Abstract
Bacterial adhesins mediate the attachment and biofilm production leading to the persistence of colonized strains. The aim of this study was evaluation of the association of surface adhesin genes with the biofilm formation among Klebsiella oxytoca isolates. Among 50 isolates of K. oxytoca from patients with antibiotic-associated diarrhoea, the susceptibility test, MIC (according to CLSI 2016) and phenotypic biofilm formation (with microtitre tissue-plate assay) were performed. The presence of adhesins was investigated using PCR. Thirty-three (66%) isolates produced moderate-level biofilms, but none of them exhibited strong biofilm formation. The presence of adhesins was as follows: fimA, 60% (n = 30), mrkA, 42% (n = 21), matB, 96% (n = 48) and pilQ, 92% (n = 46). The biofilm formation was related to the presence of fimA (odds ratio (OR) 0.8571, 95% CI 1.733–6.267, p <0.0001), mrkA (OR 0.2462, 95% CI 2.723–4.622, p 0.001), matB (OR 0.4521, 95% CI 1.353–5.332, p 0.008) and pilQ (OR 0.1481, 95% CI 1.691–6.117, p <0.0001). The npsB toxin-encoding gene was detected among 46 (92%) isolates. Resistance to non-β-lactam antibiotics was significantly associated with the presence of adhesin-encoding genes. The presence of adhesins and the capsular encoding gene was significantly associated with biofilm formation among K. oxytoca isolates. The presence of surface adhesin-encoding genes was significantly associated with the biofilm formation and also with resistance to non-β-lactam antibiotics among K. oxytoca clinical isolates. In addition, biofilm production was not significantly associated with β-lactam resistance among the isolates.
Keywords: Adhesins, antibiotic resistance, biofilms, Klebsiella oxytoca
Introduction
Klebsiella oxytoca is one of the agents causing antibiotic-associated haemorrhagic colitis [1], [2]. On the other hand, Klebsiella spp. produce biofilms via several types of adhesive structures [3] found in both Klebsiella pneumoniae and K. oxytoca, mostly including capsule, and type 1 and type 3 fimbria. The type 3 fimbria subunit proteins constitute the major bacterial adhesins encoded by the mrkABCDF (mannose-resistance adhesins of Klebsiella spp.) genes, among which mrkA and mrkD are the main subunits and attachment subunits, respectively [4]. The type 3 fimbrial genes are encoded by chromosomal, conjugative plasmids and transposons [5], [6], [7], [8]. These binding structures have been mainly detected among biofilm producer isolates. The mrkD subunit contains sequence variations among isolates due to mutations in this region [9]. The attachment of K. oxytoca isolates to the epithelial cells leads to biofilm formation and persistence of infection, or difficulty in eradication of the infection. The relation of adhesive genes and the antibiotic resistance pattern of isolates has not been fully revealed [10]. The toxin-producing isolates are identified by the cell culture and PCR amplification of related npsA and npsB genes [11], [12]. Screening of biofilm-associated genes and evaluation of their relation to the biofilm formation would help decisions on eradication of biofilm-related infections.
In recent years, isolates with resistance to third- and fourth-generation cephalosporins have spread around the world. These isolates produce extended-spectrum β-lactamases. In addition, isolates expressing extended-spectrum β-lactamases have shown multiple resistance to fluoroquinolones and aminoglycosides. In addition, carbapenemase enzymes cause difficulty in infection eradication in K. oxytoca [13], [14]. The purpose of this study was to evaluate the relationship between biofilm formation and the presence of surface adhesin genes in K. oxytoca.
Materials and methods
A total of 50 K. oxytoca were isolated from faecal samples from hospitalized patients with haemorrhagic colitis during 2013–2016. The isolates were inoculated onto MacConkey and blood agar media (Merk, Darmstadt, Germany) and identified with biochemical and molecular (amplification of pehX gene) tests.
The susceptibility of isolates was implemented with the Kirby Bauer method. For each isolate, a bacterial suspension equal to the turbidity of half McFarland was prepared and spread on Müller–Hinton agar medium (Merk, Germany). The plates were observed with the naked eye and the zones were interpreted during 18–22 h. The phenotypic extended-spectrum β-lactamases and carbapenemase production was investigated with combined disc and Carba-NP tests, respectively, according to the CLSI 2016 advice [15].
The MIC for ceftazidime, cefotaxime and imipenem were investigated using the agar dilution method (Sigma Aldrich, St Louis, MO, USA). Briefly, a bacterial suspension equal to the opacity of the half McFarland standard was prepared and 10 μL was inoculated onto Müller–Hinton agar containing dilutions of antibiotics. After culture, plates were incubated for 18–24 h. Any spotted growth was considered a positive result.
The phenotypic biofilm formation was assessed with a microtitre tissue-plate assay using 96-well plates according to previous publications. Each isolate was cultured in trypticase soy broth for 24 h, then diluted 1:100 and 20 μL was used to inoculate into 180 μL trypticase soy broth in each well of a 96-well plate (in triplicate for each isolate) and incubated overnight. The wells were washed and 10% crystal violet (volume/volume) was added for the staining of precipitated and attached cells for 15 min. Next, the wells were washed with sterile distilled water and methanol (99%) was used for fixation of biofilms; the plate was left to dry for up to 24 h. Thereafter, the biofilms were solubilized with 96% ethanol and assessed under the ELISA reader at an OD for 490 nm [16], [17], [18]. For measurement of biofilm formation, the test OD was compared with the control OD (ODc); where OD>4×ODc means strong biofilm formation, 2×ODc<OD≤4×ODc means moderate biofilm formation, ODc<OD≤2×ODc means weak biofilm formation and OD ≤ 0.08324 means no biofilm formation [19].
The PCR was applied to amplify the fimA-, mrkA-, matB-, pilQ- and pilL-encoding adhesins and the npsB toxin-encoding gene for which specific primers (TAKARA, Seoul, South Korea; Table 1) were designed in this study. For the amplification of genes, the thermal profile included 94°C for 4 min, 30 cycles of 94°C for 30 s, annealing temperature (Table 1) for 30 s, 72°C for 30 s and a final extension of 72°C for 10 min.
Table 1.
The specific primer sequences used in this study
| Primer | Sequence 5′–3′ | Annealing temperature (°C) | Amplicon (bp) | Reference |
|---|---|---|---|---|
| mrkA | F: CTGGCCGGCGCTACTGCTAAG R: CACCCGGGATGATTTTGTTGG |
60 | 127 | This study |
| fimA | F: GCACCGCGATTGACAGC R: CGAAGGTTGCGCCATCCAG |
59 | 132 | This study |
| matB/ecp | F: GTACTGGGCGGCAACCTTAG R: GTGCCGCTGATGATGGAGAA |
61 | 98 | This study |
| pilL | F: TCTATGCCGCCTCTCCTGAAGTTG R: TCGGCGATAATGACACGGGGATAC |
60 | 150 | This study |
| pilQ | F: TCCGCCAGGCTCCACTTC R: GCTCGCGGGCATCTGAC |
61 | 194 | This study |
| npsB | F: CCCGTTGGCCGCTCATCACCTAT R: GCGCCGCACAATTTCCCTTCCTC |
60 | 470 | This study |
The analysis of data in which the association of adhesin genes and biofilm formation was considered, 95% CI and error <5% (p <0.05) were significant in the unpaired t-test and analysis of variance (anova) test. SPSS software version 21 was used for the data analysis.
Results
Of 50 isolates, the majority were resistant to trimethoprim-sulfamethoxazole and tetracycline (50% and 40%, respectively) and 45 (90%) of them were susceptible to both piperacillin-tazobactam and amikacin. In addition, resistance was observed to ceftazidime (28%), cefepime (20%), cefotaxime (28%), imipenem (18%), meropenem (14%), cefoxitin (26%), gentamicin (16%) and ciprofloxacin (22%). using anova test, resistance to ciprofloxacin, tetracycline, gentamicin, amikacin and trimethoprim-sulfamethoxazole was significantly associated with the presence of all adhesin genes.
Thirty-three (66%) isolates produced moderate-level biofilms, but none of them exhibited strong biofilm formation. There was no significant difference between β-lactam (cephalosporins and carbapenem) resistant and susceptible isolates of K. oxytoca regarding biofilm formation (p >0.05). Fourteen of 16 ciprofloxacin-resistant and seven of eight gentamicin-resistant K. oxytoca produced moderate-level biofilms (p 0.0001, using the anova test).
The presence of adhesins was as follows: fimA (60%, n = 30), mrkA (42%, n = 21), matB (96%, n = 48), and pilQ (92%, n = 46). The biofilm formation was related to the presence of fimA (odds ratio (OR) 0.8571, 95% CI 1.733–6.267, p <0.0001), mrkA (OR 0.2462, 95% CI 2.723–4.622, p 0.001), matB (OR 0.4521, 95% CI 1.353–5.332, p 0.008) and pilQ (OR 0.1481, 95% CI 1.691–6.117, p <0.0001). All the isolates were cytotoxin-positive (npsB gene) K. oxytoca.
The relation of resistance to antibiotics and presence of adhesin genes is depicted in Table 1 and the relation of phenotypic biofilm formation and presence of fimA and mrkD adhesin-encoding genes is shown in Table 2. A significant difference was observed among fimbria adhesins and resistance to non-β-lactam antibiotics (Table 2). Multivariate analysis showed that the presence of fimA, pilQ, matB and mrkA was significantly associated with resistance to ciprofloxacin, tetracycline, gentamicin, amikacin and trimethoprim-sulfamethoxazole.
Table 2.
The rate of resistance to antibiotics related to surface adhesion genes
| Antibiotics | fimA (n = 30) | mrkA (n = 21) | pilQ (n = 46) | matB (n = 48) | p Value |
|---|---|---|---|---|---|
| CAZ | 16 (32%) | 9 (18%) | 16 (32%) | 16 (32%) | 0.212 |
| FEP | 12 (24%) | 7 (14%) | 12 (24%) | 12 (24%) | 0.104 |
| CTX | 15 (30%) | 6 (12%) | 16 (32%) | 15 (30%) | 0.132 |
| IPM | 4 (8%) | 3 (6%) | 4 (8%) | 4 (8%) | 0.195 |
| MEM | 3 (6%) | 3 (6%) | 4 (8%) | 5 (10%) | 0.191 |
| PITZ | 2 (4%) | 2 (4%) | 3 (6%) | 4 (8%) | 0.106 |
| FOX | 12 (24%) | 9 (18%) | 13 (26%) | 12 (24%) | 0.351 |
| AN | 2 (4%) | 1 (2%) | 3 (6%) | 3 (6%) | 0.011 |
| GN | 4 (8%) | 3 (6%) | 5 (10%) | 6 (12%) | 0.002 |
| CP | 10 (20%) | 11 (22%) | 5 (10%) | 12 (24%) | <0.001 |
| TE | 16 (32%) | 14 (28%) | 17 (34%) | 17 (34%) | 0.004 |
| SXT | 20 (40%) | 18 (39%) | 21 (42%) | 21 (42%) | 0.001 |
Abbreviations: CAZ, ceftazidime; FEP, cefepime; CTX, cefotaxime; IPM, imipenem; MEM, meropenem; PITZ, piperacillin-tazobactam; FOX, cefoxitin; AN, amikacin; GN, gentamicin; CP, ciprofloxacin; TE, tetracycline; SXT, tetracycline.
The association of adhesin genes and biofilm formation by K. oxytoca is displayed in Table 3. The analysis demonstrated that there is a relationship between adhesins and biofilm formation (Table 3).
Table 3.
The association of surface adhesion genes with the biofilm formation (one-way analysis of variance)
| Biofilm level | fimA (n = 30) | mrkA (n = 21) | matB (n = 48) | pilQ (n = 46) | p value |
|---|---|---|---|---|---|
| Moderate | 29 (58%) | 19 (38%) | 32 (64%) | 32 (58%) | 0.003 |
| Weak | 1 (2%) | 2 (4%) | 15 (30%) | 13 (26%) | <0.001 |
| No biofilm | 0.00 | 0.00 | 1 (2%) | 1 (2%) | <0.001 |
Discussion
The presence of adhesive structures enables the bacteria to colonize and produce biofilm, and in addition to restrict antibiotic penetration into the cells. Type 1 and type 3 fimbria play a key role in the attachment of Enterobacteriaceae to the host epithelial and endothelial cells [20], [21], [22]. The biofilm formation has been less studied among K. oxytoca isolates. In this study, 33 isolates produced moderate-level biofilm and all were npsB-positive, which is important for colonization in the intestine and for toxin production. Furthermore, the presence of adhesin genes was significantly associated with biofilm formation (p <0.05). As shown, 29 of 30 of fimA-positive isolates, 19 of 21 mrkA-positive isolates, 32 of 48 matB-positive isolates and 32 of 46 fimA-positive isolates produced moderate-level biofilms; however, the gene expression of adhesins is yet to be revealed.
The presence of surface adhesion genes was significantly associated with resistance to the non-β-lactam antibiotics, suggesting the inhibitory role of adhesins in the drugs' infiltration. The presence of adhesion genes was independently associated with resistance to ciprofloxacin, tetracycline, gentamicin and trimethoprim-sulfamethoxazole discs. Several previous studies have shown the relation between resistance to antibiotics and presence of surface adhesive genes. Vuotto et al. showed that antibiotic resistance increases in K. pneumoniae when the isolates grow in biofilm mode [23]. Therefore, it is suggested that these antibiotics should be used with caution in the presence of biofilm formation or in biofilm-related infections.
Another study indicated the role of type 1 and type 3 fimbria of K. pneumoniae in the attachment to the murine urinary tract [20]. It has been shown that K. pneumoniae growth on abiotic and human cell surfaces is mainly mediated by the mrkA gene [24], [25], [26]. Twenty isolates contained all the adhesive genes and 19 of them produced moderate-level biofilms. Furthermore, nine isolates were multidrug-resistant K. oxytoca and could amplify all the adhesin-encoding genes. The results suggested that β-lactam resistance is not associated with the presence of surface adhesive structures, but resistance to other antibiotics is possibly related to these surface adhesins. In contrast, a significant relation was observed between fimA+ mrkA+ and fimA– mrkA– isolates and resistance to tetracycline and trimethoprim-sulfamethoxazole (p 0.0271). Investigation of the expression of the biofilm-related genes by quantitative real-time PCR will be helpful. In addition, more investigations are needed regarding biofilm formation and antibiotic resistance to allow more careful prescription of specific antibiotics.
The results showed the relation between the presence of surface adhesin-encoding genes and biofilm formation and also resistance to non-β-lactam antibiotics among K. oxytoca clinical isolates. In addition, biofilm production was not significantly associated with the β-lactam resistance among the isolates. Bacterial adhesion and colonization is related to biofilm formation and drug resistance, so it is essential to implement the control and prevention plans regarding biofilm-associated infections and eradication of infections.
Transparency declaration
The authors have no conflicts of interest to declare.
Acknowledgements
This study was supported by Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran.
References
- 1.Beaugerie L., Metz M., Barbut F., Bellaiche G., Bouhnik Y., Raskine L. Klebsiella oxytoca as an agent of antibiotic-associated hemorrhagic colitis. Clin Gastroenterol Hepatol. 2003;1:370–376. doi: 10.1053/s1542-3565(03)00183-6. [DOI] [PubMed] [Google Scholar]
- 2.Hoffmann K.M., Deutschmann A., Weitzer C., Joainig M., Zechner E., Högenauer C. Antibiotic-associated hemorrhagic colitis caused by cytotoxin-producing Klebsiella oxytoca. Pediatrics. 2010;125 doi: 10.1542/peds.2009-1751. e960–e3. [DOI] [PubMed] [Google Scholar]
- 3.Alcántar-Curiel M.D., Blackburn D., Saldaña Z., Gayosso-Vázquez C., Iovine N., De la Cruz M.A. Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation. Virulence. 2013;4:129–138. doi: 10.4161/viru.22974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Cheryl-lynn Y.O., Beatson S.A., Totsika M., Forestier C., McEwan A.G., Schembri M.A. Molecular analysis of type 3 fimbrial genes from Escherichia coli, Klebsiella and Citrobacter species. BMC Microbiol. 2010;10:183. doi: 10.1186/1471-2180-10-183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Sebghati T.A.S., Korhonen T.K., Hornick D.B., Clegg S. Characterization of the type 3 fimbrial adhesins of Klebsiella strains. Infect Immun. 1998;66:2887–2894. doi: 10.1128/iai.66.6.2887-2894.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Schembri M.A., Nimmo G.R., Looke D.F., McEwan A.G., Beatson S.A., Webb R.I. Identification of Type 3 fimbriae in Klebsiella spp. J Bacteriol. 2008;190:1054. doi: 10.1128/JB.01523-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Paczosa M.K., Mecsas J. Klebsiella pneumoniae: going on the offense with a strong defense. Microbiol Mol Biol Rev. 2016;80:629–661. doi: 10.1128/MMBR.00078-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ares M.A., Fernández-Vázquez J.L., Rosales-Reyes R., Jarillo-Quijada M., von Bargen K., Torres J. H-NS nucleoid protein controls virulence features of Klebsiella pneumoniae by regulating the expression of type 3 pili and the capsule polysaccharide. Front Cell Infect Microbiol. 2016;6:13. doi: 10.3389/fcimb.2016.00013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Huang Y.-J., Wu C.-C., Chen M.-C., Fung C.-P., Peng H.-L. Characterization of the type 3 fimbriae with different MrkD adhesins: possible role of the MrkD containing an RGD motif. Biochem Biophys Res Commun. 2006;350:537–542. doi: 10.1016/j.bbrc.2006.09.070. [DOI] [PubMed] [Google Scholar]
- 10.Ong C.-L.Y., Ulett G.C., Mabbett A.N., Beatson S.A., Webb R.I., Monaghan W. Identification of type 3 fimbriae in uropathogenic Escherichia coli reveals a role in biofilm formation. J Bacteriol. 2008;190:1054–1063. doi: 10.1128/JB.01523-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Schneditz G., Rentner J., Roier S., Pletz J., Herzog K.A., Bücker R. Enterotoxicity of a nonribosomal peptide causes antibiotic-associated colitis. Proc Natl Acad Sci. 2014;111:13181–13186. doi: 10.1073/pnas.1403274111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gerratana B. Biosynthesis, synthesis, and biological activities of pyrrolobenzodiazepines. Med Res Rev. 2012;32:254–293. doi: 10.1002/med.20212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Moradigaravand D., Martin V., Peacock S.J., Parkhill J. Population structure of multidrug-resistant Klebsiella oxytoca within hospitals across the United Kingdom and Ireland identifies sharing of virulence and resistance genes with K. pneumoniae. Gen Biol Evolut. 2017;9:574–584. doi: 10.1093/gbe/evx019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Simon M., Melzl H., Hiergeist A., Richert K., Falgenhauer L., Pfeifer Y. Colistin-and carbapenem-resistant Klebsiella oxytoca harboring bla VIM-2 and an insertion in the mgrB gene isolated from blood culture. Int J Med Microbiol. 2017;307:113–115. doi: 10.1016/j.ijmm.2017.01.001. [DOI] [PubMed] [Google Scholar]
- 15.Clinical and Laboratory Standards Institute (CLSI) 26th ed. CLSI; Wayne, PA: 2016. Performance standards for antimicrobial susceptibility testing. CLSI supplement M100S. [Google Scholar]
- 16.Babapour E., Haddadi A., Mirnejad R., Angaji S.-A., Amirmozafari N. Biofilm formation in clinical isolates of nosocomial Acinetobacter baumannii and its relationship with multidrug resistance. Asia Pac J Trop Biomed. 2016;6:528–533. [Google Scholar]
- 17.Mirzaee M., Najar Peerayeh S., Ghasemian A.-M. Detection of icaABCD genes and biofilm formation in clinical isolates of methicillin-resistant Staphylococcus aureus. Iran J Pathol. 2014;9:257–262. [Google Scholar]
- 18.DePas W.H., Syed A.K., Sifuentes M., Lee J.S., Warshaw D., Saggar V. Biofilm formation protects Escherichia coli against killing by Caenorhabditis elegans and Myxococcus xanthus. Appl Environ Microbiol. 2014;80:7079–7087. doi: 10.1128/AEM.02464-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Novais Â, Vuotto C., Pires J., Montenegro C., Donelli G., Coque T.M. Diversity and biofilm-production ability among isolates of Escherichia coli phylogroup D belonging to ST69, ST393 and ST405 clonal groups. BMC Microbiol. 2013;13(1):144. doi: 10.1186/1471-2180-13-144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Murphy C.N., Mortensen M.S., Krogfelt K.A., Clegg S. Role of Klebsiella pneumoniae type 1 and type 3 fimbriae in colonizing silicone tubes implanted into the bladders of mice as a model of catheter-associated urinary tract infections. Infect Immun. 2013;81:3009–3017. doi: 10.1128/IAI.00348-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sarkar S., Vagenas D., Schembri M.A., Totsika M. Biofilm formation by multidrug resistant Escherichia coli ST131 is dependent on type 1 fimbriae and assay conditions. Pathog Dis. 2016;74 doi: 10.1093/femspd/ftw013. [DOI] [PubMed] [Google Scholar]
- 22.Reisner A., Maierl M., Jörger M., Krause R., Berger D., Haid A. Type 1 fimbriae contribute to catheter-associated urinary tract infections caused by Escherichia coli. J Bacteriol. 2014;196:931–939. doi: 10.1128/JB.00985-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Vuotto C., Longo F., Balice M.P., Donelli G., Varaldo P.E. Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens. 2014;3:743–758. doi: 10.3390/pathogens3030743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ares M.A., Fernández-Vázquez J.L., Pacheco S., Martínez-Santos V.I., Jarillo-Quijada M.D., Torres J. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: antagonist of H-NS and repressor. PLoS One. 2017;12 doi: 10.1371/journal.pone.0173285. e0173285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ou Q., Fan J., Duan D., Xu L., Wang J., Zhou D. Involvement of cAMP receptor protein in biofilm formation, fimbria production, capsular polysaccharide biosynthesis and lethality in mouse of Klebsiella pneumoniae serotype K1 causing pyogenic liver abscess. J Med Microbiol. 2017;66:1–7. doi: 10.1099/jmm.0.000391. [DOI] [PubMed] [Google Scholar]
- 26.Khater F., Balestrino D., Charbonnel N., Dufayard J.F., Brisse S., Forestier C. In silico analysis of usher-encoding genes in Klebsiella pneumoniae and characterization of their role in adhesion and colonization. PLoS One. 2015;10 doi: 10.1371/journal.pone.0116215. e0116215. [DOI] [PMC free article] [PubMed] [Google Scholar]