. Mapping of isolate-specific QTLs for clubroot resistance in Chinese cabbage (Brassica rapa L. ssp. pekinensis) Theor. Appl. Genet. 2008;117:759–767. doi: 10.1007/s00122-008-0817-0. [DOI] [PubMed] [Google Scholar]
- 16.Suwabe K, et al. Identification of two loci for resistance to clubroot (Plasmodiophora brassicae Woronin) In Brassica rapa L. Theor. Appl. Genet. 2003;107:997–1002. doi: 10.1007/s00122-003-1309-x. [DOI] [PubMed] [Google Scholar]
- 17.Saito M, et al. Fine mapping of the clubroot resistance gene Crr3 in Brassica rapa. Theor. Appl. Genet. 2006;114:81–91. doi: 10.1007/s00122-006-0412-1. [DOI] [PubMed] [Google Scholar]
- 18.Hayashida N, et al. Construction of a practical SCAR marker linked to clubroot resistance in Chinese cabbage, with intensive analysis of HC352b genes. Engei. Gakkai. Zasshi. 2008;77:150–154. doi: 10.2503/jjshs1.77.150. [DOI] [Google Scholar]
- 19.Kato T, Hatakeyama K, Fukino N, Matsumoto S. Fine mapping of the clubroot resistance gene CRb and development of a useful selectable marker in Brassica rapa. Breed. Sci. 2013;63:116–24. doi: 10.1270/jsbbs.63.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Piao ZY, Deng YQ, Choi SR, Park YJ, Lim YP. SCAR and CAPS mapping of CRb, a gene conferring resistance to Plasmodiophora brassicae in Chinese cabbage (Brassica rapa ssp. pekinensis) Theor. Appl. Genet. 2004;108:1458–1465. doi: 10.1007/s00122-003-1577-5. [DOI] [PubMed] [Google Scholar]
- 21.Zhang T, et al. Fine genetic and physical mapping of the CRb gene conferring resistance to clubroot disease in Brassica rapa. Mol. Breed. 2014;34:1173–1183. doi: 10.1007/s11032-014-0108-1. [DOI] [Google Scholar]
- 22.Chu M, et al. Fine mapping of Rcr1 and analyses of its effect on transcriptome patterns during infection by Plasmodiophora brassicae. BMC Genomics. 2014;15:z1166. doi: 10.1186/1471-2164-15-1166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Huang, Z. et al. Fine Mapping of a Clubroot Resistance Gene in Chinese Cabbage Using SNP Markers Identified from Bulked Segregant RNA Sequencing. Front Plant Sci. 8, 10.3389/fpls.2017.01448 (2017). [DOI] [PMC free article] [PubMed]
- 24.Hatakeyama K, et al. Identification and characterization of Crr1a, a gene for resistance to clubroot disease (Plasmodiophora brassicae Woronin) In Brassica rapa L. PLoS ONE. 2013;8:1–10. doi: 10.1371/journal.pone.0054745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hatakeyama K, et al. The tandem repeated organization of NB-LRR genes in the clubroot-resistant CRb locus in Brassica rapa L. Mol. Genet. Genomics. 2017;292:397–405. doi: 10.1007/s00438-016-1281-1. [DOI] [PubMed] [Google Scholar]
- 26.Ueno H, et al. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa. Plant Mol. Biol. 2012;80:621–629. doi: 10.1007/s11103-012-9971-5. [DOI] [PubMed] [Google Scholar]
- 27.Piao Z, Ramchiary N, Lim YP. Genetics of clubroot resistance in Brassica species. J. Plant Growth Regul. 2009;28:252–264. doi: 10.1007/s00344-009-9093-8. [DOI] [Google Scholar]
- 28.Yu F, et al. Identification of genome-wide variants and discovery of variants associated with Brassica rapa clubroot resistance gene Rcr1 through bulked segregant RNA sequencing. PLoS ONE. 2016;11:e0153218. doi: 10.1371/journal.pone.0153218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Barbazuk WB, Emrich SJ, Chen HD, Li L, Schnable PS. SNP discovery via 454 transcriptome sequencing. Plant J. 2007;51:910–918. doi: 10.1111/j.1365-313X.2007.03193.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chepelev I, Wei G, Tang Q, Zhao K. Detection of single nucleotide variations in expressed exons of the human genome using RNA-Seq. Nucleic Acids Res. 2009;37:e106. doi: 10.1093/nar/gkp507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Michelmore RW, Paran I, Kesseli RV. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl Acad. Sci. USA. 1991;88:9828–9832. doi: 10.1073/pnas.88.21.9828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ramirez-Gonzalez, R. H. et al. RNA-Seq bulked segregant analysis enables the identification of high-resolution genetic markers for breeding in hexaploid wheat. Plant Biotechnol. J. 13, 613–624. [DOI] [PubMed]
- 33.Trick M, et al. Combining SNP discovery from next-generation sequencing data with bulked segregant analysis (BSA) to fine-map genes in polyploid wheat. BMC Plant Biol. 2012;12:14. doi: 10.1186/1471-2229-12-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Liu S, Yeh CT, Tang HM, Nettleton D, Schnable PS. Gene mapping via bulked segregant RNA-Seq (BSR-Seq) PLoS ONE. 2012;7:e36406. doi: 10.1371/journal.pone.0036406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Du, H. et al. Bulked Segregant RNA-seq Reveals Differential Expression and SNPs of Candidate Genes Associated with Waterlogging Tolerance in Maize. Frontiers in plant science8, 1022, 10.3389/fpls.2017.01022 (2017). [DOI] [PMC free article] [PubMed]
- 36.Austin RS, et al. Next-generation mapping of Arabidopsis genes. Plant J. 2011;67:715–725. doi: 10.1111/j.1365-313X.2011.04619.x. [DOI] [PubMed] [Google Scholar]
- 37.Peng, G. et al. Sources of resistance to Plasmodiophora brassicae (clubroot) pathotypes virulent on canola. Can. J. Plant Pathol.36, 89–99, 10.1080/07060661.2013.863805 (2014).
- 38.Parkin IA, et al. Transcriptome and methylome profiling reveals relics of genome dominance in the mesopolyploid Brassica oleracea. Gen. Biol. 2014;15:R77. doi: 10.1186/gb-2014-15-6-r77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Mokry M, et al. Identification of factors required for meristem function in Arabidopsis using a novel next generation sequencing fast forward genetics approach. BMC Genomics. 2011;12:256. doi: 10.1186/1471-2164-12-256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Schneeberger K, et al. SHOREmap: simultaneous mapping and mutation identification by deep sequencing. Nat. Methods. 2009;6:550–551. doi: 10.1038/nmeth0809-550. [DOI] [PubMed] [Google Scholar]
- 41.Zuryn S, Le Gras S, Jamet K, Jarriault S. A Strategy for Direct Mapping and Identification of Mutation by Whole-Genome Sequencing. Genetics. 2010;186:427–430. doi: 10.1534/genetics.110.119230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Crute IR, Gray AR, Crisp P, Buczacki ST. Variation in Plasmodiophora brassicae and resistance to clubroot disease in brassica and allied crops: A critical review. Plant Breed. 1980;350:91–104. [Google Scholar]
- 43.Yu J, et al. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana. BMC Genomics. 2014;15:3. doi: 10.1186/1471-2164-15-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Gao F, Hirani AH, Liu J. Fine mapping a clubroot resistance locus in Chinese cabbage. J. Amer. Soc. Hort. Sci. 2014;139:247–252. [Google Scholar]
- 45.Fredua-Agyeman R, Rahman MH. Mapping of the clubroot disease resistance in spring Brassica napus canola introgressed from European winter canola cv. ‘Mendel’. Euphytica. 2016;211:201–213. doi: 10.1007/s10681-016-1730-2. [DOI] [Google Scholar]
- 46.Hasan MJ, Rahman H. Genetics and molecular mapping of resistance to Plasmodiophora brassicae pathotypes 2, 3, 5, 6, and 8 in rutabaga (Brassica napus var. napobrassica) Genome. 2016;59:805–815. doi: 10.1139/gen-2016-0034. [DOI] [PubMed] [Google Scholar]
- 47.Zhang H, et al. Mapping of clubroot (Plasmodiophora brassicae) resistance in canola (Brassica napus) Plant Pathol. 2016;65:435–440. doi: 10.1111/ppa.12422. [DOI] [Google Scholar]
- 48.Cao M, et al. Analysis of human triallelic SNPs by next-generation sequencing. Ann. Hum. Genet. 2015;79:275–281. doi: 10.1111/ahg.12114. [DOI] [PubMed] [Google Scholar]
- 49.Wang DG, et al. Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science. 1998;280:1077–1082. doi: 10.1126/science.280.5366.1077. [DOI] [PubMed] [Google Scholar]
- 50.Hodgkinson A, Eyre-Walker A. Human triallelic sites: Evidence for a new mutational mechanism? Genetics. 2010;184:233–241. doi: 10.1534/genetics.109.110510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Strelkov SE, Tewari JP, Smith-Degenhardt E. Characterization of Plasmodiophora brassicae populations from Alberta. Canada. Can. J. Plant Pathol. 2006;28:467–474. doi: 10.1080/07060660609507321. [DOI] [Google Scholar]
- 52.Crête R, Laliberté J, Jasmin JJ. Lutte chimique contre la hernie, Plasmodiophora brassicae Wor., des cruciferes en sols mineral et organique. Can. J. Plant. Sci. 1963;43:349–354. doi: 10.4141/cjps63-065. [DOI] [Google Scholar]
- 53.Conesa, A. et al. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics. 21, 3674–3676 (2005). [DOI] [PubMed]
- 54.Van Ooijen JW, Voorrips RE. JoinMap 3.0: Software for the calculation of genetic linkage maps. Plant Research International, Wageningen, Netherlands. Stam (1993) The Plant Journal. 2001;3:739–744. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.