Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2018 Sep 15;74(12):2667–2670. doi: 10.1002/ps.5141

An improved DNA method to unambiguously detect small hive beetle Aethina tumida, an invasive pest of honeybee colonies

Paolo Silacci 1, Claudine Biolley 1, Corinne Jud 1, Jean‐Daniel Charrière 1, Benjamin Dainat 1,✉
PMCID: PMC6282992  PMID: 29998601

Abstract

The scavenger and invasive species Aethina tumida threatening the honey bee has been recently introduced in Europe. We present a new, reliable and rapid multiplex real‐time PCR for efficient diagnostics enabling surveillance programs. © 2018 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Keywords: Aethina tumida, Apis mellifera, diagnostics, multiplex PCR

1.

Photo 1.

PS-5141-GRA-0001-c

Small hive beetle larvae on brood comb.

The small hive beetle (SHB) Aethina tumida Murray (Coleoptera: Nitidulidae) is a scavenger native to sub‐Saharan Africa and is a pest of honey bees without provoking significant damage within its endemic range.1, 2 Since the first report in 1996 out of its native range3 in North Carolina, USA, the beetle became an invasive species in Australia, and in central and North America. It was introduced in Europe in 2004 in Portugal where an eradication program was effective and then in Italy in 2014 where infestation is still ongoing4 probably originating from an African population.5 Its life cycle is intimately linked to the honey bee where it mates and reproduces inside the colony and where the larvae feed on beebread, honey and brood causing destruction.1, 6, 7 Besides honey bees, it can also affect bumble bees and stingless bees (see review in reference2). The economic damage to the beekeeping industry can therefore be substantial thereby explaining why the SHB is a statutory notifiable pest in the European Union (EU). After its introduction in Italy, the EU authorities (Commission Implementing Decision 2014/909/EU of 12 December 2014) established new protective measures to prevent SHB spread including the goal to eradicate it if possible. It is consequently of the utmost importance to have an easy, reliable and cheap technique for diagnostics. However, the eggs and larvae stage are extremely difficult to identify with conventional taxonomic techniques bearing a too high risk of incorrect results. A previous PCR assay is based on work published in 2007,8 where an amplification system targeting the cytochrome oxidase subunit I (COI) gene was proposed. However, the sequence of the reverse primer contains an important internal mismatch of three nucleotides with all currently published A. tumida COI sequences, rendering its application tedious and susceptible to false negative diagnostic. In this study, we propose a new SHB diagnostics using a multiplex PCR approach targeting COI gene and a common region of 18S ribosomal gene as internal control.

These results further confirm the validity of the proposed multiplex PCR system for rapid, reliable and specific diagnostics of the small hive beetle (SHB) that may be found in the hive and thus facilitate for example early detection programs.

The DNA extraction method was chosen according to a previous study comparing different extraction procedures of genomic DNA from ticks providing material allowing maximal recovery and good quality for a consistent amplification.9 Briefly, insects stored in ethanol 70% (v/v) were air‐dried prior to dissection into four quarters and then DNA was extracted using GeneJet Genomic Kit (Thermo Fisher, Waltham, MA, USA) following the manufacturer's instructions and eluted into a final volume of 100 μL. Then, 4 μL (0.8–10 ng) of insect genomic DNA were used for amplification. PCR was performed in a 20 μL reaction volume containing 1x KAPA PROBE Fast Universal Master Mix (Sigma, St Louis, MO, USA), 200 nmoL/L of COI and 18S primers, 400 nmoL/L of COI probe and 50 nmoL/L of 18S probe. The amplification profile included an activation step of 5 min at 95 °C followed by 60 cycles of a two‐step amplification (5 s at 95 °C; 20 s at 62 °C), using an Eco™ real time PCR device (PCRmax). Primers (Table 1) were designed with Primer‐Blast10 thereby checking specificity in nucleotide Databank to any known sequences and probes with Primer3 v. 0.4.0.11 Both primers and probes were synthetized by Microsynth (Microsynth, Balgach, Switzerland). Amplification results were analyzed with Eco Study v.5.0 (PCRmax). Size and sequence of the COI amplicon were further verified on a DNA extracted from a beetle individual isolated in Italy (data not shown).

Table 1.

Sequences of primers and probes targeting COI and 18S genes. Amplicon lengths were of 396 bp for COI and 80 bp for 18S

COI gene 18S gene
Forward primers 5′‐CGACCCTCAGGCATAACCTT‐3′ 5′‐AATCAGCGTGTCTTCCCTGG‐3′
Reverse primers 5′‐AGGCTCGAGTATCAACGTCTA‐3′ 5′‐CAATTGCAAGCCCCAATCCC‐3′
Probes 5′‐HEX‐GGAAGCCTTTGGAACTTTAGG‐BHQ‐3′ 5′‐FAM‐GTAACCCGCTGAACCTCCTT‐BHQ‐3′

After optimization of the concentration of the two probes, to further confirm the specificity of the primers the multiplex assay was tested on a total of 49 DNAs extracted from different insects which can be found in the vicinity of colony hives or are common in European fields. The DNA test set included 12 A. tumida individuals of different geographical origins and relatives from the Nitidulidae family. All the DNA extracted from A. tumida were positive for both the internal control 18S and COI gene amplification. Interestingly, threshold cycles (Cq) for the two systems never diverged for more than 6.4 cycles (Table 2). All the other 37 insect samples analyzed were positive for 18S, with Cq ≤ 42.1, and negative for COI (Table 2).

Table 2.

Results of multiplex Aethina tumida PCR system application to 49 different insect DNA

Individual Species with GBOLD accession number where relevant Origin Development stage Atum Cq 18S Cq
1 Aethina tumida Italy Adult 28.7 28.6
2 Aethina tumida Italy Larvae 30.9 26.4
3 Aethina tumida Italy Larvae 32.5 26.1
4 Aethina tumida Italy (Calabria) Adult 21 22.8
5 Aethina tumida Italy (Calabria) Adult 20.2 22.1
6 Aethina tumida United Kingdom (breeding from an US strain) Larvae 35.2 28.2
7 Aethina tumida United Kingdom (breeding from an US strain) Adult 30.3 26.2
8 Aethina tumida Mexico Adult 18.8 21.4
9 Aethina tumida South Africa Adult 27.9 34.1
10 Aethina tumida South Africa Adult 28 33.4
11 Aethina tumida South Africa Larvae 28 31.5
12 Aethina tumida South Africa Larvae 22.4 30
13 Harmonia axyridis Switzerland Adult ND 16.1
14 Harmonia axyridis Switzerland Adult ND 23.5
15 Muscidae Switzerland Adult ND 42.1
16 Forficula auricularia Switzerland Adult ND 38.5
17 Leptoglossus occidentalis Switzerland Adult ND 37.1
18 Galleria mellonella Switzerland Larvae ND 21.4
19 Galleria mellonella Switzerland Larvae ND 22.8
20 Lepidoptera Switzerland Larvae ND 32.7
21 Varroa destructor Switzerland Adult ND 31
22 Meligethes viridescens Switzerland Adult ND 35
23 Cychramus luteus (Nitidulidae)
ZFMK‐TIS‐2504554
Germany Adult ND 34.9
24 Cychramus luteus (Nitidulidae)
ZFMK‐TIS‐2503863
Germany Adult ND 33.3
25 Cychramus luteus (Nitidulidae)
ZFMK‐TIS‐2506747
Italy Adult ND 34.7
26 Epuraea aestiva (Nitidulidae)
ZFMK‐TIS‐13931
Germany Adult ND 24.3
27 Epuraea aestiva (Nitidulidae)
ZFMK‐TIS‐2504534
Germany Adult ND 29.4
28 Epuraea aestiva (Nitidulidae)
ZFMK‐TIS‐2504535
Germany Adult ND 28.4
29 Glischrochilus hortensis (Nitidulidae)
ZFMK‐TIS‐2522755
Germany Adult ND 30.6
30 Glischrochilus hortensis (Nitidulidae)
ZFMK‐TIS‐11274
Germany Adult ND 37.5
31 Glischrochilus hortensis (Nitidulidae)
ZFMK‐TIS‐11650
Germany Adult ND 29.5
32 Glischrochilus quadriguttatus (Nitidulidae)
ZFMK‐TIS‐2515238
Germany Adult ND 27.9
33 Glischrochilus quadriguttatus (Nitidulidae)
ZFMK‐TIS‐2511771
Germany Adult ND 31.4
34 Glischrochilus quadriguttatus (Nitidulidae)
ZFMK‐TIS‐2521080
Germany Adult ND 25.4
35 Glischrochilus quadriguttatus (Nitidulidae) Switzerland Adult ND 35.2
36 Glischrochilus quadriguttatus (Nitidulidae) Switzerland Adult ND 34.9
37 Glischrochilus quadriguttatus (Nitidulidae) Switzerland Adult ND 30.9
38 Carpophilus sexpustulatus (Nitidulidae)
ZFMK‐TIS‐2521034
Germany Adult ND 29.1
39 Carpophilus sexpustulatus (Nitidulidae)
ZFMK‐TIS‐2521033
Germany Adult ND 26.4
40 Carpophilus sexpustulatus (Nitidulidae)
ZFMK‐TIS‐2527002
Germany Adult ND 29.3
41 Carpophilus sp. (Nitidulidae)
ZFMK‐TIS‐2580556
Slovenia Adult ND 27
42 Soronia grisea (Nitidulidae) Switzerland Adult ND 35.7
43 Soronia grisea (Nitidulidae) Switzerland Adult ND 38.2
44 Soronia grisea (Nitidulidae) Switzerland Adult ND 29.9
45 Trichodes alvearius Switzerland Adult ND 28.6
46 Hoplia philanthus (Scarabaeidae) Switzerland Adult ND 17.7
47 Hoplia philanthus (Scarabaeidae) Switzerland Adult ND 18.4
48 Hoplia philanthus (Scarabaeidae) Switzerland Adult ND 19.3
49 Hoplia philanthus (Scarabaeidae) Switzerland Adult ND 19.9

Note: ND, non detected.

Some DNA from insects (individuals 23–34 and 38–41) were obtained from BOLD Germany, details can be found at https://doi.org/10.5883/DS-AETHINA

These observations prove the reliability of our multiplex PCR system, despite single nucleotide mismatches present in the COI reverse primer and at 5′ extremity of the COI probe with three known sequences of A. tumida (KT380625.1, KT380626.1, AF227647.1). These single nucleotide mismatches apparently did not influence COI amplification, nor its specificity.

These results further confirm the validity of the proposed multiplex PCR system for a rapid, reliable and specific diagnostics of SHB that may be found in the hive and thus facilitate for example early detection programs.

ACKNOWLEDGEMENTS

The authors thank Stève Breitenmoser, Daniel Cherix for providing samples and taxonomy expertise. The authors address thanks also to Giovanni Formato, Rémy Vandame, Mike Brown for providing samples. The authors thank Bjoern Rulik for providing genetic material from the German Barcode of Life, a project of the Humboldt Ring, grant‐funded by the German Federal Ministry for Education and Research (GBOL1: BMBF #01LI1101A / 01LI1501A).

Financial support was partially granted by the Swiss Veterinary Office.

Use of commercial names in this paper is for information purpose only. There are no conflicts of interest to be declared.

REFERENCES

  • 1. Lundie AE, The small hive beetle, Aethina tumida . South Africa Dept. Agric. Forestry Sci. Bull. 220:1–30 (1940). [Google Scholar]
  • 2. Neumann P, Pettis JS and Schäfer MO, Quo vadis Aethina tumida? Biology and control of small hive beetles. Apidologie 47:1–40 (2016). [Google Scholar]
  • 3. Hood WM, Clemson University Entomology Information Series. Small hive beetle, Clemson cooperative extension, Clemson, SC, USA: (1999). [Google Scholar]
  • 4. Mutinelli F, Montarsi F, Federico G, Granato A, Ponti AM, Grandinetti G et al, Detection of Aethina tumida Murray (Coleoptera: Nitidulidae.) in Italy: outbreaks and early reaction measures. Jof Apic Res 53:569–575 (2014). [Google Scholar]
  • 5. Granato A, Zecchin B, Baratto C, Duquesne V, Negrisolo E, Chauzat M‐P et al, Introduction of Aethina tumida (Coleoptera: Nitidulidae) in the regions of Calabria and Sicily (southern Italy). Apidologie 48:1–10 (2016). [Google Scholar]
  • 6. Schmolke MD, A Study of Aethina tumida: The Small Hive Beetle. University of Rhodesia, South Africa, Rhodesia: (1974). [Google Scholar]
  • 7. Neumann P and Elzen PJ, The biology of the small hive beetle (Aethina tumida, Coleoptera : Nitidulidae): gaps in our knowledge of an invasive species. Apidologie 35:229–247 (2004). [Google Scholar]
  • 8. Ward L, Brown M, Neumann P, Wilkins S, Pettis J and Boonham N, A DNA method for screening hive debris for the presence of small hive beetle (Aethina tumida). Apidologie 38:272–280 (2007). [Google Scholar]
  • 9. Ammazzalorso AD, Zolnik CP, Daniels TJ and Kolokotronis SO, To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis). PeerJ 3:e1147 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S and Madden TL, Primer‐BLAST: a tool to design target‐specific primers for polymerase chain reaction. BMC Bioinformatics 13:134 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M et al, Primer3‐‐new capabilities and interfaces. Nucleic Acids Res 40:e115 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Pest Management Science are provided here courtesy of Wiley

RESOURCES