Abstract
Cryptosporidium is an important opportunistic intestinal pathogen for immunocompromised individuals and a common cause of diarrhea in young children in developing countries. Gastrointestinal epithelial cells play a central role in activating and orchestrating host immune responses against Cryptosporidium infection but underlying molecular mechanisms are not fully understood. We report here that C. parvum infection causes significant alterations in long non-coding RNA (lncRNA) expression profiles in murine intestinal epithelial cells. Transcription of a panel of lncRNA genes, including NR_045064, in infected cells is controlled by the nuclear factor-kappa B signaling. Functionally, inhibition of NR_045064 induction increases parasite burden in intestinal epithelial cells. Induction of NR_045064 enhances the transcription of selected defense genes in host cells following C. parvum infection. Epigenetic histone modifications are involved in NR_045064-mediated transcription of associated defense genes in infected host cells. Moreover, the p300/MLL-associated chromatin remodeling is involved in NR_045064-mediated transcription of associated defense genes in intestinal epithelial cells following C. parvum infection. Expression of NR_045064 and associated genes is also identified in intestinal epithelium in C57BL/6J mice following phosphorothioate oligodeoxynucleotide or lipopolysaccharide stimulation. Our data demonstrate that lncRNAs, such as NR_045064, play a role in regulating epithelial defense against microbial infection.
Keywords: Cryptosporidium, Cryptosporidiosis, Intestinal epithelium, LncRNAs, Csf2, Nos2, Defense, Epigenetic, Histone modifications, WDR5, MLL3/4 complex
Introduction
Epithelial cells along the mucosal surface provide the front line of defense against luminal pathogen infection in the gastrointestinal tract and are an important component of digestive mucosal immunity (1). These epithelial cells represent an integral component of a highly regulated communication network that can transmit essential signals to cells in the underlying gastrointestinal mucosa, and that themselves, in turn, serve as targets of mucosal immune mediators (1). Toll-like receptors (TLRs) and NF-ĸB signaling are key to epithelial immune defense and have been implicated in secretion of antimicrobial peptides, release of cytokines and chemokines to mobilize immune effector cells, and activation of adaptive immunity (2, 3). Upon microbial challenge, gastrointestinal epithelial cells quickly initiate a series of innate immune reactions, including production of antimicrobial molecules and release of chemokines and cytokines (2, 3). These chemokines and cytokines then mobilize and activate immune effector cells to the infection sites (2).
Increasing evidence suggests that long non-coding RNAs (lncRNAs) function to regulate gene transcription through specific interactions with other cellular factors, including proteins, DNA, and other RNA molecules (4). Modes of lncRNA action may include regulation of gene expression in cis or in trans through recruitment of proteins or molecular complexes to specific loci, scaffolding of nuclear complexes, titration of RNA-binding proteins, and pairing with other RNAs to trigger posttranscriptional regulation (5). Many lncRNAs, including long intergenic ncRNAs (lincRNAs), are induced in innate immune cells (6) and may play a role in the regulation of innate defense (7). For example, numerous lincRNAs are differentially regulated in virus-infected cells (8) and in dendritic cells or macrophages following stimulation by ligands for TLR4 and TLR2 (4). LincRNA-Cox2, one of the most highly induced lincRNAs in macrophages, has been shown to mediate both the activation and repression of distinct classes of immune genes (9). We have recently demonstrated that lincRNA-Cox2 regulates inflammatory gene transcription in GI epithelial cells through modulating ATP-dependent chromatin remodeling (10, 11).
Cryptosporidium is a protozoan parasite that infects the gastrointestinal epithelium and other mucosal surfaces in humans (12). This parasite is an important opportunistic pathogen in AIDS patients and a common cause of diarrhea in young children in developing countries (13). Despite its significant morbidity, mortality, and cost to society, there is currently no fully effective therapy available (14). The majority of human cryptosporidial infections are caused by two species: C. parvum and C. hominis (14). Cryptosporidium attaches to the apical membrane surface of epithelial cells and forms an intracellular but extracytoplasmic vacuole in which the organism remains (12). As such, epithelial cells play a central role in activating and orchestrating host immune responses (15). Indeed, the invasion of intestinal epithelial cells by C. parvum in vitro activates TLR4/NF-ĸB signaling, resulting in the production and secretion of various cytokines and chemokines, antimicrobial peptides (β-defensins and cathelicidins), and nitric oxide (NO), which may kill C. parvum or inhibit parasite growth (16, 17).
In this study, we investigated the role of lncRNAs in intestinal epithelial cell antimicrobial defense using murine models of intestinal cryptosporidiosis. We observed significant alterations in lncRNA expression profiles in intestinal epithelial cells following C. parvum infection and identified a panel of lncRNA genes that are controlled by the NF-кB signaling pathway in host cells. One of such lncRNAs, NR_045064 (18), may play a role in regulating epithelial defense against C. parvum infection through facilitating the transactivation of several defense genes.
Materials and Methods
C. parvum, Cell Lines, Reagents
C. parvum oocysts of the Iowa strain were purchased from a commercial source (Bunch Grass Farm, Deary, ID). Murine intestinal epithelial cell line (IEC4.1) was a kind gift from Dr. Pingchang Yang (McMaster University, Hamilton, Canada) and muINTEPI, a murine intestinal epithelial cell line (19), was purchased from InSCREENeX Cellular Screening Technologies (Germany). SC-514 (100 μM, Calbiochem), a potent IKK-2 inhibitor (20), and JSH-23 (Santa Cruz Biotechnology, Dallas, TX), a cell-permeable, selective inhibitor of nuclear translocation of NF-кB p65 and its transcription activity (21, 22), were used to inhibit NF-кB activation. The phosphorothioate oligodeoxynucleotide (ODN), CpG-ODN 1668 (TCCATGACGTTCCTGATGCT), was purchased from Invitrogen (Carlsbad, CA). Lipopolysaccharide (LPS, from E. coli strain K12) was purchased from Invitrogen (San Diego, CA) and IFN-γ and TNF-α were purchased from R&D Systems (Minneapolis, MN). SC-514, TNF-α, IFN-γ and LPS at the utilized concentrations showed no cytotoxic effects on IEC4.1 and muINTEPI cells.
Isolation of intestinal epithelium and enteroids from mice
Intestinal epithelium and enteroids were isolated and cultured as previously described (23). Briefly, small intestines were opened longitudinally and washed with ice-cold Ca2+ and Mg2+ free PBS, then were cut into 1-2 mm fragments and washed with ice-cold Ca2+ and Mg2+ free PBS 3 times. The cut fragments were incubated in ice-cold 2 mM PBS/EDTA at 4°C for 30min with gentle rotation followed by vigorous shake until the PBS solution was mostly opaque with dislodged crypt and villus particles. Large tissue fragments were removed through a 100-μm cell strainer (Becton-Dickinson Bioscience, Franklin Lakes, NJ). The pass through was centrifuged 150g for 5 min at 4°C and the pellet was collected as the intestinal epithelium.
Infection Models and Infection Assays
Models of intestinal cryptosporidiosis using intestinal epithelial cell lines and enteroids were employed as previously described (17, 23). Infection was done in culture medium (DMEM-F12 with 100 U/ml penicillin and 100 μg/ml streptomycin) containing viable C. parvum oocysts (oocysts with host cells in a 1:4 ratio). For in vivo infection, we adapted a murine model of intestinal cryptosporidiosis in neonatal mice (24). Briefly, mice at the age of 7-9 days after birth received C. parvum oocysts by oral gavage (105 oocysts per mice). Mice receiving vehicle (PBS) by oral gavage were used as control. At 24 and 48 h after Cryptosporidium or vehicle administration, animals were sacrificed and ileum intestinal tissues were collected. At least five animals from each group were sacrificed and ileum tissues were obtained for biochemical analysis. The C57BL/6J mice (The Jackson Laboratory) were used and approved by the Creighton University Biosafety and Institutional Animal Care and Use Committees. Infection was quantified by using real-time PCR, immunofluorescence microscopy, and immunohistochemistry, as previously reported (17, 23).
Real-time PCR
For quantitative analysis of mRNA and lncRNA expression, comparative real-time PCR was performed as previous reported (8-11, 17, 23) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). The sequences for all the primers are listed in Table S1.
Small RNAs (siRNAs) and Plasmids
Custom-designed RNA oligos against NR_045064 and a scrambled RNA were synthesized by Exiqon and transfected into cells with Lipofectamine RNAimax according to the manufacturer’s protocol (Invitrogen). Sequences of siRNAs are: GAAAUGCUAACCGAGCUCAUU (sense) and UGAGCUCGGUUAGCAUUUCUU (antisense) for NR_045064 and non-specific scrambled sequence UUCUCCGAACGUGUCACGUUU (sense) and ACGUGACACGUUCGGAGAAUU (antisense) for the control. The Wdr5 siRNA was purchased from the Santa Cruz Biotechnology. siRNAs were transfected into IEC4.1 cells with Lipofectamine RNAimax (Invitrogen). For NR_045064 siRNA transfection into enteroids, the electroporation approach was used with the Neon transfection system (Thermo Fisher Scientific, Waltham, MA; electroporation parameter: 1600 v, 10 ms, pulse 3). The full length of NR_045064 was cloned into the pcDNA3.1(+) vector according to the manufacturer’s protocol. NR_045064-pCDNA 3.1(+) was transfected to cells with Lipofectamine 2000 (Invitrogen).
Luciferase reporter constructs and luciferase assay
The −1906 to +139 region of the NR_045064 gene, which contains four putative NF-кB binding sites, was cloned into the multiple cloning site of the pGL3-Basic Luciferase vector (Thermo Fisher Scientific). The following primers were used to amplify the sequence: 5’-GGGTACCAGTCAGTTTTACTATG -3’ (forward, with the restriction site for KpnI) and 5’- CCAAGCTTCCACGCAGAAGG -3’ (reverse, with the restriction site for HindIII). The vectors with the mutants of the putative NF-кB binding sites using the GeneArt Site-Directed Mutagenesis PLUS kit (Thermo Fisher Scientific) and the empty vector were used as the control. The sequences for primers used for mutants are listed in Table S1. Cultured cells were transfected with the reporter construct overnight and then exposed to C. parvum infection for 8 h in the presence or absence of SC-514 or JSH-23 followed by assessment of luciferase activity. The luciferase activity was normalized to the control β-galactosidase level and compared with that of the pGL3 basic vector.
Whole cell extracts and Western Blot
Whole cell extracts were isolated using the standard approach as previously reported (25). Briefly, cells were grown to 80% confluence and then exposed to C. parvum for various times. Cells were washed with PBS, and the whole cell protein was extracted in M-PER™ Mammalian Protein Extraction Reagent (Thermo Scientific) with proteinase inhibitor according to the product instruction. Protein concentration of each whole cell lysate was determined and subsequently analyzed by Western blot. The following antibodies were used for blotting: anti-H3K4me1 (Abcam), anti-Actin (Sigma), and anti-Wdr5 (Cell Signaling Technology).
Immunoprecipitation (IP) and Co-IP
Cells were lysed with the lysis buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 20 μM MG-132, 1 mM PMSF, 10 μg/ml leupeptin, and 2 μg/ml pepstatin). A total of 1,000 μg of lysate protein was incubated with the primary antibodies at 4°C overnight to immunoprecipitate the protein complexes. Immune complexes were then collected by direct binding to protein A-Sepharose. The immunoprecipitates were then blotted with the corresponding antibody against the protein as indicated. Anti-Mll3 (Millipore) and anti-Mll4 (Millipore) were used for IP/Co-IP analysis.
RNA Immunnoprecipitation (RIP), Chromatin Immunoprecipitation (ChIP), and Chromatin Isolation by RNA Purification (ChIRP) Analyses
The formaldehyde crosslinking RIP was performed as described (26). Briefly, precleaning lysates with 20 μl of PBS washed Magna ChIP Protein A+G Magnetic Beads (Millipore, Massachusetts). The precleaned lysate (250 μl) was then diluted with the whole cell extract buffer (250 μl), mixed with the specific antibody-coated beads, and incubated with rotation at 4°C for 4h, followed by 4 times washing with the whole cell extract buffer containing protease and RNase inhibitors. The collected immunoprecipitated RNP complexes and input were digested in RNA PK Buffer pH 7.0 (100 mM NaCl, 10 mM TrisCl pH 7.0,1 mM EDTA, 0.5% SDS) with addition of 10 μg Proteinase K and incubated at 50 °C for 45 min with end-to-end shaking at 400 rpm. Formaldehyde cross-links were reversed by incubation at 65 °C with rotation for 4 h. RNA was extracted from these samples using Trizol according to the manufacturer’s protocol (Invitrogen) and treated with DNA-free DNase Treatment & Removal I kit according to the manufacturer’s protocol (Ambion Inc., Austin, TX). The presence of RNA was measured by quantitative, strand-specific RT-PCR using the iCycler iQ Real-time detection system (BioRad). Gene-specific PCR primer pairs are listed in Table S1. ChIP analysis was carried out as previously reported (10,11). The following antibodies were used for ChIP analysis: anti-p300 (Abcam), anti-H3k4me1 (Abcam), anti-H3k36me3 (Cell Signaling Technology), and anti-Wdr5 (Cell Signaling Technology). ChIRP analysis was performed as previously reported (27). Briefly, a pool of tiling oligonucleotide probes with affinity specific to NR_045064 was used and glutaraldehyde cross-linked for chromatin isolation. The sequences for each probe are listed in Table S1. The DNA sequences of the chromatin immunoprecipitates were confirmed by real-time PCR using the same primer sets covering the gene promoter regions of interest as for ChIP analysis. A pool of scrambled oligo probes and primers for LacZ were used as controls.
Intestinal epithelial inflammation induced by ODN or LPS in mice
C57BL/6J mice (6 days old) (The Jackson Laboratory) were administrated with CpG-ODN 1668 (30 mg/kg body weight, oral) and intestine epithelium were collected at 4 and 24 h, as previously reported (28, 29). For LPS stimulation, C57BL/6J mice (4-6 wk old) (The Jackson Laboratory) were injected with LPS (15 mg/kg bodyweight, i.p.), as previously reported (30-32), and intestine epithelium were collected at 4 and 24 h post-injection. Tissue isolated from mice after PBS administration were used as the control.
Statistical Analysis
All values are given as mean ± SEM. Means of groups were from at least three independent experiments and compared with Student’s t test (unpaired) or the ANOVA test when appropriate. p values < 0.05 were considered statistically significant. The array data were analyzed and compared statistically by LC Sciences using the Agilent Feature Extraction Software, in accordance with MIAME guidelines. p values < 0.05 were considered statistically significant.
Results
Alterations in lncRNA expression profiles in intestinal epithelial cells following C. parvum infection
To characterize the lncRNA expression profile in intestinal epithelial cells following Cryptosporidium infection, a genome-wide transcriptome analysis was performed using an in vitro model of intestinal cryptosporidiosis employing the IEC4.1 cell line, a transformed but non-tumorigenic intestinal epithelial cell line from neonatal mice (5-7 days old). IEC4.1 cells were exposed to C. parvum infection for 24 h and genome-wide RNA transcriptome analysis was carried out using the Agilent SurePrint G3 Mouse Gene Expression Microarray (G4852A), which provides full coverage of genes and transcripts with the most up-to-date content, including mRNAs and lncRNAs (http://www.chem.agilent.com/store/en_US/Prod-G4852A/G4852A). All array data were described in accordance with MIAME guidelines and deposited at GEO database (with the accession number: GSE112247; https://www.ncbi.nlm.nih.gov/geo). A total of 1406 protein-coding genes were upregulated and 2536 protein-coding genes downregulated in cells following infection (the fold changes >1.25 combined with a p < 0.05 as the threshold) (Table S2 and database GSE112247). A total of 1212 lncRNAs were upregulated and 627 lncRNAs downregulated in the infected cells (Table S3 and database GSE112247). Top 20 upregulated and downregulated lncRNA candidates are shown in heatmap in Figure 1A. C. parvum-induced upregulation of selected lncRNA genes was further confirmed by quantitative real-time PCR in IEC4.1 cells and muINTEPI cells following infection for 24 h (Figure 1B). Consistent with previous studies (17, 33, 34), protein-coding genes, such as chemokine (C-X-C motif) ligand 2 (Cxcl2), nitric oxide synthase (Nos2/iNos) and colony stimulating factor 2 (Csf2), were upregulated in host cells following C. parvum infection (Figure S1A, Table S2 and database GSE112247). Using an ex vivo infection model employing enteroids from neonatal mice (23), we detected increased expression levels of selected lncRNAs in enteroids following C. parvum infection (Figure 1B). An increase in their expression levels was also observed in the intestinal epithelium in infected neonatal mice at 72 h after oral administration of the parasite (Figure 1B). The top 5 most upregulated lncRNAs in the intestinal epithelium following infection in vivo are NR_045064, lncRNA-Chr5:5405, lncRNA-Chr14:1060, NR_045311 and lincRNA-Chr9:4130 (Figure 1B)
Figure 1.

Alterations in lncRNA expression profile in intestinal epithelial cells following C. parvum infection. (A) Heat maps representing the top 20 upregulated and downregulated lncRNA genes in IEC4.1 cells following C. parvum infection. IEC cells were exposed to C. parvum infection for 24 h followed by genome-wide array analysis. The top 20 upregulated lncRNAs and top 20 downregulated lncRNA genes were shown, presented as fold changes to the mean value of the log2 (Hy5/Hy3) ratios in the non-infected control (n=3). (B) Expression levels of selected upregulated lncRNA genes in IEC4.1 cells, muINTEPI cells, enteroids, and intestinal epithelium following C. parvum infection, as validated by using real-time quantitative PCR. IEC4.1 and muINTEPI cells were exposed to infection for 24 h; crypt units of small intestinal epithelium were isolated and exposed to C. parvum infection in culture for 24 h. Neonates of mice at 5 days of age received C. parvum administration by oral and intestinal ileum epithelium were isolated after infection for 72 h. Expression levels of lncRNAs were quantified by using real-time PCR. Data represent three independent experiments. *P<.05 and ** P<.01 vs cells of the non-infected control.
Transcriptional control of lncRNAs, such as NR_045064, by NF-кB signaling in intestinal epithelial cells following C. parvum infection
Differential alterations in the lncRNA expression profile of infected host cells suggest that lncRNA gene expression is finely controlled in intestinal epithelial cells in response to C. parvum infection. In our previous studies, we demonstrated that C. parvum infection activates the NF-кB pathway in gastrointestinal epithelial cells through microbial recognition of TLR4 and TLR2 (35, 36). Therefore, we asked whether activation of the NF-кB pathway is involved in the transcription of select lncRNAs upregulated by C. parvum. We exposed IEC4.1 cells to C. parvum infection in the presence of SC-514, an IKK2 inhibitor that prevents p65-associated transcriptional activation of the NF-кB pathway (20). SC-514 blocked C. parvum-induced upregulation of many lncRNAs (Figure 2A). One of such lncRNAs is NR_045064, a non-coding transcript of 754 nt from chromosome 15 (Figure 2B) (18). Expression of this NR_045064 was detected in many of the tissues and organs obtained from mice, such as the brain, heart, and lungs (Figure S1A). NF-кB-dependent upregulation of NR_045064, as well as several other selected lncRNAs induced by C. parvum infection in IEC4.1 cells, was further confirmed in muINTEPI cells following infection in the presence or absence of SC-514 or JSH-23 (Figure 2C). Induction of NR_045064 by C. parvum infection was detected in IEC4.1 cells as early as 8 h following infection, persisting for up to 48 h in the infected cells (Figure 2D). Transactivation of the NR_045064 gene was also detected in IEC4.1 and muINTEPI cells following stimulation by LPS or TNF-α, but not by IFN-γ (Figure 2E). Based on TFSEARCH (http://www.cbrc.jp/ research/db/TFSEARCH.html) and MOTIF (http://motif.genome.jp/) database searches (37, 38), putative NF-кB binding sites were identified within the potential promoter region of the NR_045064 gene (Figure 2F). We then cloned the potential promoter region of the NR_045064 gene and inserted the sequence into the luciferase reporter vector (Figure 2F). C. parvum infection increased the luciferase activity in cells transfected with the luciferase construct that encompassed the promoter region of NR_045064 gene, but not in cells transfected with the empty vector control (Figure 2F). Moreover, increased luciferase activity associated with the promoter region of the NR_045064 gene induced by C. parvum infection was blocked with the NF-кB inhibitor or by mutation of the putative NF-кB binding sites (Figure 2F).
Figure 2. Transcriptional control of lncRNAs, such as NR_045064, by the NF-кB signaling in intestinal epithelial cells following C. parvum infection.

(A) Effects of NF-кB signaling inhibition on C. parvum-induced lncRNA expression in IEC4.1 cells. IEC4.1 cells were exposed to C. parvum infection for 24 h in the presence or absence of the NF-кB inhibitor SC-514. Inhibition of NF-кB signaling attenuated the induction of many selected lncRNAs, such as NR_045064, in cells following infection. (B) Genome location and the sequence of NR_045064 gene. (C) Effects of NF-кB signaling inhibition on C. parvum-induced lncRNA expression in muINTEPI cells. Cells were exposed to C. parvum infection for 24 h in the presence or absence of the NF-кB inhibitor SC-514 or JSH-23. Expression levels of selected lncRNAs, including NR_045064, were measured by using real-time PCR. (D) Time course of NR_045064 induction in IEC4.1 cells following C. parvum infection. IEC4.1 cells were exposed to C. parvum infection for 6, 8, 24, 48 h and expression levels of NR_045064 were quantified by real-time PCR. (E) Induction of NR_045064 in IEC4.1 and muINTEPI cells in response to stimuli by LPS, TNF-α, and IFN-γ. Cells were exposed to various stimuli for 1 - 4 h and expression levels of NR_045064 were measured by using real-time PCR. (F) C. parvum infection triggers the luciferase activity associated with the NR_045064 promoter in IEC4.1 cells. The 2kb upstream of the transcription start site of NR_045064 was cloned and inserted into the pGL3-Basic luciferase reporter construct, with or without the mutation in the putative NF-кB binding sites. Cells were transfected with the generated reporter constructs and then exposed to C. parvum infection for 8 h in the presence or absence of SC-514 or JSH-23. Infection triggered the luciferase activity associated with the NR_045064 promoter in IEC4.1 cells, whereas SC-514 and JSH-23 attenuated this activity. Data represent means ± SEM from three independent experiments. *P<.05 and ** P<.01 vs cells of non-infected control; # P<.05 and ## P<.01 vs infected cells without treatment with SC-514 or JSH-23.
Impact of NR_045064 induction on parasite burden in intestinal epithelial cells following C. parvum infection
The NF-кB signaling pathway has been demonstrated to be essential to epithelial anti-C. parvum defense (12, 15, 36). Given the fact that NR_045064 is the top induced lincRNA in intestinal epithelium following C. parvum infection in vivo, couple with its NF-кB-dependent transcription feature, we asked whether transcription of this gene is involved in epithelial anti-C. parvum defense. To test this possibility, we took the RNAi approach to knockdown NR_045064 in host cells and then measured its impact on C. parvum infection burden following exposure of them to the parasites for various periods of time. The designed siRNA to NR_045064 could significantly knockdown the expression level of NR_045064 in the non-infected and C. parvum-infected IEC4.1 cells (Figure 3A). Intriguingly, knockdown of NR_045064, but not the non-specific siRNA controls, caused a significant increase in the infection burden in IEC 4.1 cells (Figure 3B). Complementarily, overexpression of the 754 nt of NR_045064 in IEC4.1 cells resulted in a decrease of infection burden (Figure 3C). Moreover, siRNAs to knockdown NR_045064 also increased the burden of C. parvum infection in enteroids isolated from neonatal mice (Figure 3D). Taken together, the above data suggest that induction of NR_045064 may promote epithelial antimicrobial defense against C. parvum infection.
Figure 3.

Impact of NR_045064 induction on parasite burden in intestinal epithelial cells and enteroids following C. parvum infection. (A) Knockdown of NR_045064 with a siRNA in IEC4.1 cells. Cells were treated with the designed siRNA to NR_045064 and then exposed to C. parvum infection, followed by real-time PCR analysis of NR_045064. A non-specific siRNA sequence was used as the control. (B) Knockdown of NR_045064 on C. parvum parasite burden in IEC4.1 cells. Cells were treated with the siRNA to NR_045064 and exposed to C. parvum infection for 8 and 24 h. Cells treated with the non-specific scrambled siRNA were used as the control and C. parvum burden was quantified by using real-time PCR. (C) Overexpression of NR_045064 on C. parvum parasite burden in IEC4.1 cells. Cells were transfected with the NR_045064-pcDNA3.1(+) and then exposed to C. parvum infection for 8 and 24 h. Cells treated with the empty pcDNA3.1(+) vector were used as the control and C. parvum burden was quantified by using real-time PCR. (D) Knockdown of NR_045064 on parasite burden in enteroids following C. parvum infection ex vivo. Enteroids were treated with the NR_045064 siRNA and then exposed to C. parvum infection for 24 h. Infection burden was quantified by using real-time PCR. * p < 0.05 and ** p < 0.01 vs non-infected cells transfected with a control siRNA (in A, B and D) or pcDNA3.1(+) empty plasmid control (in C); # p < 0.05 and ## p < 0.01 vs infected cells transfected with a control siRNA (in A, B and D) or pcDNA3.1(+) empty plasmid control (in C).
Impact of NR_045064 induction on the transcription of selected defense genes in intestinal epithelial cells following C. parvum infection
Given the significant impact of NR_045064 induction on the parasite infection burden, we tested whether NR_045064 induction can affect the transcription of epithelial cell defense genes in intestinal epithelial cells following C. parvum infection. Previous studies have demonstrated a set of genes critical to epithelial anti-C. parvum defense, such as Nos2, Csf2, Cxcl2, indoleamine-2,3-dioxygenase 1 (Ido1), lipocalin (Lcn2), and regenerating islet-derived 3 gamma (Reg3g) (1-3). We then measured the expression levels of these genes in cells either transfected the siRNAs to NR_045064 or overexpressed with the NR_045064 vector following C. parvum infection. Upregulation of expression levels for Csf2, Nos2, and Cxcl2 genes was detected in IEC4.1 cells following C. parvum infection (Figure 4A). Knockdown of NR_045064, but not the non-specific siRNA controls, attenuated the induction of Csf2, Nos2, and Cxcl2 in cells induced by C. parvum infection (Figure 4A). Complementarily, overexpression of NR_045064 enhanced C. parvum-induced expression of Csf2, Nos2, and Cxcl2 in IEC4.1 cells (Figure 4B). Neither siRNA to NR_045064 nor forced expression of NR_045064 resulted in significant changes in the expression levels of Lcn2, Ido1 and Reg3g in the non-infected or C. parvum-infected IEC4.1 cells (Figure 4A and 4B). The above data suggest that NR_045064 induction is involved in the transcriptional regulation of selected defense genes in intestinal epithelial cells following C. parvum infection.
Figure 4.

Impact of NR_045064 induction on the transcription of selected defense genes in intestinal epithelial cells following C. parvum infection. (A) Knockdown of NR_045064 on the expression levels of epithelial defense genes in IEC4.1 cells in response to C. parvum infection. Cells were treated with the siRNA to NR_045064 and exposed to C. parvum infection for 24 h. Cells treated with the non-specific scrambled siRNA were used as the control and expression levels of selected defense genes were quantified by using real-time PCR. (B) Overexpression of NR_045064 on the expression levels of epithelial defense genes in IEC4.1 cells in response to C. parvum infection. Cells were transfected with the NR_045064-pcDNA3.1(+) and then exposed to C. parvum infection for 24 h. Cells treated with the empty pcDNA3.1(+) vector were used as the control and expression levels of selected defense genes were quantified by using real-time PCR. * p<0.05 and ** p < 0.01 vs non-infected cells transfected with a control siRNA (in A) or pcDNA3.1(+) empty plasmid control (in B); ## p < 0.01 vs infected cells transfected with a control siRNA (in A) or pcDNA3.1(+) empty plasmid control (in B).
Epigenetic histone modifications are involved in NR_045064-mediated transcription of Nos2 and Csf2 genes in intestinal epithelial cells following C. parvum infection
To explore the underlying mechanisms of NR_045064-mediated gene transactivation, we asked whether NR_045064 induction can impact the transcriptional active histone modifications associated with Nos2 and Csf2 genes induced by C. parvum infection. Histone modifications, such as H3K4 and H3K36 methylations, are generally associated with gene transactivation (39). Using chromatin immunoprecipitation (ChIP) analysis with designed PCR primers (Table S1) covering the various regions of regulatory promoters of the genes (Figure 5A), we detected a significant increase in H3K4me1 in the gene loci of Nos2 and Csf2 in infected IEC4.1 cells (Figure 5A). Indeed, an increased content of H3K4me1 at the protein level was measured using Western blot in cells following infection at 24h (Figure S1A). Accordingly, enrichment of H3K4me1 at the gene loci of Nos2 and Csf2 induced by C. parvum were attenuated in cells transfected with the siRNA to NR_045064 (Figure 5A). Nevertheless, no detectable increase in H3K36me3 was detected in the Nos2 and Csf2 gene loci in infected IEC4.1 cells (Figure 5B).
Figure 5.

Impact of NR_045064 induction on the active histone modifications associated with selected defense genes in intestinal epithelial cells following C. parvum infection. (A) Enrichment of the activation marker H3K4me1 associated with Nos2 and Csf2 gene loci in IEC4.1 cells following C. parvum infection. Cells were transfected with NR_045064 siRNA for 16 h and exposed to C. parvum infection for 24 h, followed by ChIP analysis using anti-H3K4me1 and the PCR primer sets as designed. Cells treated with the scrambled siRNA were used as the control. A significant increase in the enrichment of H3K4me1 was detected with the promoter regions of both Nos2 and Csf2 gene loci in cells following infection. (B) No significant enrichment of the activation marker H3K36me3 associated with Nos2 and Csf2 gene loci in IEC4.1 cells following C. parvum infection. Cells were transfected with NR_045064 siRNA for 16 h and exposed to C. parvum infection for 24 h, followed by ChIP analysis using anti-H3K36me3 and the PCR primer sets as designed. Data represent means ± SEM from three independent experiments. * p<0.05 vs non-infected cells transfected with the control siRNA; # p < 0.05 vs infected cells transfected with the control siRNA.
WDR5/MLL-p300 associated chromatin remodeling is involved in NR_045064-mediated transcription of Nos2 and Csf2 genes in intestinal epithelial cells following C. parvum infection
We further asked the question how transcription of Nos2 and Csf2 genes is selectively regulated by NR_045064. Based on TFSEARCH (http://www.cbrc.jp/research/db/ TFSEARCH.html) and MOTIF (http://motif.genome.jp/) database searches (37, 38), putative p300 binding sites were identified within the potential promoter regions of the Nos2 and Csf2 gene loci. To define whether NR_045064 is physiologically associated with p300, we performed the RIP assay. A significant amount of NR_045064 was detected in the immunoprecipitates from both the non-infected and infected IEC4.1 cells using anti-p300 (Figure 6A), suggesting a physiological association between p300 and NR_045064. Nevertheless, no obvious increase of NR_045064 to the p300 complex in the infected cells, probably because that whole cell extracts were used for the RIP assay and the anti-p300 was not specific for activated p300. We then asked whether they could coordinately be recruited to the Nos2 and Csf2 gene loci. Indeed, an increased occupancy of p300 to the promotor regions of Nos2 and Csf2 gene loci was detected using the ChIP analysis (Figure 6B). Knockdown NR_045064 with the siRNAs partially blocked the occupancy of p300 to the promotor regions of the gene loci (Figure 6B). To define whether NR_045064 is also recruited to the Nos2 and Csf2 gene loci to facilitate their transcription in infected cells, we performed chromatin isolation by RNA purification (ChIRP) analysis to measure the occupancy of NR_045064 to the genes in cells following infection. A pool of biotinylated tiling oligonucleotide probes with affinity to the NR_045064 sequence was used to precipitate the chromatin fragments through glutaraldehyde crosslinking and chromatin isolation. The DNA sequences of the precipitated chromatin fragments were identified by PCR using primers specific to various regions of the DNA sequences of the target gene loci (27). We detected an increased occupancy of NR_045064 to the Nos2 and Csf2 gene loci in IEC4.1 cells after exposure to C. parvum for 24h (Figure 6C).
Figure 6.

p300 and Wdr5/Mll-containing complex associated chromatin remodeling and effects of NR_045064 induction on the transcription of selected defense genes in intestinal epithelial cells following C. parvum infection. (A) Physiologic association of NR_045064 with the p300 complex in IEC4.1 cells. Cells were exposed to C. parvum infection for 24 h, followed by RNA immunoprecipitation (RIP) analysis using anti-p300. Presence of NR_045064, but not the control RNU2-1 snRNA in the immunoprecipitates from infected cells was detected by real-time PCR. (B) Increased recruitment of p300 to the Nos2 and Csf2 gene loci in IEC4.1 cells following C. parvum infection. Cells were transfected with the NR_045064 siRNA for 16 h, then exposed to C. parvum infection for 24 h followed by ChIP analysis using anti-p300 and the PCR primer sets as designed. (C) Increased recruitment of NR_045064 to the Nos2 and Csf2 gene loci in IEC4.1 cells following C. parvum infection. Cells were exposed to C. parvum infection for 24 h followed by ChIRP analysis using a pool of probes specific to NR_045064 and the PCR primer sets as designed. (D) Physiologic association of NR_045064 with the Wdr5-containing complex in cells following infection. IEC4.1 cells were exposed to C. parvum infection for 24 h, followed by RIP analysis using anti-Wdr5. (E) Knockdown of NR_045064 attenuated the association between Wdr5 and Mll3/4 complex in IEC4.1 cells induced by infection. Cells were transfected with the NR_045064 siRNA for 16 h, then exposed to C. parvum infection for 24 h followed by Co-IP analysis. Representative gel images are shown. Densitometric levels of positive signals were quantified and are expressed as the ratio to the input. (F) Increased recruitment of Wdr5 to the Nos2 and Csf2 gene loci in infected IEC4.1 cells. Cells were transfected with the NR_045064 siRNA for 16 h, then exposed to C. parvum infection for 24 h followed by ChIP analysis using anti-Wdr5 and the PCR primer sets as designed. (G) Knockdown of Wdr5 on C. parvum-induced transcription of the Nos2 and Csf2 genes in IEC4.1 cells. Cells were transfected with the Wdr5 siRNA for 16 h, then exposed to C. parvum infection for 24 h followed by real-time PCR analysis of the Nos2 and Csf2 genes. Data represent means ± SEM from three independent experiments. * P<0.05 versus non-infected cells treated with the siRNA control; # P < 0.05 vs infected cells transfected with the control siRNA.
The p300 transcription factor is not generally accepted as an RNA-binding protein (RBP) (40). To clarify which RNA-binding elements in the p300/NR_045064 complex may mediate the assembly of NR_045064, we tested the potential involvement of Wdr5, an RBP and a key element of the Mll complex that has been implicated in p300-mediated histone methylation and gene transcription (41). We first performed the RIP assay using anti-Wdr5 in cells following C. parvum infection. A significant amount of NR_045064, but not for the control Run2-1 RNA, was detected in the immunoprecipitates from infected cells (Figure 6D). Assembly of NR_045064 to the Wdr5 complex was not detected in the non-infected control (Figure 6D). We then performed Co-IP analysis for Wdr5 and the Mll complex in cells following C. parvum infection. An increased association between Wdr5 and the Mll3/Mll4 was detected in infected IEC4.1 cells (Figure 6E). Knockdown of NR_045064 with the siRNAs significantly blocked the physical association between Wdr5 and Mll3/Mll4 complex (Figure 6E). Accordingly, an increased recruitment of Mll/Wdr5 complex was detected in the Nos2 and Csf2 gene loci in IEC4.1 cells after exposure to C. parvum for 24h (Figure 6F). Notably, both Wdr5 and NR_054064 were recruited to the set 2 promoter region of Csf2 and set 1/2/3 promoter regions of Nos2. However, recruitment of NR_054064, but not Wdr5, was detected in the set 3/5 regions of Csf2 and set 7 region of Nos2. Recruitment of Wdr5, but not NR_054064, was detected in the set 1 region of Csf2 and set 4 region of Nos2 (Figure 6C and 6F). Interestingly, knockdown of NR_045064 with the siRNAs significantly blocked the recruitment of Wdr5 to all the set regions of Nos2 and Csf2 gene loci in infected cells, even for the set 1 region of Csf2 and set 4 region of Nos2 where direct recruitment of NR_045064 was not detected (Figure 6C and 6F). Complementarily, siRNA knockdown of Wdr5 also significantly inhibited C. parvum-induced transcription of Nos2 and Csf2 genes in IEC4.1 cells (Figure 6G). Taken together, the above data indicate that WDR5/MLL-p300 associated chromatin remodeling is involved in NR_045064-mediated transcription of associated defense genes in intestinal epithelial cells following C. parvum infection.
Expression of NR_045064 and inflammatory genes in the intestinal epithelium in response to ODN or LPS stimulation
To determine the relevance of our findings of C. parvum-responsive NR_045064-mediated intestinal defense gene transcription in the intestine in general, we tested intestinal epithelial response to ODN and LPS stimulation. Given the activation of TLR9/NF-кB signaling in intestinal epithelium by CpG-ODNs in vitro and in vivo, this model has been used to stimulate NF-кB-mediated innate defense in the gastrointestinal tract (28, 29). Transactivation of the NR_045064 gene was detected in IEC4.1 and muINTEPI cells following stimulation by CpG-ODN 1668 (Figure 7A). Mice were administrated by oral with CpG-ODN 1668 (30 mg/kg body weight) and intestinal epithelium was isolated. Expression levels of NR_045064 and inflammatory genes were measured. A significant increase in NR_045064 levels was found in the small intestinal epithelium (Figure 7B). Upregulation of Nos2 and Cxcl2 was also detected in the small intestinal epithelium from mice after ODN injection (Figure 7B). Similarly, using a well-established mouse septic model induced by LPS to the abdominal cavity (30-32), we detected a significant increase in the expression levels of NR_045064, Nos2 and Cxcl2 in the small intestinal epithelium from mice after LPS injection (Figure 7C).
Figure 7.

Expression of NR_045064, Nos2 and Cxcl2 in intestinal epithelium in response to ODN or LPS stimulation. (A) Induction of NR_045064 in IEC4.1 and muINTEPI cells in response to ODN stimulation. Cells were exposed to ODN stimulation for 4 h and expression levels of NR_045064 were measured by using real-time PCR. (B) Induction of NR_045064, Nos2 and Cxcl2 in the small intestinal epithelium from animals following ODN oral administration as assessed by real-time PCR. Mice received CpG-ODN 1668 (30 mg/kg body weight) and small intestinal epithelium was isolated at 4 and 24 h after ODN oral administration. (C) Induction of NR_045064, Nos2 and Cxcl2 in the small intestinal epithelium from animals at 4 and 24 h after LPS stimulation. Mice were injected intraperitoneally with LPS (15 mg/kg body weight). Small intestinal epithelium from animals received PBS oral administration or intraperitoneal injection was used for control. Data represent means ± SEM from 3-10 mice.
Discussion
Our genome-wide analysis of the transcriptomic profile revealed distinct gene expression patterns for both protein-coding genes and lncRNA genes in intestinal epithelial cells following C. parvum infection. Similar to the protein-coding genes, transcription of a panel of lncRNA genes appears to be controlled by NF-кB signaling. One of such lncRNAs, NR_045064, is induced at an early phase in host cells following C. parvum infection and functionally, induction of NR_045064 is involved in the regulation of epithelial antimicrobial defense responses through facilitating defense gene transcription. Therefore, lncRNAs may represent a new arm of regulation in defense mechanisms in intestinal epithelial cells against C. parvum infection.
Various models of transcriptional control of lncRNA genes have recently been proposed, based upon their genomic locations (5). Some may have their own regulatory elements (e.g., promoters and enhancers) and thus, are regulated independently (42-44). Others may share the regulatory elements with nearby genes and be co-regulated along with other genes (45-46). Regulation of the NR_045064 gene at the transcriptional level by NF-κB involves binding of the NF-κB subunits to the putative promoter region of the NR_045064 gene. Putative binding sites exist at the promoter region of the gene locus. Moreover, luciferase reporter assay associated with the transcriptional activity induced by NF-κB activation was detected in intestinal epithelial cells following C. parvum infection. Thus, NF-κB-mediated transcription of lncRNA genes may be an important part of the transcriptional responses in intestinal epithelial cells to C. parvum infection.
One of the major findings of this study is that NR_045064 is required for efficient epithelial defense against Cryptosporidium infection. Loss-of- or gain-of-function of NR_045064 can significantly impact the parasite burden in intestinal epithelial cells. Previous studies demonstrated that knockdown a single lncRNA could alter the expression profiles of many genes (9, 10, 11, 48, 49). For example, knockdown of lincRNA-Cox2, a TLR/NF-κB-responsive lincRNA in murine macrophages (9), resulted in a global inhibition of transcription of the late primary inflammatory genes in cells in response to LPS stimulation (10). Given the essential role of a limited defense genes for intestinal epithelial cells against C. parvum infection (15), we focused our analysis of NR_045064 influence on defense gene transcription. Our data support that induction of NR_045064 is involved in the transcriptional regulation of selected defense genes in cells following C. parvum infection. This impact appears to be gene specific, as the upregulation of the Nos2 and Csf2 genes, not the other tested defense genes such as Lcn2 and Ido1, was attenuated in infected cells treated with the siRNA to NR_045064. The recruitment of NR_045064 to the Cfs2 and Nos2 gene loci in cells following infection further support that this function of NR_045064 on Nos2 and Csf2 expression is at the transcription level.
Our data support that the transcriptional regulation of Nos2 and Csf2 genes by NR_045064 in cells in response to C. parvum infection involves p300/WDR5/MLL complex-mediated epigenetic gene transcription. The SET1/COMPASS family of histone H3K4 methylases are essential regulators of transcription and key mediators of normal development and disease (50, 51). Key subunits of this family proteins include MLL1, MLL3, MLL4, SET1A, SET1B, WDR5, RbBP5, ASH2L, and DPY30 (47). Of these subunits, MLL3 and MLL4 possess histone methylation activity and are involved in transcriptional coactivation of many genes (50-53). Functionally, the WDR5/MLL3/4-containing complex has been associated with p300-mediated gene transcription through modulation of histone modifications (41). First, we identified that several of the key subunits of the complex were recruited to the Nos2 and Csf2 gene loci in cells following infection, including p300 and Wdr5. Importantly, NR_045064 was also recruited to the similar regions of the gene loci in infected cells. Second, the WDR5/MLL-containing complex-associated H3K4 methylation was also enriched at the corresponding regions of the gene loci in cells following infection. Knockdown of Wdr5 attenuated the enrichment of above histone modifications at the Nos2 and Csf2 gene loci. Finally, NR_045064 is involved in the recruitment of the complex to the gene loci, as NR_045064 was assembled into the Wdr5-containing complex and knockdown of NR_045064 resulted in a decreased recruitment of p300 and Wdr5 and associated H3K4 methylation at the Nos2 and Csf2 gene loci in cells following infection.
Notably, both Wdr5 and NR_054064 were recruited to the set 2 promoter region of Csf2 and set 1/2/3 promoter regions of Nos2. However, recruitment of NR-054064, but not Wdr5, was detected in the set 3/5 regions of Csf2 and set 7 region of Nos2, suggesting other Wdr5-indenepdent mechanisms for NR_054064 recruitment to different regions. Intriguingly, knockdown of NR_045064 could block the recruitment of Wdr5 to the set 1 region of Csf2 and set 4 region of Nos2 where recruitment of NR_045064 was not detected. Underlying mechanisms merit further investigation.
NR_045064 may function as a scaffold molecule through its interactions with the RNA-binding proteins within the Wdr5/Mll complex. Wdr5 is a known RNA-binding protein and the Wdr5/Mll complex is involved in p300-mediated gene transcription (41). Whether NR_045064 can directly interact with Wdr5 requires further characterization using in vitro RNA-pull down assay. However, knockdown of NR_045064 resulted in dissociation between Wdr5 and Mll3 or Mll4, as revealed by our Co-IP analysis. This implicates to us that NR_045064 may function as a scaffold to assemble various key elements for the Wdr5/Mll complex. Alternatively, some lncRNAs have been demonstrated to interact with DNA molecules to form a triple-helical structure (54, 55). As such, NR_045064 may “guide” the initial recruitment of the Wdr5/Mll complex to the gene loci through direct binding to a specific DNA motif. We favor the speculation that NR_045064 may function as a scaffold molecule for the assembly of various p300/Wdr5/Mll components to the Nos2 and Csf2 gene loci in cells following Cryptosporidium infection.
NF-κB-mediated NR_045064 expression and its subsequent impact on transcription of defense genes may also be involved in intestinal inflammation and infection by other pathogens. The induction of NR_045064 in intestinal epithelium following stimulation with ODN or LPS, along with the expression of several inflammatory and defense genes, suggests that NF-κB-mediated NR_045064 expression and its subsequent impact on transcription of inflammatory and defense genes may be an important component of NF-κB-mediated responses in intestinal epithelium in general. Future studies should investigate the regulation of other genes by NR_045064 and potential significance in inflammatory process. Comprehending the mechanisms of how lncRNAs may modulate dynamic gene transcription through chromatin remodeling could advance our knowledge of the molecular mechanisms of defense responses in many inflammatory and infectious diseases, such as intestinal cryptosporidiosis.
Supplementary Material
Acknowledgments
We thank Ms. Barbara L. Bittner for her assistance in writing the manuscript. The IEC4.1 cells were a gift from Dr. Ping-Chang Yang (McMaster University, Hamilton, Canada).
This work was partially supported by the National Institutes of Health (AI116323 and AI136877) and the Nebraska Cancer and Smoking Disease Research Program (LB595) to XMC and by Grant Number G20RR024001 from the National Center for Research Resources.
Abbreviations:
- ChIP
chromatin immunoprecipitation
- ChIRP
chromatin isolation by RNA purification
- CSF2
colony stimulating factor 2
- IFN-γ
interferon gamma
- IP
Immunoprecipitation
- LincRNAs
long intergenic non-coding RNAs
- LncRNAs
long non-coding RNAs
- LPS
lipopolysaccharide
- MLL
lysine methyltransferase
- NF-κB
nuclear factor-κB
- NO
nitric oxide
- Nos2
inducible nitric oxide synthase 2
- RIP
RNA immunnoprecipitation
- siRNA
small interfering RNA
- TLR
Toll-like receptor
- TNF-α
tumor necrosis factor alpha
- WDR5
WD repeat-containing protein 5
Footnotes
Supplemental Data
Supplemental data include three supplemental tables and one supplemental figure which are available online.
Disclosures
The authors have no financial conflicts of interest.
Potential conflicts of interest: Nothing to report.
References
- 1.Peterson LW, and Artis D. 2014. Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 14: 141–153. [DOI] [PubMed] [Google Scholar]
- 2.Abreu MT, Fukata M, and Arditi M. 2005. TLR signaling in the gut in health and disease. J. Immunol. 174: 4453–4460. [DOI] [PubMed] [Google Scholar]
- 3.Price AE, Shamardani K, Lugo KA, Deguine J, Roberts AW, Lee BL, and Barton GM. 2018. A map of Toll-like receptor expression in the intestinal epithelium reveals distinct spatial, cell type-specific, and temporal patterns. Immunity. S1074–7613(18)30336–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M, Zuk O, Carey BW, Cassady JP, et al. 2009. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature. 458: 223–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Ma S, Ming Z, Gong AY, Wang Y, Chen X, Hu G, Zhou R, Shibata A, Swanson PC, and Chen XM. 2017. A long noncoding RNA, lincRNA-Tnfaip3, acts as a coregulator of NF-κB to modulate inflammatory gene transcription in mouse macrophages. FASEB J. 31: 1215–1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Elling R, Chan J, and Fitzgerald KA. 2016. Emerging role of long noncoding RNAs as regulators of innate immune cell development and inflammatory gene expression. Eur. J. Immunol. 46: 504–512 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Atianand MK, and Fitzgerald KA. 2014. Long non-coding RNAs and control of gene expression in the immune system. Trends Mol. Med. 20: 623–631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Peng X, Gralinski L, Armour CD, Ferris MT, Thomas MJ, Proll S, Bradel-Tretheway BG, Korth MJ, Castle JC, Biery MC, et al. 2010. Unique signatures of long noncoding RNA expression in response to virus infection and altered innate immune signaling. MBio. 1: e00206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Carpenter S, Aiello D, Atianand MK, Ricci EP, Gandhi P, Hall LL, Byron M, Monks B, Henry-Bezy M, Lawrence JB, et al. 2013. A long noncoding RNA mediates both activation and repression of immune response genes. Science. 341: 789–792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hu G, Gong AY, Wang Y, Ma S, Chen X, Chen J, Su CJ, Shibata A, Strauss-Soukup JK, Drescher KM, et al. 2016. LincRNA-Cox2 promotes late inflammatory gene transcription in macrophages through modulating SWI/SNF-mediated chromatin remodeling. J. Immunol. 196: 2799–2808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tong Q, Gong AY, Zhang X, Lin C, Ma S, Chen J, Hu G, and Chen XM. 2016. LincRNA-Cox2 modulates TNFα-induced transcription of Il12b gene in intestinal epithelial cells through regulation of Mi-2/NuRD-mediated epigenetic histone modifications. FASEB J. 30: 1187–1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.O’Hara SP, Huang BQ, Chen XM, Nelson J, and LaRusso NF. 2005. Distribution of Cryptosporidium parvum sporozoite apical organelles during attachment to and internalization by cultured biliary epithelial cells. J. Parasitol. 91: 995–999. [DOI] [PubMed] [Google Scholar]
- 13.Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Wu Y, Sow S, Sur D, Breiman RF, et al. 2013. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 382: 209–222. [DOI] [PubMed] [Google Scholar]
- 14.Checkley W, White AC Jr, Jaganath D, Arrowood MJ, Chalmers RM, Chen XM, Fayer R, Griffiths JK, Guerrant RL, Hedstrom L, et al. 2015. A review of the global burden, novel diagnostics, therapeutics, and vaccine targets for cryptosporidium. Lancet Infect. Dis.15: 85–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.McDonald V, Korbel DS, Barakat FM, Choudhry N, and Petry F. 2013. Innate immune responses against Cryptosporidium parvum infection. Parasite Immunol. 35: 55–64. [DOI] [PubMed] [Google Scholar]
- 16.Laurent F, Kagnoff MF, Savidge TC, Naciri M, and Eckmann L. 1998. Human intestinal epithelial cells respond to Cryptosporidium parvum infection with increased prostaglandin H synthase 2 expression and prostaglandin E2 and F2alpha production. Infect. Immun. 66: 1787–1790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zhou R, Gong AY, Eischeid AN, and Chen XM. 2012. miR-27b targets KSRP to coordinate TLR4-mediated epithelial defense against Cryptosporidium parvum infection. PLoS Pathog. 8: e1002702. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hansen GM, Markesich DC, Burnett MB, Zhu Q, Dionne KM, Richter LJ, Finnell RH, Sands AT, Zambrowicz BP, and Abuin A. 2008. Large-scale gene trapping in C57BL/6N mouse embryonic stem cells. Genome Res. 18: 1670–1679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Selvakumar TA, Bhushal S, Kalinke U, Wirth D, Hauser H, Köster M, and Hornef MW. 2017. Identification of a predominantly interferon-λ-induced transcriptional profile in murine intestinal epithelial Cells. Front. Immunol. 8: 1302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kishore N, Sommers C, Mathialagan S, Guzova J, Yao M, Hauser S, Huynh K, Bonar S, Mielke C, Albee L, et al. 2003. A selective IKK-2 inhibitor blocks NF-kappa B-dependent gene expression in interleukin-1 beta-stimulated synovial fibroblasts. J. Biol. Chem. 278: 32861–32871. [DOI] [PubMed] [Google Scholar]
- 21.Kumar A, Negi G and Sharma SS. 2011. JSH-23 targets nuclear factor-kappa B and reverses various deficits in experimental diabetic neuropathy: Effect on neuroinflammation and antioxidant defence . Diabetes Obes. Metab 13: 750–758. [DOI] [PubMed] [Google Scholar]
- 22.Shin HM, Kim MH, Kim BH, Jung SH, Kim YS, Park HJ, Hong JT, Min KR, and Kim Y. 2004. Inhibitory action of novel aromatic diamine compound on lipopolysaccharide-induced nuclear translocation of NF-κB without affecting IκB degradation. FEBS Lett. 571: 50–54. [DOI] [PubMed] [Google Scholar]
- 23.Zhang XT, Gong AY, Wang Y, Chen X, Lim SYS, Dolata CE, and Chen XM. 2016. Cryptosporidium parvum infection attenuates the ex vivo propagation of murine intestinal enteroids. Physiol. Rep.4: e13060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kapel N, Benhamou Y, Buraud M, Magne D, Opolon P, and Gobert JG. 1996. Kinetics of mucosal ileal gamma-interferon response during cryptosporidiosis in immunocompetent neonatal mice. Parasitol. Res. 82: 664–667. [DOI] [PubMed] [Google Scholar]
- 25.Wang Y, Gong AY, Ma S, Chen X, Li Y, Su CJ, Norall D, Strauss-Soukup JK, and Chen XM. 2017. Delivery of parasite RNA transcripts into infected epithelial cells during Cryptosporidium infection and its potential impact on host gene transcription. J. Infect. Dis. 215: 636–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Niranjanakumari S, Lasda E, Brazas R, and Garcia-Blanco MA. 2002. Reversible cross-linking combined with immunoprecipitation to study RNA-protein interactions in vivo. Methods. 26: 182–190. [DOI] [PubMed] [Google Scholar]
- 27.Chu C, Qu K, Zhong FL, Artandi SE, and Chang HY. 2011. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions. Mol. Cell. 44: 667–678. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Raghavan S, Nyström J, Fredriksson M, Holmgren J, and Harandi AM. 2003. Orally administered CpG oligodeoxynucleotide induces production of CXC and CC chemokines in the gastric mucosa and suppresses bacterial colonization in a mouse model of Helicobacter pylori infection. Infect. Immun. 71: 7014–7022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lacroix-Lamandé S, Rochereau N, Mancassola R, Barrier M, Clauzon A, and Laurent F. 2009. Neonate intestinal immune response to CpG oligodeoxynucleotide stimulation. PLoS One. 4: e8291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ando H, Takamura T, Ota T, Nagai Y, and Kobayashi K. 2000. Cerivastatin improves survival of mice with lipopolysaccharide-induced sepsis. J. Pharmacol. Exp. Ther. 294: 1043–1046. [PubMed] [Google Scholar]
- 31.Costa SG, Barioni ÉD, Ignácio A, Albuquerque J, Câmara NOS, Pavani C, Vitoretti LB, Damazo AS, Farsky SHP, and A. Lino-Dos-Santos-Franco. 2017. Beneficial effects of Red Light-Emitting Diode treatment in experimental model of acute lung injury induced by sepsis. Sci. Rep. 7: 12670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chee ME, Majumder K, and Mine Y. 2017. Intervention of Dietary Dipeptide Gamma-l-Glutamyl-l-Valine (γ-EV) Ameliorates Inflammatory Response in a Mouse Model of LPS-Induced Sepsis. J. Agric. Food. Chem. 65: 5953–5960. [DOI] [PubMed] [Google Scholar]
- 33.Deng M, Lancto CA, and Abrahamsen MS. 2004. Cryptosporidium parvum regulation of human epithelial cell gene expression. Inter. J. Parasitol. 34: 73–82. [DOI] [PubMed] [Google Scholar]
- 34.Yang YL, Serrano MG, Sheoran AS, Manque PA, Buck GA, and Widmer G. 2009. Over-expression and localization of a host protein on the membrane of Cryptosporidium parvum infected epithelial cells. Mol. Biochem. Parasitol. 168: 95–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Chen XM, Levine SA, Splinter PL, Tietz PS, Ganong AL, Jobin C, Gores GJ, Paya CV, and LaRusso NF. 2001. Cryptosporidium parvum activates nuclear factor kappaB in biliary epithelia preventing epithelial cell apoptosis. Gastroenterol. 120: 1774–1783. [DOI] [PubMed] [Google Scholar]
- 36.Chen XM, O’Hara SP, Nelson JB, Splinter PL, Small AJ, Tietz PS, Limper AH, and LaRusso NF. 2005. Multiple TLRs are expressed in human cholangiocytes and mediate host epithelial defense responses to Cryptosporidium parvum via activation of NF-kappaB. J. Immunol. 175: 7447–7456. [DOI] [PubMed] [Google Scholar]
- 37.Kast C, Wang M, and Whiteway M. 2003. The ERK/MAPK pathway regulates the activity of the human tissue factor pathway inhibitor-2 promoter. J. Biol. Chem. 278: 6787–6794. [DOI] [PubMed] [Google Scholar]
- 38.Musikacharoen T, Matsuguchi T, Kikuchi T, and Yoshikai Y. 2001. NF-kappa B and STAT5 play important roles in the regulation of mouse Toll-like receptor 2 gene expression. J. Immunol. 166: 4516–4524. [DOI] [PubMed] [Google Scholar]
- 39.Edmunds JW, Mahadevan LC, and Clayton AL. 2008. Dynamic histone H3 methylation during gene induction: HYPB/Setd2 mediates all H3K36 trimethylation. EMBO J. 27: 406–420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM, Strein C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM, et al. 2012. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149: 1393–1406. [DOI] [PubMed] [Google Scholar]
- 41.Lai B Lee J, Jang Y, Wang L, Peng W, and Ge K. 2017. MLL3/MLL4 are required for CBP/p300 binding on enhancers and super-enhancer formation in brown adipogenesis. Nuc. Acids Res. 45: 6388–6403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Tran UM, Rajarajacholan U, Soh J, Kim TS, Thalappilly S, Sensen CW, and Riabowol K. 2015. LincRNA-p21 acts as a mediator of ING1b-induced apoptosis. Cell Death Dis. 6: e1668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Alam T, Medvedeva YA, Jia H, Brown JB, Lipovich L, and Bajic VB. 2014. Promoter analysis reveals globally differential regulation of human long non-coding RNA and protein-coding genes. PLoS One. 9: e109443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Barsyte-Lovejoy D, Lau SK, Boutros PC, Khosravi F, Jurisica I, Andrulis IL, Tsao MS, and Penn LZ. 2006. The c-Myc oncogene directly induces the H19 noncoding RNA by allele-specific binding to potentiate tumorigenesis. Cancer Res 66: 5330–5337. [DOI] [PubMed] [Google Scholar]
- 45.Bolouri H, and Ruzzo WL. 2012. Integration of 198 ChIP-seq datasets reveals human cis-regulatory regions. J. Comput. Biol. 19: 989–997. [DOI] [PubMed] [Google Scholar]
- 46.Joung J, Engreitz JM, Konermann S, Abudayyeh OO, Verdine VK, Aguet F, Gootenberg JS, Sanjana NE, Wright JB, Fulco CP, et al. 2017. Genome-scale activation screen identifies a lncRNA locus regulating a gene neighbourhood. Nature. 548: 343–346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Engreitz JM, Haines JE, Perez EM, Munson G, Chen J, Kane M, McDonel PE, Guttman M, and Lander ES. 2016. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature. 539: 452–455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Hu X, Feng Y, Zhang D, Zhao SD, Hu Z, Greshock J, Zhang Y, Yang L, Zhong X, Wang LP, et al. 2014. A functional genomic approach identifies FAL1 as an oncogenic long noncoding RNA that associates with BMI1 and represses p21 expression in cancer. Cancer Cell. 26: 344–357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Chow JC, Ciaudo C, Fazzari MJ, Mise N, Servant N, Glass JL, Attreed M, Avner P, Wutz A, Barillot E, et al. 2010. LINE-1 activity in facultative heterochromatin formation during X chromosome inactivation. Cell. 141: 956–969. [DOI] [PubMed] [Google Scholar]
- 50.Shilatifard A 2012. The COMPASS Family of Histone H3K4 Methylases: Mechanisms of Regulation in Development and Disease Pathogenesis. Annu. Rev. Biochem. 81: 65–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Takahashi YH, Westfield GH, Oleskie AN, Trievel RC, Shilatifard A, and Skiniotis G. 2011. Structural analysis of the core COMPASS family of histone H3K4 methylases from yeast to human. Proc. Natl. Acad. Sci. USA. 108: 20526–20531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Wang P, Lin C, Smith ER, Guo H, Sanderson BW, Wu M, Gogol M, Alexander T, Seidel C, Wiedemann LM, Ge K, Krumlauf R, and Shilatifard A. 2009. Global analysis of H3K4 methylation defines MLL family member targets and points to a role for MLL1-mediated H3K4 methylation in the regulation of transcriptional initiation by RNA polymerase II. Mol. Cell Biol. 29: 6074–6085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Mishra BP, Ansari KI, and Mandal SS. 2009. Dynamic association of MLL1, H3K4 trimethylation with chromatin and Hox gene expression during the cell cycle. FEBS J. 276:1629–1640. [DOI] [PubMed] [Google Scholar]
- 54.Brown JA, Kinzig CG, DeGregorio SJ, and Steiz. JA 2016. Methyltransferase-like protein 16 binds the 3’-terminal triple helix of MALAT1 long noncoding RNA. Proc. Natl. Acad. Sci. USA. 113: 14013–14018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Brown JA, Valenstein ML, Yario TA, Tycowski KT, and Steitz JA. 2012. Formation of triple-helical structures by the 3’-end sequences of MALAT1 and MENβ noncoding RNAs. Proc. Natl. Acad. Sci. USA. 109: 19202–19207. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
