Analysis of genome-wide variants through bulked segregant RNA sequencing reveals a major gene for resistance to Plasmodiophora brassicae in Brassica oleracea

Abstract

Two cabbage (Brassica oleracea) cultivars ‘Tekila’ and ‘Kilaherb’ were identified as resistant to several pathotypes of Plasmodiophora brassicae. In this study, we identified a clubroot resistance gene (Rcr7) in ‘Tekila’ for resistance to pathotype 3 of P. brassicae from a segregating population derived from ‘Tekila’ crossed with the susceptible line T010000DH3. Genetic mapping was performed by identifying the percentage of polymorphic variants (PPV), a new method proposed in this study, through bulked segregant RNA sequencing. Chromosome C7 carried the highest PPV (42%) compared to the 30–34% in the remaining chromosomes. A peak with PPV (56–73%) was found within the physical interval 41–44 Mb, which indicated that Rcr7 might be located in this region. Kompetitive Allele-Specific PCR was used to confirm the association of Rcr7 with SNPs in the region. Rcr7 was flanked by two SNP markers and co-segregated with three SNP markers in the segregating population of 465 plants. Seven genes encoding TIR-NBS-LRR disease resistance proteins were identified in the target region, but only two genes, Bo7g108760 and Bo7g109000, were expressed. Resistance to pathotype 5X was also mapped to the same region as Rcr7. B. oleracea lines including ‘Kilaherb’ were tested with five SNP markers for Rcr7 and for resistance to pathotype 3; 11 of 25 lines were resistant, but ‘Kilaherb’ was the only line that carried the SNP alleles associated with Rcr7. The presence of Rcr7 in ‘Kilaherb’ for resistance to both pathotypes 3 and 5X was confirmed through linkage analysis.

Introduction

Clubroot, caused by the obligate pathogen Plasmodiophora brassicae Woronin, attacks several economically important members of the family Brassicaceae, including canola/oilseed rape (Brassica napus L.), broccoli and cabbage (B. oleracea L.)¹. The disease has been reported in more than 60 countries, with an estimated annual yield loss globally of 15%². The pathogen induces the development of characteristic clubbing symptoms on the roots of susceptible plants, which results in wilting, premature yellowing and reduced quality and yield. Clubroot was first reported on canola on the Canadian prairies in 2003³, and is spreading across the prairie region⁴. Crop rotation, increasing soil pH, and fungicide application⁵ have been recommended to manage clubroot on Brassica vegetables, but the efficacy of these methods is limited. Genetic resistance remains the most effective strategy for clubroot management^6,7. Several pathotypes of P. brassicae are present in Canada (pathotypes 2, 3, 5, 5X, 6 and 8), with pathotype 3 being the most prevalent and pathotype 5X being one of the new pathotypes that can overcome the resistance in the current cohort of clubroot resistant cultivars^8–11.

B. napus was originated from the interspecific hybridization of B. rapa and B. oleracea. The majority of genes for clubroot resistance that have been identified are from B. rapa subsp. rapifera¹². Resistance in B. rapa is conferred by major and minor resistance genes, and resistance from B. rapa has been utilized widely in breeding for resistance to clubroot in B. rapa and B. napus^7,13,14. Several clubroot resistance genes have been identified and mapped to chromosomes of B. rapa; CRc¹⁵ and Rcr8¹¹ on chromosome A02, Crr1¹⁶ and Rcr9¹¹ on chromosome A08, Crr2¹⁶ on A01, Crr4¹⁶ on A06, Crr3¹⁷, CRa¹⁸, CRk¹⁵, CRb^kato19, CRb^20,21, Rcr1²², Rcr2²³ and Rcr4¹¹ on chromosome A03. CRa, CRb^kato and Crr1 have been cloned from B. rapa^24–26. They encode toll-interleukin-1 receptor/nucleotide binding site/leucine-rich repeat (TIR-NBS-LRR or TNL) proteins. In contrast to B. rapa, no major clubroot resistance genes or lines with strong resistance have been identified in B. oleracea²⁷.

Molecular mapping of genes in plants is based primarily on polymorphisms in genomic DNA sequences. Transcriptome analysis of short sequences generated from RNA sequencing (RNA-Seq) platforms has been used extensively for gene expression profiling and detection variants in many plant systems^28–30.

RNA-Seq is being widely used to identify single nucleotide polymorphisms (SNPs) that can be used as molecular markers^31,32. Also, bulk segregant analysis (BSA) has been applied for detecting molecular markers linked to traits of interest, such as disease resistance³³. In BSA, bulks of plants with contrasting phenotype are generated. Recent studies have used bulked segregant RNA-Seq (BSR-Seq), a combination of BSA and RNA-Seq approaches^23,34–36 to map genes of interest. Recently, BSR-Seq of genome-wide DNA variants in a B. rapa population were used to map clubroot resistance gene Rcr1 onto chromosome A03. More than 70% of the variants between resistant (R) and susceptible (S) bulks were monomorphic in each chromosome except A03, where a significantly higher percentage of polymorphic variants (PPV) were present²⁸. We therefore hypothesized that a gene could be genetically mapped by identifying the PPV in a genome through BSR-Seq.

A previous study identified two cabbage (B. oleracea) cultivars, ‘Tekila’ and ‘Kilaherb’, with strong resistance to the major strains of P. brassicae in western Canada³⁷. The objectives of the current study were: (i) to identify resistance gene in the cabbage cultivars; (ii) to test if identification of PPV could be used for gene mapping; (iii) to characterize transcriptome-wide variation and map the resistance gene; (iv) to develop SNP markers tightly linked to the resistance gene; and (v) to examine DNA variation in the target region and identify the most probable candidates for the gene.

Results

Resistance to clubroot in cultivar ‘Tekila’ is controlled by one dominant gene

The resistant hybrid ‘Tekila’ was crossed with a susceptible doubled-haploid line T010000DH3 to develop an F₁ mapping population, which is equivalent to a BC₁ population, because the resistant parent was a hybrid. Five weeks after inoculation with pathotype 3 of P. brassicae, the plants were rated for clubroot symptoms. Of the 465 F₁ plant tested, 232 plants were resistant (R) and 233 were susceptible (S). The segregation ratio was 1R: 1S (χ² = 0.7, P = 0.40), which indicated that resistance to pathotype 3 in this cultivar was likely controlled by a single dominant gene, designated as Rcr7 (Resistance to club-root 7).

Sequence alignment and read mapping

Six bulks were generated; three from the R plants and three from the S plants. RNA from each individual bulk was sequenced, resulted in six RNA sequence files. The total sequence counts were over 44 million (M) for R bulks, and 41 M for the S bulks. Approximately 80% and 83% of the total counts were assembled to reference genome in R and S pools, respectively. The total length of coding sequences assigned to chromosomes in the reference genome was 62.6 Mb. The total accumulated length of coding sequences aligned to chromosomes was ~447 Mb for each of the R and S pools. This gives an estimated 7-fold depth of coverage of the gene coding portion of the reference genome³⁸.

Transcriptome haplotytping

A haplotype profile was established based on the alignment between the coding sequences of the reference genome and RNA-Seq from the R and S pools. In total, 89 haplotypes were identified, with 48 biallelic and 41 triallelic types (Supplementary Table S1). Biallelic haplotypes were the most frequent within the coding region, with a genome-wide frequency (GWF) of 145,151. In contrast, triallelic types were rare, with a GWF of 170 (Supplementary Table S1). Also, 34% of variants at triallelic sites were non-synonymous and 66% were synonymous. Chromosome C3 contained the highest number of biallelic haplotypes, with chromosome-wide haplotype frequency (CWF) of 23,906. Chromosome C6 had the lowest number, with a CWF of 11,956. Chromosome C7 had the highest number of triallelic haplotypes, with a CWF of 32, while C6 had the lowest number, with a CWF of 7 (Supplementary Table S1).

Analysis of variants and mapping of Rcr7 through analysis of PPV

Based on alignment with the reference genome, about 156 K variants were detected in either R or S pools, with 154 K SNPs and 2.6 K InDels in each pool (Supplementary Table S2). Also, 36% of variants per pool were nonsynonymous and 64% were synonymous (Supplementary Table S2). Overall, 36.5% of the SNPs and 51.4% of the InDels were polymorphic (Supplementary Fig. S1).

Chromosome C7 carried the highest PPV (42%) compared to the other eight chromosomes (30–34%) (Fig. 1a). This indicated that Rcr7 was likely located on C7, based on PPV. In addition, a PPV peak (56–73%) was found within the physical interval 41–44 Mb (Fig. 1b), which indicated that Rcr7 likely resided in this region of chromosome C7.

Figure 1.

Distribution of percentage of DNA variants. (a) The percentage (%) of monomorphic and polymorphic variants on each chromosome. (b) The percentage of polymorphic variants on chromosome C7.

Confirmation of Rcr7 location and fine mapping

There were 1668 SNP sites identified between physical positions 41–44 Mb of chromosome C7 where Rcr7 was mapped using PPV (Supplementary Table S3). To fine map the gene, 465 F₁ plants including 90R and 90S plants for RNA-Seq in the F₁ population were analyzed with eight SNP markers at the physical position 41–44 Mb of chromosome C7 using Kompetitive Allele-Specific PCR (KASP) (Table 1, Supplementary Table S3). Rcr7 was flanked by SNP_C7_44 and SNP_C7_56 at 0.4 and 1.1 centi-Morgan (cM) respectively, in an interval of 1.5 cM. Three SNP markers (SNP_C7_34, SNP_C7_43 and SNP_C7_68) co-segregated with Rcr7 (Fig. 2), confirming that Rcr7 is located at the physical position 41–44 Mb of chromosome C7.

Table 1.

List of KASP primers, together with their physical locations and flanking sequences.

Marker ID	Physical location	Flanking sequence
SNP_C7_20	42111835	CCATGGAGGAGCTTGTGAGAATGGCTCAAACAGGTGATCCCTTGTGGGTTTCAAGCGATA[G/A]TGCGGTTGAGATTCTCAATGAGGAAGAGTATTTTCGAACGTTCCCTAGGGGAATAGGACC
SNP_C7_34	42889307	CCGGGAGTCTACGAGATAGGACTAAACTACCTTGATTTCATGGGCAAGAATAGTGGGCCT[C/T]TTTTGGACAATAAGGTTAATGTTACGAAGTGCAACATATTGGATCTCAGGTTCTGCAGAA
SNP_C7_42	42707812	CGTTCGAAGCATCATATCAAGTCCGAGGGAACCAACTTTCGGCATGTAGTTTCTCATTAT[G/A]TCGTATCTCCCCTGCACATATCACATTATATTAAGATCTCACTGCAAGATCCCACAAAAA
SNP_C7_43	42887446	TTGTTGAACTGAATCATGAAGCCATCAAGAACCGACTGCGAGTTGTTCTCGAGGAGCATA[C/T]TGTAGAACACTTGACCATCTTGTCGGGTTAATTGAGCGCTAATCTGCAGACCTTGACCGC
SNP_C7_44	42863773	CATGATCTTCGCACTTGTCTACTGTACTGCCGGAATCTCGGGAGGACACATTAACCCGGC[G/A]GTGACATTCGGTTTGTTCTTGGCGAGGAAGCTTTCTTTGACAAGAACTGTCTTCTACATA
SNP_C7_45	42581612	GATGGAACTCACAATCTCTCAGCCTGATGATTGGCATCTTCATCTCCGTGACGGCGATCT[T/C]CTTCAGGCTGTTGTTCCCCACAGGTTTATATAACTAGGACCTACAATTTACATGCATATC
SNP_C7_56	43094738	GCTTTGTTACTTGAGGCGCAAGTTAAGGATTGTTAAGGACCATAAGCTGCAGAAGAAAGG[C/A]GGTATGTCTCCGGAGAAGTTTGATTCGAGGATGGAAGAGGCTAACAACAGGCTGTCTTTC
SNP_C7_68	42888001	CAAGGTTGAAATATTTGCGAGCAGCTCATCCAGGAGTGACGGCTCAAGTTGATTTGAGTC[G/A]TCAGTAATCACAGGCTTTTCAGCTAAAACAACATCCTTCGCCGCCTAGTCAAAAGAAGAG

Figure 2.

Mapping of Rcr7 in the F₁ population derived from the cross ‘Tekila’ × T010000DH3 with SNP markers using the KASP method. R for resistant, S for susceptible on the right, SNP markers on the top. PCR products amplified from R alleles are denoted in black and those from S alleles in hatched. The recombinants were identified from the F₁ population consisting of 465 plants tested with pathotype 3 of P. brassicae.

Identification of variants in the target region

SNP_C7_44 was located in gene Bo7g108740 encoding an Aquaporin protein at site 42,863,773 and SNP_C7_56 in gene Bo7g109090 encoding a Receptor-like protein kinase 1-like protein at site 43,094,738 causing synonymous mutations (Fig. 3). The physical distance between these two markers was 230,966 bases. There were 36 genes, including 6 genes that encoded disease resistance proteins and 1 gene that encoded disease resistance-responsive protein in this region, based on Blast2Go search (Supplementary Table S4). Blast search at http://www.arabidopsis.org/wublast/index2.jsp indicated that all seven disease resistance genes encoded TNL proteins. The number of polymorphic variants (SNP and InDel) uniquely identified from the R bulk was further assessed in the seven genes. Five TNL genes (Bo7g108830, Bo7g108840, Bo7g108850, Bo7g108870 and Bo7g109070) in the region did not show any expression and no short reads were assembled into the reference genome, so no polymorphic variants could be identified in the genes (Table 2). Short reads were identified in two TNL genes, Bo7g108760 and Bo7g109000, in both the R and S bulks (Table 2). The coding region in Bo7g108760 is 2724 bp in length (Table 2). One polymorphic InDel was identified (Table 2, Fig. 3). The coding region in Bo7g109000 is 564 bp in length and no polymorphic SNPs or InDels between the R and S bulks were identified (Table 2).

Figure 3.

Rcr7 location on chromosome C7. (a) Genetic location of Rcr7. (b) Physical locations of the SNP markers and TIR-NBS-LRR disease resistance genes in the Rcr7 target region. The length of the boxes reflects the sizes of the genes. (c) Comparison of polymorphic variants at the Bo7g108760 loci between the reference genome, R pool and S pool.

Table 2.

List of genes encoding disease resistance related proteins in the Rcr7 C-genome target region and homologous regions in A-genome of Brassica rapa.

B. oleracea	Gene length (bp)	No. of SNP	No. of Indel	RPKM in R bulks	RPKM in S bulks	B. rapa homologb
Bo7g108760	2724	4	1	2.420	2.433	Bra019305; A03; 25101681 to 25104380
Bo7g108830	1032	0	0	0.003	0.003	Bra013698; A01; 7228683 to 7231760
Bo7g108840	414	0	0	0.003	0.003	Bra001161; A03; 15045523 to 15048954
Bo7g108850	789	0	0	0.003	0.003	Bra027889; A09; 10044020 to 10045004
Bo7g108870	900	0	0	0.079	0.178	Bra019297; A03; 25153454 to 25154701
Bo7g109000	564	0	0	5.811	3.577	Bra019277; A03; 25319404 to 25319967
Bo7g109070	3009	0	0	0.237	0.160	Bra019273; A03; 25345715 to 25352019

^aEach of these genes were in the TIR-NBS-LRR class, based in gene sequence blasts at http://www.arabidopsis.org/wublast/index2.jsp.

^bGene sequence was blasted at http://brassicadb.org/brad/blastPage.php.

The homologous regions of the A-genome of B. rapa corresponding to the seven TNL genes were searched. Two expressed TNL genes, Bo7g108760 and Bo7g109000, as well as two unexpressed TNL genes, Bo7g108870 and Bo7g109070, were homologous to the B. rapa genes Bra019305, Bra019277, Bra019297 and Bra019273 respectively. All four B. rapa genes reside in the 25 Mb region of chromosome A03. The unexpressed gene, Bo7g108840, was homologous to the B. rapa gene Bra001161 in the 15 Mb region of A03; Bo7g108830 and Bo7g108850 were homologous to the B. rapa genes Bra013698 and Bra027889, which are located at 7 Mb of A01 and 10 Mb of A09 respectively (Table 2).

Genetic mapping of clubroot resistance to pathotype 3 of P. brassicae in ‘Kilaherb’

The two flanking markers and three co-segregating markers (Table 1) were assessed on additional 25 accessions of B. oleracea, including ‘Kilaherb’ (Table 3). Eleven accessions were resistant to pathotype 3 of P. brassicae, with 0 DSI, but only ‘Kilaherb’ carried the SNP alleles associated with Rcr7.

Table 3.

Clubroot severity (disease severity index, DSI) and SNP marker profiles on accessions of Brassica oleracea.

Accession ID	Name	DSI	SNP_C7_ marker
			43	34	68	44	56
CN 35413	White Flowered	78	—	—	—	—	—
Kailaan-Big Boy	Kailaan-Big Boy	44	—	—	—	—	—
CN87022	Polycaul	50	—	—	—	—	—
CGN14040	Kailan	71	—	—	—	—	—
CGN14041	Kailan	86	—	—	—	—	—
Chinese kale	Kialaan–Ii	0	—	—	—	—	—
Chinese kale	Kialaan–I	0	—	—	—	—	—
CK 1312	Nobel Jade	38	—	—	—	—	—
CHK1058	Green Jade	73	—	—	—	—	—
MU538B	UI Lan Midwater	0	—	—	—	—	—
MU550B	Green Pearl	0	—	—	—	—	—
422 C	Guy Lon	100	—	—	—	—	—
1004	1004	0	—	—	—	—	—
1005	1005	30	—	—	—	—	—
1006	1006	0	—	—	—	—	—
JL04	JL04	0	—	—	—	—	—
JL03	JL03	0	—	—	—	—	—
JL02	JL02	24	—	—	—	—	—
Jl01	Jl01	50	—	—	—	—	—
H03	H03	0	—	—	—	—	—
H02	H02	0	—	—	—	—	—
H01	H01	33	—	—	—	—	—
B04	B04	0	—	—	—	—	—
B03	B03	11	—	—	—	—	—
DH3	T010000DH3	100	—	—	—	—	—
Kilaherb	Kilaherb	0	+	+	+	+	+
Tekila	Tekila	0	+	+	+	+	+

“+” The presence of SNP allele associated with Rcr7; “−” absence of SNP allele associated with Rcr7.

To determine if the clubroot resistance in ‘Kilaherb’ was associated with Rcr7, a segregating population consisting of 50 F₁ plants from the cross ‘Kilaherb’ × T010000DH3 was assessed with the eight SNP markers identified previously. The population segregated in a 1:1 ratio (25R and 25S) to pathotype 3 of P. brassicae, indicating that ‘Kilaherb’ carried a single dominant clubroot resistance gene. All eight SNP markers associated with Rcr7 in ‘Tekila’ were also associated with resistance in ‘Kilaherb’ (Fig. 4). Three SNP markers (SNP_C7_34, SNP_C7_43 and SNP_C7_68) that co-segregated with Rcr7 also co-segregated with resistance in ‘Kilaherb’, confirming that ‘Kilaherb’ carries Rcr7.

Figure 4.

Genetic mapping of clubroot resistance in ‘Kilaherb’ × T010000DH3 F₁ population for resistance to pathotypes 3 and 5X.

Genetic mapping of resistance to pathotype 5X of P. brassicae in ‘Tekila’ and ‘Kilaherb’

‘Tekila’ and ‘Kilaherb’ were resistant to pathotype 5X of P. brassicae. To test if the resistance to 5X was associated with Rcr7, a subset of the ‘Tekila’ and ‘Kilaherb’ segregating populations comprising 88 F₁ plants each were inoculated with pathotype 5X. There were 50 R and 38S plants in the ‘Tekila’ population and 43R and 55S plants in the ‘Kilaherb’ population. Segregation for R and S in both populations was consistent with an expected ratio of 1:1 (χ² = 1.64 and P = 0.20 in the ‘Tekila’ population and χ² = 1.47 and P = 0.23 in the ‘Kilaherb’ population). When both populations were test with the eight SNP markers linked to Rcr7, all of the markers co-segregated with resistance to pathotype 5x in ‘Tekila’ and the genetic map for resistance to pathotype 5X for ‘Kilaherb’ was exactly the same as that for resistance to pathotype 3 (Fig. 4).

Discussion

Until recently, genetic mapping to identify genetic loci governing traits of interest was time-consuming and laborious. Development of high throughput sequencing (HTS) technology has made sequencing of whole genomes comparatively quick and affordable. One application of HTS is mapping by sequencing (MBS). MBS has been used to map causal genes in the genomes of organisms such as Arabidopsis thaliana^3,39,40, Caenorhabditis elegans⁴¹, wheat³⁵ and maize³⁶. A previous study identified a high proportion of PPV on chromosome A03 of B. rapa adjacent to the clubroot resistance gene Rcr1²⁸. The current study used NGS and identification of PPV to map a major clubroot resistance gene from B. oleracea, which was designated as Rcr7. A higher PPV was identified within the physical interval 41–44 Mb of chromosome C7 in B. oleracea, which indicated that Rcr7 was likely located in this region. This was confirmed via conventional mapping using linkage analysis. Taken together, these results supported the proposal that identification of PPV could be used for genetic mapping of genes of interest. However, its application and efficacy comparing with other MBS methods still needs to be determined.

Although some QTLs for clubroot resistance in B. oleracea have previously been identified and mapped⁴², Rcr7 is the first major clubroot resistance gene finely mapped in the B. oleracea genome. Strong resistance to the main pathotypes in Canada (pathotypes 2, 3, 5, 6 and 8) had previously been identified in the A-genome resistance genes Rcr1, Rcr2 and Rc4, but these genes did not confer resistance to pathotype 5X^11,23,43. On the other hand, the A-genome resistance genes Rcr8 and Rcr9 conferred resistance to pathotype 5X, but did not confer resistance to pathotypes 2, 3, 5, 6 and 8¹¹. In the current study, resistance to pathotypes 3 and 5X was associated with the Rcr7 region. It is likely that resistance to the pathotypes in ‘Tekila’ is controlled by the single dominant gene Rcr7 or tightly linked genes on chromosome C7. Although Rcr7 donors ‘Takila’ and ‘Kilaherb’ also showed complete resistance to 2, 5, 6 and 8, the mapping populations were not tested against these pathotypes due to the availability of the pathotypes and the limited number of seeds in the mapping populations when we performed the study. Our previous studies on Rcr1, Rcr2 and Rc4 indicated that resistance to pathotypes 2, 3, 5. 6 and 8 was associated^11,23,28. Further studies are needed to determine if resistance to these pathotypes is associated with Rcr7.

When a set of B. oleracea lines were tested for resistance to pathotype 3 and assessed using the flanking and co-segregating markers associated with Rcr7, ‘Kilaherb’ had the same phenotype and marker profile at all of the marker loci as ‘Tekila’. Segregation analysis of the ‘Kilaherb’ × T010000DH3 F₁ population indicated that resistance was controlled by a major dominant resistance gene, similarly to ‘Tekila’. Marker profiling for a set of F₁ segregating lines also supported the hypothesis that ‘Kilaherb’ carried Rcr7. Both ‘Tekila’ and ‘Kilaherb’ were developed by Syngenta, so it is possible that the same source of resistance was used in both hybrids.

A patent (http://www.google.com/patents/EP1525317A1?cl=en) on “Clubroot Resistant Brassica oleracea Plants” shows that Syngenta developed a monogenic dominant resistance to the disease clubroot introgressed from B. rapa. Therefore, it is possible that Rcr7 was originated from A-genome of B. rapa. Research in Canada has focused on identification of clubroot resistance genes in B. rapa^{11,22,23,28,44} and the A-genome of B. napus^45–47. Most of the clubroot resistance genes effective against pathotype 3 were mapped into the 24 Mb region of chromosome A03 that contains the cloned clubroot resistance genes CRa/CRb^kato, where a cluster of four TNL genes, Bra019413, Bra019412, Bra019410 and Bra019409 are located. However, the genes/alleles do not confer resistance to pathotype 5X^11,23,28, while resistance to both pathotypes 3 and 5X was associated with Rcr7. A search of the homologous regions of A-genome corresponding to the seven TNL genes in the Rcr7 target region of chromosome C7 revealed that the homologous genes in chromosome A03 were not in the previous mapped A03 genes (Rcr1/Rcr2/Rcr4/CRa/CRb) region. In addition, gene specific SNP markers associated with Rcr1/Rcr2/Rcr4^11,23,28 in the F₁ population of ‘Tekila’ × T010000DH3 were either monomorphic or not tightly linked to Rcr7 (data not shown). Therefore, Rcr7 is a clubroot resistance gene mapped in the B. oleracea genome, possibly originating from a gene in chromosome A03 of B. rapa, but different from Rcr1/Rcr2/Rcr4 based on the genetic location and resistance specificity. However, the Rcr7 origin and clubroot genes corresponding to Rcr7 in B. rapa require further investigations.

Only 2 of the 7 TNL genes associated with Rcr7 (Bo7g108760 and Bo7g109000) were expressed in this study. No polymorphic variants were identified in Bo7g109000, but one polymorphic InDel was found in Bo7g108760. Therefore, Bo7g108760 is possibly a candidate of Rcr7. However, the profiles of gene expression and DNA variants were not fully captured in this study due to low depth of sequencing, so other candidates may exist. The identity of the TNL gene corresponding to Rcr7 will be addressed after the gene has been cloned.

The transition forms (C → T, G → A) dominated single-base substitutions with the ratio of 1.5 (transition): 1 (tranversion). This ratio was similar to the 2:1 ratio reported from the human genome^48,49. Despite the bialleleic nature of most SNPs in the current analysis, some loci with three segregating nucleotides may also exist in certain populations⁵⁰. Triallelic SNPs were previously reported in the human genome at a very low frequency compared to biallelic variants. Human transcriptome analysis showed that triallelic sites would likely cause non-synonymous⁴⁸ changes. In the current study, 34% of the triallelic SNPs resulted in non-synonymous variation in the B. oleracea reference genome.

Materials and Methods

Schematic flowchart of the experimental procedure is shown in Supplementary Fig. S2.

Plant mapping population

The study assessed F₁ populations derived from crosses of two clubroot- resistant hybrid cabbage cultivars, ‘Tekila’ and ‘Kilaherb’ (Syngenta Canada), with a clubroot- susceptible doubled haploid (DH) line T010000DH3 derived from Chinese kale (B. oleracea) cultivar ‘TO1434’ (Saskatoon Research and Development Centre, Saskatoon, SK, Canada). ‘Tekila’ and ‘Kilaherb’ were completely resistant to pathotypes 2, 3, 5, 6 and 8 of P. brassicae in an initial screening³⁷ and strains of pathotype 5X (F. Yu unpublished data). ‘Tekila’ and ‘Kilaherb’ were vernalized and crossed with T010000DH3. Also, 24 accessions of B. oleracea were assessed in this study (Table 3).

Evaluation of plants for resistance to clubroot

A field population of P. brassicae identified as pathotype 3²² and a field population L-G02 of pathotype 5X¹⁰ were used for inoculation in this study. Clubroot reaction was assessed in controlled environment studies, as described by Chu, et al.²². Briefly, the plants were assessed for clubroot symptoms at 5 weeks after seeding using a 0 to 3 scale, where 0 = no symptoms and 3 = large galls⁵¹. A clubroot rating of 0 was defined as R, 1–3 as S. A disease severity index (DSI)^51,52 was computed based on 7-14 plants of each of the B. oleracea accessions.

RNA sequencing, read mapping, variant analysis and gene annotation

At 12 days after seeding, leaf tissue was collected from each F₁ plant for RNA extraction. The leaf tissue of each individual plant was stored at −80 °C until after its clubroot reaction had been assessed. Then the F₁ plants were separated into resistant and susceptible pools. From each pool, three bulks were randomly generated, with each bulk containing 30 plants. RNA was extracted from each bulk using Qiagen RNA extraction kits as per manufacturer’s instruction (Qiagen, Toronto, ON). A cDNA library for each bulk was constructed following Illumina TruSeq® RNA Sample Preparation v2 Guide (RS-122-9001DOC, Illumina Inc.; San Diego, CA). Sequencing samples were prepared using MiSeq® Reagent Kit V3, as per the manufacturer’s instruction (MS-102-3001, Illumina Inc.). Sequencing was performed at the University of Saskatchewan, Saskatoon, SK using an Illuimna MiSeq® System (Illumina Inc.) with 75 cycles, which resulted in 75 bp pair-end reads. The short sequence reads of the pooled resistance bulks and pooled susceptible bulks were mapped to the nine chromosomes (C1 to C9) of B. oleracea reference genome v2.1³⁸ following the pooled sample assembly method described by²⁸ using SeqMan NextGen in DNASTAR.12 software (Lasergene Inc., Madison, WI). For variant analysis, pooled sample assembly (PSA) was selected because it tends to produce a more complete sequence coverage compared to single-sample assembly²⁸.

Variants (SNPs and InDels) analysis was performed using SeqMan Pro 12 in DNASTAR.12 software, utilizing the following parameters: SNP% ≥15%, P not ref ≥50%, Q-call ≥15 and depth ≥5.

Gene annotation was analyzed with Blast2GO⁵³. Further confirmation of the genes with TNL domains was performed with Arabidopsis thaliana WU-BLAST2 Search at http://www.arabidopsis.org/wublast/index2.jsp.

KASP assay and linkage analysis

The sequences flanking the selected SNP sites were used for designing KASP primers (Table 1). DNA oligoes were synthesized at Integrated DNA Technologies Inc. (Coralville, IA, USA). The primers carry standard FAM or HEX tails (FAM tail: 5′GAAGGTGACCAAGTTCATGCT3′; hex TAIL 5′GAAGGTCGGAGTCAACGGATT3′) with the targeted SNP at the 3′ end. KASP assays were performed following the principle and procedure available at http://www.kbioscience.co.uk/reagents/KASP_manual.pdf and http://www.kbioscience.co.uk/download/KASP.swf. The assays were performed using a StepOne Plus real time qPCR system (Applied Biosystem, Mississauga, ON). Linkage analysis was performed using JoinMap V.4⁵⁴.

Author Contributions

F.Y., G.P. and K.C.F. conceived of the study. A.D. designed and conducted the study. A.D. and F.Y. analyzed data; X.Z. developed the mapping populations; B.D.G. and S.E.S. provided materials and helped with phenotyping; A.D. and F.Y. drafted the manuscript. All authors reviewed the manuscript and approved the final draft.

Competing Interests

The authors declare no competing interests.

Electronic supplementary material

Supplementary information accompanies this paper at 10.1038/s41598-018-36187-5.