Dynein 1 supports spermatid transport and spermiation during spermatogenesis in the rat testis

Qing Wen; Elizabeth I Tang; Wing-yee Lui; Will M Lee; Chris K C Wong; Bruno Silvestrini; C Yan Cheng

doi:10.1152/ajpendo.00114.2018

. 2018 Jul 17;315(5):E924–E948. doi: 10.1152/ajpendo.00114.2018

Dynein 1 supports spermatid transport and spermiation during spermatogenesis in the rat testis

Qing Wen ¹, Elizabeth I Tang ¹, Wing-yee Lui ², Will M Lee ², Chris K C Wong ³, Bruno Silvestrini ⁴, C Yan Cheng ^1,^✉

PMCID: PMC6293164 PMID: 30016153

Abstract

In the mammalian testis, spermatogenesis is dependent on the microtubule (MT)-specific motor proteins, such as dynein 1, that serve as the engine to support germ cell and organelle transport across the seminiferous epithelium at different stages of the epithelial cycle. Yet the underlying molecular mechanism(s) that support this series of cellular events remain unknown. Herein, we used RNAi to knockdown cytoplasmic dynein 1 heavy chain (Dync1h1) and an inhibitor ciliobrevin D to inactivate dynein in Sertoli cells in vitro and the testis in vivo, thereby probing the role of dynein 1 in spermatogenesis. Both treatments were shown to extensively induce disruption of MT organization across Sertoli cells in vitro and the testis in vivo. These changes also perturbed the transport of spermatids and other organelles (such as phagosomes) across the epithelium. These changes thus led to disruption of spermatogenesis. Interestingly, the knockdown of dynein 1 or its inactivation by ciliobrevin D also perturbed gross disruption of F-actin across the Sertoli cells in vitro and the seminiferous epithelium in vivo, illustrating there are cross talks between the two cytoskeletons in the testis. In summary, these findings confirm the role of cytoplasmic dynein 1 to support the transport of spermatids and organelles across the seminiferous epithelium during the epithelial cycle of spermatogenesis.

Keywords: actin, dynein 1, microtubule, ectoplasmic specialization, spermatogenesis, testis

INTRODUCTION

During the epithelial cycle, the timely transport of developing germ cells, most notably spermatids, and cellular organelles (e.g., residual bodies, phagosomes, Golgi apparatus, mitochondria, endocytic vesicles) across the seminiferous epithelium are essential to support the cellular events pertinent to spermatogenesis (33–35, 96). These cellular events include 1) spermatogonial self-renewal via mitosis and also spermatogonial differentiation, 2) meiosis I/II, 3) transformation of spermatids to form elongated spermatids via spermiogenesis, and 4) the release of mature spermatids (i.e., spermatozoa) at spermiation (22, 25, 78). Interestingly, the molecular mechanism(s) that regulate the transport of germ cells and organelles across the seminiferous epithelium to support spermatogenesis remain largely unexplored and unknown (65, 66, 92, 96). Nonetheless, studies in other epithelia from multiple organs have shown that the microtubule (MT)- and actin-based cytoskeletons play a crucial role in supporting cargo transport in mammalian cells (32, 83). The concept that MT- and actin-based cytoskeletons are crucial to confer spermatid and organelle transport is supported by the observations that the networks of MTs and F-actin across the Sertoli cells are remarkably extensive throughout different stages of the epithelial cycle in mammalian testes (54, 67, 86, 89). In fact, studies using different animal models, such as by treating adult rats with the non-hormonal male contraceptive drug adjudin (46, 84), or genetic models in mice by deleting specific genes essential to support cytoskeletal dynamics have also supported this concept. For instance, treatment of adult rats with adjudin [50 mg/kg body weight (b.w.) by oral gavage known to induce reversible male infertility] led to truncation of the actin filaments and MTs across the seminiferous epithelium of the testis. Notably, the tracklike structures conferred by F-actin and in particular MTs that aligned perpendicular to the basement membrane across the seminiferous epithelium in the adjudin-treated rats were grossly disrupted (46, 84). These changes thus led to spermatid exfoliation from the testis since the testis-specific anchoring device known as apical ectoplasmic specialization (apical ES), a testis-specific actin-rich anchoring junction (18, 75, 88, 89), was extensively disrupted following adjudin treatment (46, 84) since adhesion junction proteins at the apical ES utilized F-actin for attachment (17) and are closely supported by MTs (67, 86). However, a considerable number of elongated spermatids were found to remain trapped deep inside the epithelium even though the apical ES in the testis had been grossly disrupted (84). This was due to the loss of MT-conferred tracks to support spermatid transport so that these spermatids could not be released into the tubule lumen. Nonetheless, the biomolecules involved in MT-based transport of spermatids and organelles remain virtually unknown. On the other hand, specific deletion of either neuronal Wiskott-Aldrich syndrome protein (N-WASP) (73, 95) [Note: N-WASP together with the actin-related protein 2/3 (Arp2/3) complex support F-actin barbed-end branched nucleation (3)] or A-kinase anchor protein 9 [AKAP-9, a signaling protein that regulates MT dynamics (23)] (87) in Sertoli cells in mice that inactivated cytoskeletal dynamics also led to male infertility.

Studies have shown that cytoplasmic dynein 1, an MT-specific motor protein, directs cargo transport along the MT-based tracks to the MT minus end (i.e., slow growing end) in multiple epithelia (6, 12). However, the role of dynein 1 to support spermatid and organelle transport during spermatogenesis is unknown. Herein, we examined the involvement of dynein 1 in the transport of spermatids and organelles across the epithelium in supporting spermatogenesis. Besides its role in conferring MT function, dynein 1 was also found to support the proper organization of actin microfilaments in Sertoli cells in vitro and in the seminiferous epithelium in vivo, illustrating that the integrity of F-actin network is also dependent on MTs. This thus demonstrates that the MT- and actin-based cytoskeletons are intimately involved in supporting spermatogenesis.

MATERIALS AND METHODS

Animals and ethics statement.

Adult male Sprague-Dawley rats (280–300 g b.w. at ~60 days of age) or male pups at 16–18 days of age were purchased from Charles River Laboratories (Kingston, NY). Rats were housed at the Rockefeller University Comparative Bioscience Center in accordance with the applicable portions of the Animal Welfare Act and the guidelines in the Department of Health and Human Services publication Guide for the Care and Use of Laboratory Animals. Also, the use of animals for experiments reported herein was approved by the Rockefeller University Institutional Animal Care and Use Committee with Protocol Numbers 12–506-H and 15–780-H. Studies involving the use of small interfering RNA (siRNA) duplexes for applicable in vitro and in vivo experiments was approved by Rockefeller University Institutional Biosafety Committee (Approval No. 2–15–04–007). All rats were euthanized by CO₂ asphyxiation using slow (20%~30%/min) displacement of chamber air with compressed carbon dioxide using a euthanasia chamber with a built-in carbon dioxide regulator approved by the Rockefeller University Laboratory Safety and Environmental Health.

Antibodies.

Antibodies used for various experiments reported here were obtained commercially except as otherwise specified. The Resource Identification Initiative numbers of all antibodies were included in Table 1 for different experiments.

Table 1.

Antibodies used for different experiments in this report

				Working Dilution
Antibody (RRID No.)	Host Species	Vendor	Catalog No.	IB; IF
Dync1h1(AB_2093483)	Rabbit	Santa Cruz Biotechnology	sc-9115	1:200; 1:50
Dia (AB_2092924)	Goat	Santa Cruz Biotechnology	sc-10885	1:200; -
EB1 (AB_397891)	Mouse	BD Biosciences	610534	-; 1:200
Katanin p80 (AB_10918793)	Rabbit	Santa Cruz Biotechnology	sc-292216	1:200; -
Mark4 (AB_2140610)	Rabbit	Cell Signaling Technology	48345	1:500; -
ZO-1 (AB_2533938)	Rabbit	Invitrogen	61–7300	1:250; 1:100
Occludin (AB_2533977)	Rabbit	Invitrogen	71–1500	1:250; 1:100
CAR (AB_2087557)	Rabbit	Santa Cruz Biotechnology	sc-15405	1:200; 1:50
JAM-A (AB_2533241)	Rabbit	Invitrogen	36–1700	1:250; -
N-cadherin (AB_2313779)	Mouse	Invitrogen	33–3900	-; 1:100
N-cadherin (AB_647794)	Rabbit	Santa Cruz Biotechnology	sc-7939	1:200; -
β-catenin (AB_2533982)	Rabbit	Invitrogen	71–2700	1:250; 1:100
Filamin A (AB_2106406)	Rabbit	Santa Cruz Biotechnology	sc-28284	1:200; -
Arp3 (AB_476749)	Mouse	Sigma-Aldrich	A-5979	1:3,000; 1:50
Eps8 (AB_397544)	Mouse	Invitrogen	610143	1:5,000; 1:50
Palladin (AB_2158782)	Rabbit	Proteintech Group	10853–1-AP	1:1,000; 1:50
Formin 1 (AB_2105244)	Mouse	Abcam	ab-68058	1:500; -
N-WASP (AB_2288632)	Rabbit	Santa Cruz Biotechnology	sc-20770	1:200; -
β1-integrin (AB_2130101)	Rabbit	Santa Cruz Biotechnology	sc-8978	-; 1:50
α-tubulin (AB_2241126)	Mouse	Abcam	ab-7291	1:1,000; 1:200
Detyrosinated α-tubulin (AB_869990)	Rabbit	Abcam	ab-48389	-; 1:200
β-tubulin (AB_2210370)	Rabbit	Abcam	ab-6046	-; 1:200
Tyrosinated tubulin (AB_305328)	Rat	Abcam	ab-6160	-; 1:200
Acetylated α-tubulin (AB_448182)	Mouse	Abcam	ab-24610	-; 1:200
Actin (AB_630836)	Goat	Santa Cruz Biotechnology	sc-1616	1:200; -
Vimentin (AB_628437)	Mouse	Santa Cruz Biotechnology	sc-6260	1:200; 1:200
GAPDH (AB_2107448)	Mouse	Abcam	ab-8245	1:1,000; -
Laminin γ3 (AB_2636817)	Rabbit	Cheng Laboratory (97)		-; 1:200
Goat IgG-HRP (AB_634811)	Bovine	Santa Cruz Biotechnology	sc-2350	1:3,000; -
Rabbit IgG-HRP (AB_634837)	Bovine	Santa Cruz Biotechnology	sc-2370	1:3,000; -
Mouse IgG-HRP (AB_634824)	Bovine	Santa Cruz Biotechnology	sc-2371	1:3,000; -
Rabbit IgG-Alexa Fluor 488 (AB_2576217)	Goat	Invitrogen	A-11034	-; 1:250
Rabbit IgG-Alexa Fluor 555 (AB_2535850)	Goat	Invitrogen	A-21429	-; 1:250
Mouse IgG-Alexa Fluor 488 (AB_2534088)	Goat	Invitrogen	A-11029	-; 1:250
Mouse IgG-Alexa Fluor 555 (AB_141780)	Goat	Invitrogen	A-21424	-; 1:250
Rat IgG-Alexa Fluor 488 (AB_141373)	Goat	Invitrogen	A-11006	-; 1:250

Open in a new tab

Antibodies used herein cross react with the corresponding proteins in rat as noted by the corresponding manufacturer. Abcam, Cambridge, MA; BD Biosciences, San Jose, CA; Cell Signaling Technology, Danvers, MA; IB, immunoblotting; IF, immunofluorescence analysis; Invitrogen, Life Technologies, Carlsbad, CA; Proteintech Group, Chicago, IL; RRID, Research Resource Identifiers; Santa Cruz Biotechnology, Santa Cruz, CA; Sigma-Aldrich, St. Louis, MO.

Isolation and primary Sertoli cell cultures.

Sertoli cells isolated using 20-day-old-rat testes were used for primary cultures as earlier described (62). These cells were differentiated and similar to Sertoli cells isolated from adult rat testes both functionally and morphologically as earlier reported (45, 57). Freshly isolated Sertoli cells were seeded on Matrigel-coated (BD Biosciences, San Jose, CA) culture dishes (either 6-, 12-, or 24-well), coverslips (placed in 12-well dishes), and bicameral units (Millipore, Billerica, MA; placed in 24-well dishes) at a density 0.3~0.4, 0.03~0.04, and 1.0 × 10⁶ cells/cm², respectively. Residual germ cells were lysed by a hypotonic treatment using 20 mM Tris (pH 7.4 at 22°C for 2 min) as described (27, 62). Sertoli cells were cultured in serum-free DMEM/F-12 (Sigma-Aldrich, St. Louis, MO) medium supplemented with growth factors and gentamicin in a humidified atmosphere of 95% air-5% CO₂ (vol/vol) at 35°C (62). For 6- and 12-well dishes, each well contained 5 and 3 ml F12/DMEM medium for specific biochemical assays or for immunoblottings (IB). For immunofluorescence (IF), each well (with Sertoli cells cultured on a coverslip) contained 2 ml F12/DMEM. For bicameral units placed in 24-well dishes, the apical and the basal chamber contained 0.5 ml F12/DMEM. All media were supplemented with growth factors [bovine insulin (10 µg/ml), human transferrin (5 µg/ml), EGF (2.5 ng/ml), bacitracin (5 µg/ml), and gentamicin (20 µg/ml)] as described (62). These Sertoli cell cultures were used for experiments on day 3 with an established function tight junction (TJ)-permeability barrier, and ultrastructures of TJ, basal ES, gap junction, and desmosome that mimicked the Sertoli cell blood-testis barrier (BTB) in vivo were also detected as earlier described (47, 53, 82), consistent with earlier reports by others (11, 38). In fact, this in vitro system has been widely used to study Sertoli cell BTB dynamics by others (16, 24, 40, 64, 70). These Sertoli cell cultures were >98% pure with negligible contamination of germ cells, Leydig cells, and/or peritubular myoid cells using corresponding primer pairs for specific cell markers by PCR as described (44).

Knockdown of Dync1h1 by RNA interference or an inactivation of dynein by inhibitor ciliobrevin D in Sertoli cells cultured in vitro.

Dynein 1 heavy chain (Dync1h1) was silenced by RNA interference (RNAi), or dynein was inhibited by ciliobrevin D [Calbiochem, Millipore; Cat. No. 250401, a reversible and specific blocker of AAA+ (ATPases associated with diverse cellular activities) ATPase motor cytoplasmic dynein] in Sertoli cells to assess their effects on Sertoli cell function. In brief, Sertoli cells cultured alone with an established functional TJ-permeability barrier were used on day 3 for transfection with Dync1h1-specific siRNA duplexes (Dync1h1 RNAi) versus non-targeting negative control (Ctrl RNAi) siRNA duplexes (Table 2) for RNAi experiments. siRNA duplexes were obtained from Dharmacon/Thermo Fisher Scientific. siRNA duplexes were used at 100 nM (for IB, IF, and polymerization/spin-down assay) using RNAiMAX (Life Technologies, Carlsbad, CA) as a transfection reagent for 24 h, as described (50). Thereafter, cells were used for RNA extraction for analysis by qPCR (day 4). For IF, IB, or spin-down/polymerization assay, cells were rinsed twice and replaced with fresh F12/DMEM and cultured for an additional 24 h until day 5 before termination. For cultures to be used for IF, cells were co-transfected with 1 nM siGLO red transfection indicator (Dharmacon) to track successful transfection. In short, successfully transfected Sertoli cells with siRNA duplexes had red fluorescence located close to cell nuclei, and it was noted routinely that over 95% of the cells were successfully transfected. For experiments involving dynein inhibition, Sertoli cells cultured on day 4 were treated with 15 µM (or 30 µM for experiments to monitor the TJ-barrier function) versus 0.03% (vol/vol) DMSO for 1 h. Thereafter, cells were used for IF, IB, or spin-down/polymerization assays. In each experiment, replicates or triplicates were used for each treatment versus control groups. Each experiment reported herein was based on analysis of n = 3 independent experiments using different batches of Sertoli cells.

Table 2.

siRNA duplexes used for RNAi experiments

Gene	Product	Cat. No.	Target Sequences (5′-3′)	Targeted Region
Dync1h1	ON-TARGETplus rat Dync1h1 (29489) siRNA-SMARTpool	L-080024–02	`AAUUCAAGCUGGCGUGCAA`	ORF
			`GAGCAGAGCUGGGCGAGUA`	ORF
			`GGUCCAAGAAAUACGAAUU`	ORF
			`GCUCAGGAUUGACAGGAUA`	ORF
Non-Target	ON-TARGETplus Non-targeting Pool siRNA duplexes	D-001810–10	`UGGUUUACAUGUCGACUAA`
			`UGGUUUACAUGUUGUGUGA`
			`UGGUUUACAUGUUUUCUGA`
			`UGGUUUACAUGUUUUCCUA`

Open in a new tab

Knockdown of Dync1h1 or inactivation of dynein by inhibitor ciliobrevin D in adult rat testes in vivo.

Dync1h1 was silenced in adult rat (~280–300 g b.w.) testes in vivo by transfecting testes with Dync1h1 siRNA duplexes versus non-targeting control using Polyplus in vivo-jetPEI (Polyplus-transfection S.A., Illkirch, France) as a transfection reagent according to manufacturer’s instructions as described (28, 58). In brief, siRNA duplexes (500 nM) and siGLO red transfection indicator (Dharmacon; 20 nM) were constituted in 100 µl of transfection solution containing 1.7 µl in vivo-jetPEI (an adult rat testis was at ~1.6 g in weight, with a volume of ~1.6 ml) according to manufacturer’s recommendations with N/P = 8. N/P ratio was a measure of the ionic balance of the plasmid DNA, referring to the number of nitrogen (N) residues of jetPEI/nucleotide phosphate (P), in which the jetPEI concentration was expressed in nitrogen residues molarity in which 1 µg of plasmid DNA contained 3 nmol of anionic phosphate. The transfection solution in 100 µl was administered to each testis using a 28-gauge, 13-mm needle attached to a 0.5-ml insulin syringe. Transfection efficiency was estimated to be ~50%–60% as this was confirmed by the presence of >10 siGLO red fluorescence aggregates in the seminiferous epithelium of a tubule as earlier reported (29). However, this might have been an underestimate, since if the epithelium cross-section of a tubule had ~6–7 siGLO red fluorescence aggregates, it was not counted as a positively transfected tubule. As such, the percent of tubules that had diminished Dync1h1 fluorescence was >70% routinely in our experiments. For dynein inhibition, ciliobrevin D (500 µM) was constituted in 100 µl DMSO [such that the final DMSO concentration was at 0.03% in saline (vol/vol), i.e., DMSO in 0.9% NaCl, in Millipore MilliQ water (wt/vol)], and ciliobrevin D was used at 15 µM per testis (assuming a testis volume of ~1.6 ml at 1.6 g). The needle was inserted from the apical to the basal end of the testis vertically in which the left testis was transfected with the Dync1h1 siRNA duplexes or inhibitor ciliobrevin D versus the right testes transfected with the negative non-targeting control siRNA duplexes or DMSO [in 0.9% NaCl in MilliQ water (wt/vol)]. As the needle was withdrawn apically, transfection/inhibition solution was gently released and gradually filled the entire testis to avoid an acute rise in intratesticular hydrostatic pressure. Transfection was performed on days 1, 2, and 3 (triple transfections, n = 2 rats), and in some experiments, transfection or inhibition was performed on days 1, 3, and 5 (triple transfections, n = 7 rats). Rats were euthanized on day 5 (n = 2 rats) or day 7 (n = 7 rats), respectively. Testes were removed immediately after rats were euthanized and frozen in liquid nitrogen or fixed in modified Davidson’s fixative or Bouin’s fixature for their subsequent use (42, 43). Since the phenotypes in these two groups of rats were similar, data from both sets of experiments were pooled for analysis with n = 9 rats.

Assessment of Sertoli cell TJ-permeability barrier in vitro.

Sertoli cells cultured in vitro on Matrigel-coated bicameral units (diameter 12 mm, pore size 0.45 µm, effective surface area 0.6 cm²; EMD Millipore) at 1.0 × 10⁶ cells/cm² were used for quantifying the transepithelial electrical resistance in ohms (Ω) across the cell epithelium to assess the TJ-barrier function as described (62, 91). In brief, each bicameral unit was placed inside the well of a 24-well dish with 0.5 ml F12/DMEM in the apical and the basal compartments. Dync1h1 was knocked down or dynein was inhibited in Sertoli cells on days 3 and 4 using specific siRNA versus non-targeting negative control duplexes at 100 nM for 16 h or ciliobrevin D at 15 µM or 30 µM for 1hr, and Sertoli cell TJ-permeability barrier function was monitored daily by quantifying transepithelial electrical resistance across the cell epithelium (62). In each experiment, each treatment and control group had quadruple bicameral units. Each experiment was repeated thrice with a total of n = 3 independent experiments using different batches of Sertoli cells, excluding pilot experiments to test the optimal concentrations of siRNA duplexes.

BTB integrity assay.

The BTB integrity was assessed as earlier described (29) by using a membrane-impermeable biotinylation reagent, EZ-LinkSulfo-NHS-LC-Biotin (Thermo Fisher Scientific, Waltham, MA). In brief, adult male rats (n = 3, 270~300 g b.w.) transfected with siRNA duplexes or administered with inhibitor as described above (thrice, on day 1, 3, and 5) were anesthetized by ketamine HCl (60 mg/kg b.w. administered im) with xylazine as an analgesic (6–10 mg/kg b.w. administered im; Sigma Aldrich) on day 7. For positive control, rats received CdCl₂ (3 mg/kg b.w. ip) on day 1 and terminated on day 5, which is known to induce irreversible BTB disruption (94). Rats that received no treatment served as negative controls. EZ-Link Sulfo-NHS-LC-Biotin, a membrane-impermeable biotinylation reagent, freshly diluted in 100 μl PBS at 10 mg/ml containing 1 mM CaCl₂ was loaded under the tunica albuginea via a 29-gauge needle. Biotinylation reagent diffused across the entire testis to biotinylate proteins in virtually all seminiferous tubules in 30 min. Thereafter, rats were euthanized by CO₂ asphyxiation, and testes were removed and snap-frozen in liquid nitrogen. About 7 μm-thick cross sections were then obtained in a cryostat at −22°C, fixed in 4% paraformaldehyde (PFA) in PBS (10 mM sodium phosphate, 0.15 M NaCl, pH 7.4 at 22°C) (wt/vol) for 10 min, followed by an incubation with Alexa Fluor 488-streptavidin (Life Technologies, 1:250) for 30 min, and also co-stained with 4’,6-diamidino-2-phenylindole (DAPI; Sigma) to visualize cell nuclei. Samples were mounted in Prolong Gold Antifade reagent (Invitrogen, Life Technologies). To obtain semiquantitative data for the assessment of BTB integrity and for statistical analysis, the distance (D) traveled by the biotin (D_Biotin) from the basement membrane in the seminiferous tubule versus the radius of a tubule (D_Radius) was recorded. For an oblique section, the radius of the tubule was estimated by the mean of the longest and the shortest radii. Approximately 200 randomly selected tubules from each testis of n = 3 rats (i.e., 600 tubules in total) were analyzed for treatment versus control groups.

MT spin-down assay.

MT spin-down assay was performed as described (49, 85) to estimate the relative level of polymerized MTs versus free tubulins in Sertoli cell or testis lysates following Dync1h1 RNAi or treatment with dynein inhibitor ciliobrevin D according to the manufacturer’s protocols (Cat No. BK-038, Cytoskeleton, Denver, CO). In brief, Sertoli cells or testis samples were homogenized in 37°C prewarmed lysis and MT stabilization buffer with a 25-gauge syringe needle. Lysates were precleared by centrifugation at 2,000 g for 5 min at 37°C to remove cellular debris, followed by centrifugation at 100,000 g at 37°C for 30 min to separate polymerized tubulins/MTs (pellet) from tubulin monomers (supernatant). Supernatant was collected, and pellet was resuspended in 250 µl of MilliQ water containing 2 mM CaCl₂. Cell lysates, pellet, and supernatant were then used for IB. Paclitaxel (20 µM, also known as Taxol, an MT stabilizing agent) versus CaCl₂ (2 mM, an MT depolymerization agent) was used, suggested by the manufacturer, to serve as the corresponding positive and negative controls. Each experiment was performed with n = 3 independent assays, which yielded similar results.

Tubulin polymerization assay.

Tubulin polymerization assay was performed to assess the ability of Sertoli cell lysate [in a Tris-based lysis buffer (50, 51)] following Dync1h1 RNAi or dynein 1 inactivation using ciliobrevin D versus the corresponding controls to polymerize tubulin oligomers (i.e., α- and β-tubulins) in vitro according to manufacturer’s instructions (Cat No. BK-011-P, Cytoskeleton). In brief, Sertoli cell lysates in 5 µl (containing ~10–20 µg total protein) were incubated with 50 µl of tubulin reaction mix at 2 mg/ml tubulin and 15% glycerol in a Corning 96-well black flat-bottom polystyrene microplate (Corning, Lowell, MA,), wherein polymerized α-/β-tubulin oligomers had high affinity to DAPI (10). Fluorescence kinetics were monitored from top to quantify DAPI-labeled MTs in a FilterMax F5 Multi-Mode Microplate Reader and the Multi-Mode Analysis Software 3.4 (Molecular Devices, Sunnyvale, CA) at 37°C (fluorimeter settings, measurement type: kinetics, 100 cycles, 20 s interval; excitation wavelength: 360 nm; emission wavelength: 430 nm; integration time: 0.25 ms). Tubulin polymerization rate assessed by fluorescence intensity increase rate was obtained by linear regression analysis using Microsoft Excel 2016 (Microsoft, Redmond, WA). Paclitaxel (3 µM, an MT stabilizing agent) versus CaCl₂ (0.5 mM, an MT destabilizing agent) was used as the corresponding positive and negative controls.

F-actin spin-down assay.

The relative ratio of F-G actin in Sertoli cells following Dync1h1 RNAi or dynein inhibition by ciliobrevin D (15 µM) was assessed using a kit (Cat No. BK-037, Cytoskeleton) according to the manufacturer’s instructions with minor modifications. In brief, Sertoli cells (~500 µg protein from a single well of a 6-well dish at 0.4 × 10⁶ cells/cm²) were homogenized in F-actin stabilization buffer, precleared by centrifugation at 350 g for 5 min at room temperature to remove cell debris. This was followed by centrifugation at 100,000 g at 37°C for 1 h to separate F-actin from G-actin. Supernatant (~2 ml, containing G-actin) was collected, and pellet (containing F-actin) was resuspended in 300 µl 8 M urea. Thereafter, 60 µl of supernatant and 60 µl of pellet of each sample were analyzed by IB for β-actin. Phalloidin (0.1 µM, actin stabilizing agent) versus urea (80 mM, actin depolymerization agent) were used as the corresponding positive and negative controls. This thus assessed any changes in the relative ratio of F-actin incorporated into the cytoskeleton versus the G-actin pool in the cytosol in Sertoli cells following Dync1h1 knockdown or dynein inhibition by ciliobrevin D between treatment and control groups.

IF, F-actin staining, and image analysis.

IF was performed using frozen cross sections of testes at 7-μm in a cryostat at −22°C to visualize BTB-associated proteins, such as N-cadherin, ß-catenin, occludin and ZO-1, or actin regulatory proteins Arp3 and Eps8 (48, 50). To visualize MTs (e.g., α-tubulin), EB1, and Dync1h1, IF was performed using 5-μm thick sections of testes fixed in either modified Davidson fixative (for α-tubulin or EB1 staining) or Bouin’s fixative (for Dync1h1 staining) and paraffin embedded, or fresh Sertoli cells cultured on coverslips (IF) as earlier described (48, 50, 91). Frozen sections or cells were fixed in 4% PFA or ice-cold methanol for 5–10 min (IF), permeabilized in 0.1% Triton X-100 for 5–10 min (IF). Paraffin sections were deparaffinized, rehydrated, and then subjected to antigen retrieval. Tissues or Sertoli cells were then blocked in 10% goat serum (vol/vol) or 5% BSA (wt/vol) in PBS (10 mM sodium phosphate, 0.15 M NaCl, pH 7.4 at 22°C). Thereafter, samples were incubated with a specific primary and the corresponding secondary antibodies (Table 1) and co-stained with DAPI (Sigma) to visualize cell nuclei. Slides were mounted in Prolong Gold Antifade reagent (Invitrogen, Life Technologies). For F-actin staining, frozen sections or Sertoli cells (fixed in PFA) were incubated with Alexa Fluor 488 phalloidin (Invitrogen). Images were examined and acquired using a Nikon Eclipse 90i Fluorescence Microscope system equipped with Nikon Ds-Qi1Mc or DsFi1 digital camera and Nikon NIS Elements AR 3.2 software (Nikon, Tokyo, Japan). Image overlays were performed using Adobe Photoshop CS4 (Adobe, San Jose, CA). Fluorescence intensity was analyzed by ImageJ 1.45s (National Institutes of Health, Bethesda, MD) or Nikon NIS Elements AR (Version 3.2) software package. Sections of testes or Sertoli cells in an experiment including both treatment and control groups were analyzed in a single experimental session to eliminate interexperimental variations. Data shown herein were representative micrographs from a single experiment. Each experiment had n = 3 independent experiments, which yielded similar results. For fluorescence intensity or distribution analysis in Sertoli cells or seminiferous tubules of testes, at least 200 cells or 2,000 cross sections of tubules were randomly selected and examined in both experimental and control groups in an experiment, and a total n = 3 experiments were performed.

Histological analysis.

Histological analysis was performed using testes fixed in either Bouin’s fixative (Polysciences) or modified Davidson’s fixative (42, 43) and embedded in paraffin. Cauda epididymides were also fixed in modified Davidson’s fixative and embedded in paraffin. Sections of 5-µm thickness were obtained with a microtome, mounted on microscopic slides, and stained with hematoxylin and eosin after deparaffinization. For histological analysis, at least 5,000 cross sections of seminiferous tubules from each testis, or 150 cross sections of cauda epididymides from each rat to monitor sperm abnormalities, were randomly selected and examined from treatment versus control group, and representative images reported herein were the general observations of n = 4 rats, which yielded similar results.

RNA extraction, RT-PCR, and qPCR.

Total RNA was isolated from rat testes, Sertoli cells, germ cells, and brain using TRIzol reagent (Life Technologies) as described (93). Two micrograms total RNA was reverse transcribed by Moloney murine leukemia virus reverse transcriptase (M-MLV; Promega, Madison, WI) according to manufacturer’s instructions to obtain cDNAs that served as templates for subsequent PCR. To quantify Dync1h1 steady-state mRNA level, PCR was performed using cDNA products obtained above as templates with a primer pair specific for Dync1h1 versus S16 (Table 3). PCR products were verified by direct DNA sequencing at Genewiz (South Plainfield, NJ) to confirm their identity. Each RT-PCR experiment was performed with n = 3 independent experiments using different batches of Sertoli cells or germ cells versus rat testes and brain (positive control) from n = 3 male rats. qPCR was performed as described (93), and the mRNA level of Dync1h1 was analyzed by ViiA 7 Real-Time PCR System (Thermo Fisher) with PowerUp SYBR Green Master Mix (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions (n = 3). Gapdh was used as an internal control for normalization. The specificity of the fluorescence signal was verified by both melting curve analysis and gel electrophoresis. The expression level of the target gene was determined using 2^-ΔΔCT method.

Table 3.

Primer pairs used for PCR to assess the steady-state mRNA level of target genes

Gene	GenBank Accession No.	Primer Pairs (5′-3′)	Nucleotide Position	Amplified Product (bp)
Dync1h1	NM_019226.3	Sense: `TGGCTTTACATTGACAACATCG`	3735–3756	181
Dync1h1	NM_019226.3	Antisense: `GGGAGAAGACCAAACCTGTCA`	3895–3915	181
S16	NM_001169146.1	Sense: `TCCGCTGCAGTCCGTTCAAGTCTT`	87–110	385
S16	NM_001169146.1	Antisense: `GCCAAACTTCTTGGATTCGCAGCG`	448–471	385

Open in a new tab

Protein lysate preparation, protein estimation, and IB analysis.

Lysates from Sertoli cells or testes were obtained for protein estimation and IB using corresponding specific antibodies as noted in Table 1. Chemiluminescence was performed using an in-house prepared kit as described (61), and signals were detected using an ImageQuant LAS 4000 (GE Healthcare Life Sciences) imaging system and ImageQuant software (Version 1.3). GAPDH and β-actin served as a protein loading control. Protein band intensities were evaluated by ImageJ 1.45s (http://rsbweb.nih.gov/ij; National Institutes of Health, Bethesda, MD). All samples within an experimental group were processed simultaneously to avoid interexperimental variations. Each sample had triplicates for both treatment and control groups from n = 3 independent experiments using different batches of Sertoli cells or testes from n = 6 rats.

Statistical analysis.

Data analyses were performed using SPSS 16.0 (SPSS, IL). Data presented are the mean ± standard deviation of n = 3 to 5 independent experiments (or n = 6 to 9 rats). Data were subjected to homogeneity test for variance and/or analyzed by Student’s t-test (two-tailed). P < 0.05 was considered statistically significant.

RESULTS

Knockdown of dynein 1 by RNAi or its inactivation by inhibitor in Sertoli cells perturbs TJ-barrier function via changes in BTB-associated proteins at the cell-cell interface.

Dynein 1 is an MT-specific motor protein known to be involved in cargo transport across a mammalian cell in virtually all epithelia and endothelia by directing cargoes to the minus end of MTs (8, 9, 12, 92). Its presence in the testis, including Sertoli and germ cells versus brain (positive control), was confirmed by RT-PCR using a primer pair specific to Dync1h1 (Table 3; Fig. 1A) and also by immunostaining in Sertoli cells using a specific anti-Dync1h1 antibody, illustrating its co-localization with α-tubulin (a building block of MTs) (Table 1; Fig. 1, B and C). In cross sections of rat testes, Dync1h1 localized as tracklike structures, co-localizing with MTs in the seminiferous epithelium in virtually all stages of the seminiferous epithelial cycle in adult rat testes (Fig. 1D), consistent with its function as an MT-based motor protein. In this report, we used two different approaches to assess the physiological role of dynein 1 in supporting spermatogenesis in our studies (Fig. 2A). First, we elected to knockdown Dync1h1 [Dync1h1 knockdown by using Dync1h1-specific siRNA duplexes versus non-targeting negative control siRNA duplexes (Ctrl RNAi)] (Table 2 and Fig. 2A). Second, we inhibited dynein 1 with ciliobrevin D [an AAA+ ATPase motor cytoplasmic dynein inhibitor that blocks ATPase activity in dynein 1) (26, 79)] versus vehicle Ctrl, either DMSO or saline in some experiments (Fig. 2A). It was shown that a knockdown of Dync1h1 downregulated Dync1h1 expression by ~70% (using IB and qPCR) and did not affect the steady-state level of any of the BTB-associated proteins examined by IB (Fig. 2, B and C). The use of dynein 1 inhibitor ciliobrevin D at 15 µM [a concentration selected based on earlier studies (72)] that inactivated dynein 1 did not downregulate Dync1h1 expression nor any BTB-associated proteins examined by IB (Fig. 2, B and C). However, Dync1h1 knockdown or ciliobrevin D treatment perturbed Sertoli cell TJ-permeability barrier function in vitro (Fig. 2D). Furthermore, the use of ciliobrevin D at 15 µM and 30 µM displayed a dose-dependent inhibitory effect (Fig. 2D). Studies by IF in Sertoli cells also showed that a knockdown of Dync1h1 by RNAi indeed reduced the expression of Dync1h1 in Sertoli cells by ~70%, but ciliobrevin D had no apparent effect on Dync1h1 expression (Fig. 2E), illustrating the specificity of these approaches. Yet Dync1h1 knockdown or the use of ciliobrevin D at 15 µM perturbed the distribution of Sertoli BTB TJ-based (e.g., CAR/ZO-1) or basal ES-based (e.g., N-cadherin/β-catenin) protein complexes at the cell-cell interface (Fig. 2E). For instance, these TJ and basal ES proteins were found to be internalized and moved into the cell cytosol. Further analysis of these findings by quantifying changes in their distribution from the Sertoli cell-cell interface supported the notion that these TJ and basal ES proteins were rapidly internalized, moving from the cell cortical zone into the cell cytosol following Dync1h1 knockdown or treatment with ciliobrevin D (see histograms in Fig. 2E), even though their steady-state protein levels were unaffected (Fig. 2B). These changes in distribution (Fig. 2E) thus contributed to a disruption of the Sertoli cell TJ-barrier function as noted in Fig. 2D.

Fig. 1. — Expression, cellular distribution and stage-specific localization of Dync1h1 in the rat testis. A: *Dync1h1* gene expression in adult rat testes (T), Sertoli cells (SC), and germ cells (GC) versus brain (BR; positive control) with *S16* serving as a loading control by RT-PCR using the corresponding specific primer pairs (Table 3). M, DNA markers in base pairs (bp). B: specificity of the anti-Dync1h1 antibody (Table 1) was assessed by immunoblotting using cell lysates obtained from SC cultured for 5 days in vitro with 80 µg total protein. Only a prominent protein band corresponding to the electrophoretic mobility of Dync1h1 at 500 kDa was noted. HiMark Pre-stained Protein Standard (Life Technologies) served as protein markers. C: staining of SC (harvested on *day 5* and fixed in methanol) with anti-Dync1h1 antibody (red fluorescence) (Table 1) to illustrate cellular localization of Dync1h1, which was shown to partially co-localize with α-tubulin (green fluorescence) that stretched across cell cytosol. SC nuclei were visualized by DAPI (blue). Scale bar, 20 µm. D: Dync1h1 (red fluorescence) co-localized with α-tubulin (green fluorescence) in cross sections of seminiferous tubules using adult rat testes (Bouin’s fixed and paraffin embedded). Cell nuclei were visualized by DAPI (blue). In selected stages I–III, IV–V, VIII, and XIII, Dync1h1 appeared as tracklike structures that lay perpendicular to the basement membrane (annotated by dashed white line) and almost superimposable with MTs [denoted by α-tubulin, which together with β-tubulin are the building blocks of MTs (67, 86)]. Scale bar, 200 µm and 40 µm in first and second micrographs, which apply to corresponding micrographs.

Fig. 2. — A knockdown of Dync1h1 by RNAi or an inactivation of dynein 1 by specific inhibitor ciliobrevin D in Sertoli cells cultured in vitro perturbs the tight junction (TJ)-permeability barrier function via changes in the distribution of TJ and basal ectoplasmic specialization (ES) proteins at the Sertoli cell-cell interface. A: treatment regimens by RNAi [Dync1h1-specific siRNA duplexes vs. non-targeting negative control siRNA duplexes as a control (Ctrl)] or ciliobrevin D (vs. DMSO serving as a vehicle Ctrl) to knockdown Dync1h1 or inactivate dynein 1 to obtain Sertoli cells for RT-PCR, qPCR, immunoblotting (IB), and immunofluorescence analysis (IF), and the number of independent experiments performed for each corresponding study. B: lysates from Sertoli cell cultures were used for IB following a knockdown of Dync1h1 or treatment with ciliobrevin D vs. the corresponding control cultures with the corresponding specific antibodies listed in Table 1. Collectively, these data (i.e., representative findings of n = 3 independent experiments) have shown that the steady-state protein level of Dync1h1 was considerably downregulated following Dync1h1 knockdown (but not treatment with the dynein 1 inhibitor nor any other functional groups of blood-testis barrier (BTB)-associated proteins examined herein), illustrating the knockdown of Dync1h1 is specific to dynein 1 expression without any apparent off-target effects. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, and vimentin served as protein loading controls. C: steady-state mRNA or protein level of Dync1h1 was downregulated by ~70% when examined by qPCR (*left*) or IB (*right*), but only in the RNAi group, and dynein 1 inhibitor ciliobrevin D had no effects on Dync1h1 mRNA or protein expression. Each bar in the histogram is a mean ± SD of n = 3 independent experiments. **P < 0.01 when compared with the corresponding control by Student’s t-test. D: knockdown of Sertoli cell Dync1h1 or treatment of Sertoli cells with ciliobrevin D perturbed the Sertoli cell TJ-permeability barrier function. Each data point is a mean ± SD of quadruplicate bicameral units from a representative experiment. A total of n = 3 independent experiments were performed, which yielded similar results. *P < 0.05; **P < 0.01 when compared with the corresponding control by Student’s t-test. E: IF analysis was used to confirm considerable decline in Dync1h1 expression following RNAi but not treatment of Sertoli cells with ciliobrevin D (see *top*). Histogram (*middle*) summarized the relative fluorescence intensity of Dync1h1 in Dync1h1 RNAi group vs. the corresponding control cells, illustrating a ~70% knockdown. Sertoli cell Dync1h1 knockdown also perturbed the distribution of TJ proteins CAR and ZO-1 and basal ES proteins N-cadherin and β-catenin. In both control groups, TJ and basal ES proteins were tightly localized to the Sertoli cell-cell interface (see white brackets in control groups). After Dync1h1 knockdown or dynein 1 inactivation, these proteins were diffusively localized at the cell-cell interface (see yellow brackets in treatment groups). It is likely that these BTB-associated proteins were internalized and moved from the cell cortical zone into the cell cytosol. Co-transfection of siRNA duplexes with siGLO Red Transfection Indicator (red fluorescence; Dharmacon/GE/Thermo Fisher) used to illustrate successful transfection. Histograms (*bottom*) provide semiquantitative analysis regarding changes in the relative distribution of fluorescence at the cell-cell interface. Each bar is a mean ± SD of n = 3 independent experiments. **P < 0.01 when compared with corresponding control by Student’s t-test. Scale bar, 20 µm, which applies to all other micrographs. TER, transepithelial electrical resistance.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 perturbs MT organization and polymerization kinetics.

A knockdown of Dync1h1 or the use of dynein 1 inhibitor ciliobrevin D (15 µM) to inactivate dynein 1 in Sertoli cells was found to induce considerably disruptive changes on the organization of MTs across the cell cytosol (Fig. 3). For instance, MTs no longer stretched across the entire Sertoli cell cytosol but retracted and stayed closer to the cell nuclei (Fig. 3A). Studies have shown that MTs in mammalian cells are composed of various forms, including tyrosinated tubulin, which is the less stable form of MTs (i.e., more dynamics) (39), whereas both detyrosinated α-tubulin (removal of Tyr from the C-terminus by exposing Glu) and acetylated α-tubulin are the more stable forms of MTs (i.e., less dynamics) (39). Interestingly, following a knockdown of Dync1h1 or treatment of Sertoli cells with ciliobrevin D, the distribution of these various forms of MTs were perturbed (Fig. 3A). For instance, they no longer stretched across the Sertoli cell cytosol as noted in control cells from both control groups; instead, they retracted from the cell peripheries and wrapped around the Sertoli cell nuclei. Similarly, the distribution of end binding protein 1 [EB1; an MT plus-end tracking protein (+TIP) known to stabilize MTs (2, 85)] across the Sertoli cell cytosol was also grossly disrupted following Dync1h1 knockdown or treatment with ciliobrevin D (Fig. 3A). Based on the use of biochemical assays utilizing lysates of Sertoli cells of n = 3 independent experiments, these treatments also considerably perturbed the polymerization of MTs (Fig. 3B), and Dync1h1 RNAi also considerably perturbed the kinetics of MT polymerization (Fig. 3C).

Fig. 3. — A knockdown of Dync1h1 by RNAi or an inactivation of dynein by inhibitor ciliobrevin D perturbs microtubule (MT) organization and MT polymerization in Sertoli cells in vitro. A: Dync1h1 knockdown or dynein 1 inactivation by inhibitor ciliobrevin D in Sertoli cells perturbed the organization of MTs since α-tubulin [Note: α- and β-tubulins are building blocks of MTs (86)] no longer stretched across the Sertoli cell cytosol as noted in cells from both control groups. Instead, MTs appeared to be largely truncated, surrounding the Sertoli cell nuclei, retracting from cell peripheries. On the other hand, tyrosinated tubulin (to promote MT dynamics), detyrosinated α-tubulin (to stabilize MTs), and acetylated α-tubulin (to stabilize MTs) were found to wrap around the Sertoli cell nucleus loosely, displaying a pattern similar to α-tubulin following Dync1h1 knockdown or dynein inactivation, unlike control Sertoli cells wherein they stretched across the cell cytosol. Furthermore, EB1, a +TIP protein known to stabilize MTs by promoting MT growth from the plus (+) end, also retracted from the Sertoli cell cytosol and localized closer to the Sertoli cell nucleus following Dync1h1 knockdown or dynein inactivation, unlike control cells wherein EB1 scattered along MTs that stretched across the entire Sertoli cell. Co-transfection of rhodamine-siGLO indicator (red fluorescence) with siRNA duplexes was used to illustrate successful transfection. Scale bar, 20 µm, which applies to other micrographs. B: MT spin-down assay was used to quantify the relative amount of polymerized MTs (in pellet) vs. free tubulins [in supernatant (S/N)] in Sertoli cell cytosol from these cultures. Dync1h1 knockdown or dynein inactivation in Sertoli cells perturbed MT dynamics in which the level of polymerized MTs quantified in Sertoli cells considerably reduced. Taxol (20 µM) and CaCl₂ (2 mM) included in control Sertoli cell lysates in this assay served as the corresponding positive (+ve) and negative (-ve) control by stabilizing MTs and promoting MT depolymerization, respectively. GAPDH served as the protein loading control. Each bar in the histogram is a mean ± SD of n = 3 independent experiments. **P < 0.01. C: tubulin polymerization assay was used to assess the ability of Sertoli cell lysate to polymerize α- and β- tubulin oligomers in vitro after Dync1h1 knockdown. Rate of tubulin polymerization was noted on the y-axis during the assay period of 100 min. Kinetics of tubulin polymerization were further assessed during the initial 10 min (*center*) during the initial lag phase (see black boxed area, *left*) of polymerization, supporting the notion that Dync1h1 knockdown perturbed tubulin polymerization kinetics, consistent with the findings shown in B. *P < 0.05, by Student’s t-test.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 perturbs F-actin organization in Sertoli cells.

We next investigated if Dync1h1 knockdown or the use of a dynein 1 inhibitor also perturbed F-actin organization through changes in spatiotemporal expression of F-actin regulatory proteins since MT-based tracks are crucial to support intracellular protein trafficking to maintain cytoskeletal homeostasis. Indeed, a specific Dync1h1 knockdown or specific inhibition of dynein 1 induced gross disruption of F-actin organization across the Sertoli cell in which actin filaments no longer stretched across the cell cytosol as noted in control cells: instead, actin filaments were considerably truncated (Fig. 4A). These changes appeared to be the result of changes in the spatiotemporal expression of branched actin polymerization protein Arp3 [conferring actin to assume a “branched” configuration (52)] and also actin barbed end capping and bundling protein Eps8 [conferring F-actin to assume a “bundled” configuration (55)] (Fig. 4A) that led to disruptive changes on the organization of F-actin across the Sertoli cell cytosol. For instance, both Arp3 and Eps8 that were localized at the Sertoli cell-cell interface to support proper actin dynamics to confer actin organization at noted in control cells (see white arrowheads in Fig. 4A) were internalized, and moved into the cell cytosol, no longer prominently localized at the cell cortical zone (see yellow arrowheads in Fig. 4A). Interestingly, it was noted that the organization of vimentin across the Sertoli cell was also perturbed since vimentin-based filaments no longer stretched across the Sertoli cell cytosol but retracted from the cell cortical region and wrapped around the cell nuclei. A study based on the use of a biochemical assay to assess the actin bundling activity in cells from each treatment group versus the corresponding control group as noted in Fig. 4B also supported the findings shown in Fig. 4A, wherein cells from both treatment groups had reduced ability to bundle actin filaments versus the control groups.

Fig. 4. — A knockdown of Dync1h1 by RNAi or an inactivation of dynein by inhibitor ciliobrevin D perturbs F-actin organization and actin polymerization in Sertoli cells in vitro. A: knockdown of Dync1h1 or an inactivation of dynein by inhibitor ciliobrevin D in Sertoli cells was found to induce extensive disorganization of F-actin network across the Sertoli cells, including truncation of actin microfilaments, and these filaments no longer stretched across the cell cytosol as noted in control cells to support the tight junction (TJ)-permeability barrier function. These changes were likely the result of disruptive changes in spatial expression of branched actin nucleation protein Arp3 and actin barbed end capping and bundling protein Eps8. For instance, these proteins no longer localized conspicuously at the Sertoli cell-cell interface as noted in control cells (see white arrowheads), but extensively internalized, moving from the cell cortical zone to cell cytosol, no longer at the cell-cell interface (see yellow arrowheads) in the treatment groups. These changes thus failed to support Sertoli cell TJ-barrier function as noted in Fig. 2D. It was noted that the organization of vimentin was also perturbed, since following Dync1h1 RNAi or ciliobrevin D treatment, vimentin no longer stretched across the Sertoli cell cytosol; instead, vimentin became wrapped around the Sertoli cell nuclei considerably. Co-transfection of rhodamine-siGLO indicator (red fluorescence) with siRNA duplexes illustrated successful transfection. Scale bar, 20 µm, which applies to other micrographs in the same panel. B: actin spin-down assay was performed as described in materials and methods, which separated filamentous (F; in pellet) actin from globular [G; in supernatant (S/N)] actin in Sertoli cell lysates after Dync1h1 knockdown or dynein inactivation by inhibitor ciliobrevin D. As noted herein (and also in composite data summarized in bar graph, *right*), Dync1h1 knockdown by ~70% or dynein inhibition by ciliobrevin D reduced the level of F-actin in Sertoli cells considerably. GAPDH served as a protein loading control. Phalloidin (0.1 µM) and urea (80 mM) were included in Sertoli cell lysates in the assay to serve as the corresponding positive (+ve) and negative (-ve) control. Each bar in the histogram is a mean ± SD of n = 3 independent experiments. **P < 0.01 by Student’s t-test.

Knockdown of Dync1h1 or inactivation of dynein 1 by ciliobrevin D in the testis in vivo perturbs spermatogenesis.

We next examined if the phenotypes noted in Sertoli cells cultured in vitro following a specific knockdown of Dync1h1 or the use of dynein 1 inhibitor ciliobrevin D were consistent with findings in vivo. Using 2 different regimens to knockdown Dync1h1 by transfecting testes thrice on days 1, 2, and 3 versus days 1, 3, and 5 using Polyplus in vivo-jetPEI transfection medium with a transfection efficiency of ~50%–60% using siGLO red transfection indicator (versus pCI-neo/DsRed2) as earlier reported (29, 91), rats were terminated on day 5 or day 7 (Fig. 5A). Since the phenotypes of the treatment groups were similar in both regimens, these data were pooled for analysis and compared with control groups. It was noted that transfection of the testis in vivo with Dync1h1-specific siRNA duplexes (versus non-targeting negative control siRNA duplexes) downregulated Dync1h1 expression in the testis by ~70% as noted by IB and qPCR (Fig. 5, B and C). Furthermore, either treatment failed to induce any remarkable changes on the expression of multiple BTB-associated proteins examined herein (Fig. 5B), consistent with findings in vitro (Fig. 5B versus Fig. 2B), illustrating there were no off-target effects following Dync1h1 RNAi or treatment with the dynein 1 inhibitor ciliobrevin D. Also, the expression of Dync1h1 in the seminiferous epithelium of the testis in vivo following Dync1h1 knockdown was shown to be considerably reduced, but not following treatment with ciliobrevin D, when visualized by IF (Fig. 5D), consistent with findings based on either qPCR or IB (Fig. 5C). Additionally, Dync1h1 that localized along MTs and appeared as tracklike structures in control testes [either transfected with non-targeting negative siRNA duplexes or treated with vehicle (DMSO)] that lay perpendicular to the basement membrane (annotated by a dashed white line) as shown in Fig. 5D was consistent with data of normal rat testes shown in Fig. 1D. However, Dync1h1 no longer properly aligned and stretched across the seminiferous epithelium in either treatment group as noted in control testes, but truncated (yellow arrowheads) and considerably diminished in Dync1h1 RNAi group versus truncated and/or misaligned in ciliobrevin D treated testes (green arrowheads) (Fig. 5D). Thus, findings shown in Fig. 6, A–C that illustrate defects of spermatogenesis noted in multiple staged tubules (Fig. 6, A and C), which in turn led to formation of abnormal epididymal spermatozoa noted in the cauda epididymis (Fig. 6, B and C) following Dync1h1 RNAi and treatment of the testis with ciliobrevin D, were specific to Dync1h1 knockdown and dynein 1-inactivation. For instance, as noted in Fig. 6A, multiple defects in spermatogenesis were noted in Dync1h1 knockdown and dynein 1-inactivated testes versus control testes. First, there were defects in spermatid polarity in which the head of many elongated spermatids no longer pointed toward the basement membrane but deviated by 90°–180° from the intended orientation (annotated by black arrowheads) (Fig. 6A). Second, there were defects in spermatid transport and their release at spermiation, such as entrapment of spermatid 19 spermatids deep inside the epithelium, and spermatid 19 spermatids were persistently found in late stage VIII, IX, XI, XII, and even XIII tubules when spermiation had already taken place, coexisting with step 9, 11, 12, and 13 spermatids (see green arrowheads in Fig. 6A). Third, defect in phagosome transport was noted wherein phagosomes were persistently detected in the adluminal compartment in non-stage VIII tubules instead of near the basement membrane for their eventual degradation as earlier reported (21) (see white arrowheads in Fig. 6A). For instance, phagosomes found in stage VIII tubules near the tubule lumen derived from phagocytosis of residual bodies by Sertoli cells in control testes [yellow arrowheads in Ctrl RNAi testes or in DMSO (Ctrl) testes] were rapidly transported to the base of the epithelium at stage IX of the cycle (annotated by yellow arrowheads) for degradation (21). Yet phagosomes were not transported to the base of the epithelium in stage XI, XII, and XIII tubules in either Dync1h1 RNAi or ciliobrevin D treated testes but were detected in the adluminal compartment (Fig. 6A). Furthermore, abnormal spermatozoa were found in the epididymis when cauda epididymal spermatozoa were examined, including abnormal mid-piece, persistent presence of residual body materials in sperm heads, multinucleated sperm cells, malformed sperm heads, and other abnormal spermatozoa, in Dync1h1 RNAi and ciliobrevin D groups versus control groups (Fig. 6B). In short, defective tubules and also percent of abnormal sperm cells in both treatment groups were considerably higher than the corresponding control groups (Fig. 6C).

Fig. 5. — A study to assess the efficacy of in vivo knockdown of Dync1h1 by RNAi vs. inactivation of dynein by inhibitor ciliobrevin D in adult rat testis. A: regimens used for Dync1h1 knockdown or dynein inactivation by inhibitor ciliobrevin D (15 µM) in adult rat testes in vivo with n = 2 rats or n = 7 rats in 2 independent experiments for RNAi, and n = 7 rats for ciliobrevin D treatment. Since the phenotypes obtained from the experiments using two different regimens for RNAi were similar, these data were pooled for subsequent analysis. B: immunoblot (IB) analysis using lysates of testes showed that Dync1h1-specific knockdown induced a downregulation of Dync1h1 without perturbing the expression of multiple blood-testis barrier (BTB)-associated proteins, illustrating there was no apparent off-target effect following Dync1h1 knockdown. The use of ciliobrevin D to inactivate dynein did not alter Dync1h1 protein level, as well as all the BTB-associated proteins examined herein. GAPDH served as a protein loading control. C: a study by qPCR and IB illustrated a downregulation on the steady-state mRNA and protein level of Dync1h1 by at least 70% following Dync1h1 knockdown, but an inactivation of dynein had no apparent effects on Dync1h1 expression. For qPCR, *Gapdh* served as an internal control. For IB, GAPDH served as a protein loading control (see Fig. 2B). **P < 0.01, by Student’s t-test. D: efficacy of Dync1h1 knockdown in the testis in vivo was also assessed by immunofluorescence analysis using cross sections of testes and stained for Dync1h1 (red fluorescence). It was noted that Dync1h1 fluorescence signals were considerably diminished following transfection of testes with Dync1h1 siRNA duplexes vs. non-targeting negative control siRNA duplexes by as much as ~70% (see bar graph, *bottom*). For instance, Dync1h1 no longer expressed prominently along the MT-based tracklike structures (see yellow arrowheads) following Dync1h1 knockdown, unlike control testes where Dync1h1 localized closely with MT-based tracks (annotated by white arrowheads). However, following inactivation of dynein by inhibitor ciliobrevin A, although the Dync1h1 fluorescence signals remained unaffected (see bar graph, *bottom*), the distribution of Dync1h1 across the seminiferous epithelium was grossly disrupted as the tracklike structures conferred by Dync1h1 were notably truncated or misaligned [i.e., no longer lay perpendicular to the basement membrane (annotated by dashed white line; see green arrowheads)]. Each bar in the histogram is a mean ± SD of n = 4 rats. **P < 0.01 by Student’s t-test. ES, ectoplasmic specialization; TJ, tight junction.

Fig. 6. — A knockdown of Dync1h1 or an inactivation of dynein by inhibitor ciliobrevin D in adult rat testes in vivo perturbs spermatogenesis. A: histological analysis by hematoxylin-eosin staining using cross sections of testes at selected stages of the epithelial cycle following Dync1h1 knockdown or dynein inactivation by inhibitor ciliobrevin D showed extensive defects in spermatogenesis. First, spermatids had defects of polarity (black arrowheads) in which their heads no longer pointed toward the basement membrane, deviating by ~90°–180° from the basement membrane following Dync1h1 knockdown or dynein inactivation. Second, there was failure in the transport of phagosomes across the seminiferous epithelium. In control groups, phagosomes (yellow arrowheads) were found in the adluminal compartment near the tubule lumen, which were the residual bodies engulfed by the Sertoli cells at stage VIII at the time of spermiation. These phagosomes in stage VIII tubules were transported to the base of the epithelium at stage IX to prepare for their eventual lysosomal degradation. However, many phagosomes were found in the adluminal (apical) compartment in stage XI, XII, and XIII tubules (white arrowheads), which were not detected in similar staged tubules in controls. Third, there were defects in spermatid transport across the seminiferous epithelium. For instance, step 19 spermatids (green arrowheads) were consistently found in the seminiferous epithelium in stage IX, XI, XII, and XIII tubules, buried deep inside the epithelium, coexisting with step 9, 11, 12, and 13 spermatids (blue arrowheads) because of their failure to undergo spermiation in stage VIII tubules due to defects in microtubule organization. Boxed areas (insets) in testes of control groups (yellow) were magnified in corresponding yellow boxed rectangles, and insets in Dync1h1 RNAi testes (red) or ciliobrevin D treated testes (blue) were also magnified in corresponding red or blue boxed rectangles to better illustrate defects. Scale bar, 100 µm; inset, 40 µm. B: spermatozoa with structural defects were noted and summarized herein in Dync1h1 RNAi or ciliobrevin D treated group vs. the corresponding control cells, including 1) defective mid-piece so that sperm heads failed to anchor onto the tail, 2) persistent presence of residual body surrounding sperm heads, 3) malformed sperm heads, and 4) sperm heads without the tail. C: a threefold increase in defective tubules based on the criteria noted in A from n = 5 rats (*left*) and the percent of abnormal sperm found in the cauda epididymis from n = 5 rats (*righ*t). **P < 0.01, by Student’s t-test.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 in the testis in vivo perturbs MT organization through changes in the spatial expression of EB1.

Consistent with findings noted in the study in vitro, a specific knockdown of Dync1h1 by RNAi (Fig. 7, A and B) or the use of ciliobrevin D to inactivate dynein 1 (Fig. 8) in the testis in vivo was found to perturb the MT organization across the Sertoli cell epithelium. For instance, in control testes, α-tubulin (a building block of MTs) and EB1 [a +TIP known to promote MT stabilization (1, 2, 85)] co-localized, and both lay perpendicular against the basement membrane (annotated by a dashed white line) across the epithelium in virtually all stages of the epithelial cycle examined (Fig. 7A and Fig. 8), consistent with an earlier report in normal rat testes (85). However, after each treatment (either RNAi or ciliobrevin D treatment), EB1 and MTs (visualized by α-tubulin staining) were found to be extensively truncated and misaligned such that the tracklike structures conferred by MTs and supported by EB1 were no longer visible in Dync1h1 knockdown (Fig. 7) or ciliobrevin D treated testes (Fig. 8), considerably different from the corresponding control group. For instance, some tracklike structures were aligned in parallel to the basement membrane as noted in ciliobrevin D treated group (see green arrowhead in Fig. 8). There were also considerably more defective tubules if MT organization served as the criterion of identifying defective tubules, such as truncation of MTs across the seminiferous epithelium versus histological analysis (Fig. 7A versus Fig. 6C). Furthermore, a biochemical study to assess MT organization with corresponding positive and negative controls also confirmed findings shown in Fig. 7A and Fig. 8 that a knockdown of Dync1h1 or an inactivation of dynein 1 with ciliobrevin D considerably perturbed the ability of the testis to induce MT polymerization (Fig. 7B).

Fig. 8. — An inactivation of dynein by inhibitor ciliobrevin D in the testis in vivo perturbs microtubule (MT) organization through changes in the distribution of EB1 in the seminiferous epithelium. In control testes, MTs (green fluorescence, visualized by α-tubulin staining) appeared as tracklike structures that lay perpendicular to the basement membrane (annotated by a dashed white line) and stretched across the entire seminiferous epithelium (annotated by white arrowheads). EB1, a +TIP protein known to promote MT stabilization by binding to the fast growing plus end, also co-localized with MTs in the seminiferous epithelium in control testes (see white arrowheads). However, following dynein inactivation, these MT-based tracks were either truncated (yellow arrowheads) or misaligned (green arrowhead) against the basement membrane (basement membrane annotated by a dashed white line). These disruptive changes were detected in virtually all stages of the tubules, from I–XIV, and representative stage I–III, V, VIII, IX, XI, and XIII tubules were shown herein. Scale bar, 40 µm, which applies to other micrographs.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 in the testis in vivo perturbs F-actin organization.

Consistent with findings noted in the study in vitro, Dync1h1 knockdown (Fig. 9, A–C) or treatment of testes with ciliobrevin D to inactivate dynein 1 (Fig. 10) also perturbed the organization of F-actin across the seminiferous epithelium in adult rat testes. First, F-actin no longer tightly associated with apical ES surrounding the spermatid head, which led to a loss of spermatid polarity as seen in many elongated spermatids (annotated by yellow arrowheads) (Fig. 9A and Fig. 10). Second, F-actin at the basal ES no longer tightly associated with the BTB (located above the basement membrane as annotated by the dashed white line) as noted in control testes (annotated by white brackets) but diffusely localized at the site (annotated by yellow brackets in both treatment groups) (Fig. 9A and Fig. 10). Third, F-actin was shown to create the tracklike structures to support spermatid and organelle transport such as at late stage VIII of the epithelial cycle as noted in the corresponding control testis in the experiment of Dync1h1 RNAi (Fig. 9A) or the experiment of dynein 1 inactivation with ciliobrevin D (Fig. 10). In both treatment groups, however, these F-actin conferred tracklike structures were all truncated and virtually undetectable (Fig. 9A and Fig. 10). These changes thus led to a considerable increase in the percent of defective tubules when the organization of F-actin was selected as the only criterion to assess tubule integrity based on immunofluorescence microscopy (Fig. 9B). Furthermore, the ability of testis lysates to induce actin polymerization (i.e., F-actin) was considerably reduced following Dync1h1 knockdown or treatment with ciliobrevin D versus the corresponding control groups, including positive and negative control groups for this assay (Fig. 9C). The bar group in the lower panel of Fig. 9C summarizes the results of this biochemical study.

Fig. 10. — An inactivation of dynein 1 by inhibitor ciliobrevin D in adult rat testes in vivo perturbs F-actin organization in the seminiferous epithelium. Dynein 1 was inactivated by treatment of testes with ciliobrevin D vs. control testes treated with vehicle control (DMSO Ctrl). Dynein 1 inactivation by the inhibitor ciliobrevin D induced gross disruption of F-actin at the apical ectoplasmic specialization (ES). In control testes treated with DMSO only (Vehicle Ctrl), F-actin at the apical ES (enlarged in yellow boxed insets) appeared as “bulblike” structures at the concave side of spermatid heads in stage I–III, V, and VIII tubules. F-actin supported apical ES function until in late VIII of the cycle when the apical ES was degenerated to facilitate the release of sperm at spermiation. F-actin in late stage VIII tubules also appeared as tracklike structure (see white arrowheads) to support the transport of spermatids and organelles (e.g., phagosomes). Similarly, F-actin at the basal ES in control testes also supported the immunological barrier near the basement membrane (annotated by a dashed white line) by tightly localized at the blood-testis barrier (BTB; its relative position annotated by white brackets). However, following treatment of testes with ciliobrevin D to inactivate dynein, F-actin at the apical ES (enlarged in yellow boxed insets) was diffusively localized at the site, and no tracklike structures were noted across the epithelium. Furthermore, F-actin was not found in many elongating/elongated spermatids at the apical ES, causing defects of spermatid polarity with their heads pointed away from the basement membrane (annotated by yellow arrowheads) by 90°–180° from the intended orientation, considerably different from spermatids found in control testes. Also, many elongated spermatids were trapped deep inside the epithelium (annotated by green arrowheads) in stage VIII or even XIII tubules when they should have been emptied into the tubule lumen at spermiation because of defects in spermatid transport. Also, F-actin at the BTB near the basement membrane (annotated by a dashed white line) was diffusely localized (annotated by the yellow brackets) in treatment group because of disorganization of F-actin at the site when compared with control testes (white brackets). Scale bar, 40 µm; inset, 20 µm; these apply to other corresponding micrographs.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 in the testis in vivo perturbs distribution of adhesion protein complexes at the BTB, leading to a loss of BTB integrity.

Since the organization of F-actin at the basal ES/BTB was found to be disrupted following Dync1h1 knockdown (Fig. 9A), or an inactivation of dynein 1 by ciliobrevin D (Fig. 10), we next investigated if the distribution of basal ES (e.g., N-cadherin/β-catenin) or TJ (e.g., occludin/ZO-1) adhesion protein complexes at the BTB following Dync1h1 RNAi or dynein 1 inactivation was perturbed. As these adhesion protein complexes all utilized F-actin for attachment, it is not unexpected that their distribution was considerably disrupted (Fig. 11A). For instance, basal ES proteins N-cadherin and β-catenin and TJ proteins occludin and ZO-1 no longer restrictively localized at the BTB as noted in control testes, but diffusely localized at the site, consistent with in vitro findings in which both basal ES and TJ proteins diffused away from the cell cortical zone (Fig. 11A versus Fig. 2E). Furthermore, the integrity of the BTB was also found to be perturbed since the BTB was no longer capable of blocking the passage of biotin across the immunological barrier (Fig. 11B), also consistent with the findings in vitro by monitoring the integrity of the Sertoli cell TJ-barrier function (Fig. 2D). In short, similar to the positive control in which rats were treated with CdCl₂ (3 mg/kg b.w., ip) known to induce BTB disruption (37, 80, 94), a knockdown of Dync1h1 or dynein 1 inactivation by ciliobrevin D also induced BTB disruption (Fig. 11B).

Fig. 11. — A knockdown of Dync1h1 or an inactivation of dynein by inhibitor ciliobrevin D in the testis in vivo perturbs distribution of basal ectoplasmic specialization (ES)- and tight junction (TJ)-associated proteins at the blood-testis barrier (BTB). A: in control testes, basal ES proteins N-cadherin and β-catenin and TJ proteins occludin and ZO-1 were tightly associated with the BTB (see white bracket) located near the basement membrane (annotated by a dashed white line) as noted in selected stage V tubules. However, following Dync1h1 knockdown or dynein 1 inactivation, these proteins were diffusely localized at the BTB by extending considerably away from BTB site (see yellow brackets), well beyond the basement membrane (annotated by a dashed white line). Co-transfection of rhodamine-siGLO indicator (red fluorescence) illustrated successful transfection. Histograms (*bottom*) summarized results of fluorescence analysis (*top*) regarding changes in the relative distribution of basal ES or TJ proteins in treatment vs. corresponding control groups. Each bar in the histogram is a mean ± SD of n = 4 rats, and 50 randomly selected cross sections of tubules in each testis were scored. **P < 0.01 by Student’s t-test. Scale bar, 40 µm. B: results of an in vivo BTB integrity assay in which the BTB found in control testes from the two control groups were similar to normal rat testes (-ve control group) and were capable of blocking the diffusion of membrane impermeable EZ-LinkSulfo-NHS-LC-Biotin across the immunological barrier. However, as noted in the positive control group (+ve) in which rats were treated with CdCl₂ (3 mg/kg body weight, ip) for 5 days, known to disrupt the BTB function (94), biotin freely diffused across the immunological barrier to reach into the tubule lumen, which was visualized by Alexa Fluor 488-streptavidin (green fluorescence) with cell nuclei stained by DAPI. It was noted that the BTB became “leaky” in both Dync1h1 knockdown and dynein 1 inactivated testes. The histogram (*bottom*) summarized results of the BTB integrity assay in which each bar represents a mean ± SD of n = 3 rats that illustrated the ratio of the distance traveled by the biotin vs. the radius of a seminiferous tubule. For oblique sectioned tubules, the radius of the tubule was obtained by averaging the longest and shortest distance from the tubule lumen. **P < 0.01, by Student’s t-test. Scale bar, 350 µm and 80 µm (magnified micrograph), which apply to corresponding micrographs.

F-actin disorganization in the seminiferous epithelium following Dync1h1 knockdown or dynein 1 inactivation by ciliobrevin D is mediated by changes in the spatiotemporal expression of actin regulatory proteins Arp3 and Eps8.

The disruptive effects of either Dync1h1 knockdown or ciliobrevin D treatment on the organization of F-actin across the epithelium was found to be mediated by changes in the spatiotemporal expression of Arp3 and Eps8. Arp3 is a branched actin polymerization protein that induces actin bundles to be organized as a branched network to facilitate protein endocytosis and recycling, such as at stage VII of the epithelial cycle (69), thereby destabilizing ES. On the other hand, Eps8 is an actin barbed end capping and bundling protein (19) promoting ES integrity. In both treatment groups, Arp3 or Eps8 no longer localized at the apical ES as bulblike structures at the concave side of spermatid heads as noted in control groups. Instead, these two proteins extensively disorganized following Dync1h1 knockdown or ciliobrevin D treatment (Fig. 12A). Also, many elongated spermatids had defects in polarity as their heads no longer pointed to the basement membrane as noted in control testes but deviated by 90° to 180° from the basement membrane (see yellow arrowheads in Fig. 12A). Also, laminin-γ3 chain, a spermatid-specific apical ES protein (41, 97), which was robustly expressed at the concave side and toward the tip of spermatid heads as noted in control groups, were grossly disrupted, either considerably downregulated or mis-localized following either treatment (Fig. 12A). Because of these defects, the percent of VII or VIII tubules based on IF localization of either Arp3, Eps8, or laminin-γ3 chain was found to be considerably increased when compared with control groups, which was noted to be ~20% (stage VII tubules) and 7.5% (stage VIII tubules), respectively, consistent with an earlier report (36) (Fig. 12B).

Fig. 12. — A knockdown of Dync1h1 or an inactivation of dynein 1 by inhibitor ciliobrevin D in the testis in vivo perturbs the spatiotemporal expression of actin regulatory and apical ectoplasmic specialization (ES) proteins in the seminiferous epithelium of adult rat testes. A: in the testis of the two control groups [namely the Ctrl RNAi and DMSO (Ctrl)], the branched actin polymerization protein Arp3 and actin barbed end capping and bundling protein Eps8 were robustly expressed at the apical ES as “bulblike” structures on the concave side of spermatid heads to support extensive junction remodeling, including protein endocytosis and recycling in stage VII tubules. This thus supported the proper adhesion of elongated spermatids in early stage VIII tubules to prepare for their eventual release at spermiation at late stage VIII of the cycle as noted by laminin-γ3 chain staining, which is a spermatid-specific apical ES marker protein (41, 81, 97). Arp3 and Eps8 also tightly expressed at the basal ES/blood-testis barrier (BTB) to support BTB function. However, after either Dync1h1 knockdown (Dync1h1 RNAi) or inactivation of dynein 1 by ciliobrevin D, the spatiotemporal expression of either Apr3 or Eps8 were similar in both treatment groups: each of these actin-binding/regulatory proteins was grossly mis-localized (see yellow arrowheads), causing a disruption of the F-actin network at the apical ES as noted in Fig. 9A and Fig. 10. This, in turn, impeded the function of apical ES adhesion proteins as noted by changes in the distribution of laminin-γ3 chain, causing either premature release of spermatids or leading to defects in spermatid polarity (see white dotted lines). The yellow or green boxed areas illustrating the corresponding apical ES or basal ES region were magnified in insets. The basement membrane was annotated by a dashed white line. Co-transfection of rhodamine-siGLO indicator (red fluorescence) illustrated successful transfection. Scale bar, 40 µm; inset, 20 µm. B: these histograms illustrate a considerable increase in stage VII (based on Arp3 or Eps8 staining) or VIII (based on laminin-γ3 staining) when the corresponding marker proteins together with the relative location/presence of step 19 spermatids in the epithelium were used to define these stages. In control groups, the percent of stage VII and VIII was estimated to be ~20% and 7.5%, respectively, consistent with results of an earlier report (36). Each bar is a mean ± SD of n = 3 rats. For each testis, at least 50 stage VII or VIII tubules were randomly selected and scored for each group. **P < 0.01, by Student’s t-test.

DISCUSSION

Studies have shown that MT-based cytoskeleton that appears as tracklike structures is working in concert with MT-specific motor proteins (e.g., dynein 1) to support the transport of cargoes across mammalian cell cytosol, including mitochondria, chromosomes, and numerous cell organelles (4, 5, 8, 12, 59). Thus, when the heavy chain of cytoplasmic dynein 1, a minus-end-directed MT motor complex, namely Dync1h1, was silenced in the testis in vivo, it impeded the transport of developing spermatids and other cellular organelles, such as residual bodies and phagosomes, across the seminiferous epithelium during the epithelial cycle to support spermatogenesis and cell polarity. These findings are consistent with the concept that these MT-specific motor proteins and MT-based tracks are crucial to support these cellular events (12, 22, 65). Studies performed almost two decades ago have reported the presence of MT-based motor proteins dynein and kinesin II (Note: dynein and kinesin are minus-end- and plus-end-directed MT motor proteins, respectively) in the rodent testis, closely associated with the plus end (i.e., fast-growing end) of MTs at the Sertoli cell ES (31, 60, 71). Interestingly, the plus-end MTs are predominantly found near the basement membrane of the tubules but are also localized along MTs that stretch across the seminiferous epithelium (85, 86, 90). In short, dynein promotes the transport of organelles and spermatids to the minus end of MT-based tracks, that is, toward the tubule lumen of the epithelium, whereas kinesin supports their transport to the plus end of MTs, that is, toward the basal region of the epithelium. Studies using genetic models in mice, such as by deleting cytoplasmic Dync1h1 gene or mice carrying a missense point mutation in Dync1h1 (such as induced by radiation in mice), displayed sensory neuropathy due to defects in motor neuron development (15). Also, Dync1h1 mutation induced by radiation in mice also led to impaired retrograde axonal transport of doral root ganglion neurons during brain development (98). Furthermore, cytoplasmic dynein heavy chain deletion mutant and Lis1 null mutation (56), as well as Ndel1 deletion (77) in mice (Note: Lis1 and Ndel1 are molecules involved in the common pathway that regulates cytoplasmic dynein, modulating MT organization), had similar phenotypes wherein these mice displayed early embryonic lethality due to defects in brain development because of failure in axonal transport. Even though any defects in fertility following deletion of cytoplasmic dynein 1 in these genetic mouse models are not known, findings presented herein are consistent with the notion that dynein 1 is important to support spermatid and organelle transport during spermatogenesis.

Herein, we opted to use a different approach by first investigating the role of dynein 1 in the testis using an in vitro Sertoli cell model, which mimics the Sertoli cell BTB in vivo, using RNAi, followed by studies in vivo by knocking down dynein 1 specifically with dynein 1-specific siRNA duplexes at high transfection efficiency. This thus reduces the expression of Dync1h1 by ~70%–75% without perturbing the expression of other Sertoli cell and testis proteins. To further improve the rigor and reproducibility/reliability of these findings, we also used a plasma membrane-permeable benzoyl dihydroquinazolinone derivative of AAA+ ATPase motor cytoplasmic dynein inhibitor ciliobrevin D at the recommended dose range without cell cytotoxicity to inactivate dynein as earlier reported (14, 72). Ciliobrevin D blocks ATPase activity in dynein 1 and disrupts spindle pole focusing and kinetochore-MT attachment (26, 79). Ciliobrevin D is also known to reduce MT cycling needed to construct and maintain MTs to support cell movement structures, such as cilia, and is commonly used to impair MT/cilia function (14, 26, 76). Using this specific inhibitor, the activity of dynein 1 in Sertoli cells in vitro and also the testis in vivo was nullified without perturbing the steady state of Dync1h1 mRNA. It was shown that both treatments, namely RNAi and ciliobrevin D, led to similar phenotypes both in vitro and in vivo, and these data are complementary to each other, reinforcing the reliability of our observations. For instance, it was found that a knockdown of dynein 1 by >70% in Sertoli cells or an inactivation of dynein by a specific inhibitor ciliobrevin D led to a disruption of the Sertoli cell TJ-permeability barrier function. The Sertoli cell barrier function failure was mediated by disruptive changes in the organization of MTs, and also actin-based cytoskeleton, in which MTs and F-actin no longer stretched across the cell cytosol as noted in control cells. The dysfunctional organization of MTs and F-actin appeared to be caused by changes in the spatiotemporal expression of MT regulatory proteins, such as EB1 (a +TIP protein located at the rapidly growing plus end of MTs) (1, 2) or actin regulatory proteins Arp3 (69) and Eps8 (19). It is likely that the disruptive organization of actin filaments across the Sertoli cell is the result of defects in MT-based tracks, which are known to be essential to support cellular transport to maintain F-actin homeostasis (6). More important, these findings based on studies in vitro were practically reproduced in studies in vivo by transfecting testes with Dync1h1-specific siRNA duplexes (versus non-targeting negative control siRNA duplexes) or treatment of the testis with the dynein inhibitor ciliobrevin D. For instance, the organization of MT-based tracks was grossly perturbed by using either RNAi or inhibitor approach, leading to the Sertoli cell BTB breakdown in vivo, which was accompanied by changes in the spatial expression of EB1. More important, F-actin organization at both the apical ES and basal ES/BTB was also grossly disrupted in either treatment, consistent with findings noted in vitro.

Studies have shown that apical ES is crucial to support spermatid adhesion and spermatid polarity since this is the only anchoring junction at the Sertoli cell-spermatid (step 8−19 spermatids) in the rat testis (74, 89). Thus, a disruption of apical ES, such as by treating adult rats with a single dose of adjudin, known to induced reversible male infertility (20) by exerting its disrupting effects primarily at the apical ES (63), is expected to induce spermatid exfoliation that mimics spermiation for all elongated spermatids. However, it is of interest to note that only those spermatids that resided near the tubule lumen were found to undergo spermiation, but numerous step 19 spermatids remained trapped deep inside the seminiferous epithelium following adjudin treatment (46, 84). Interestingly, the apical ES for the step 19 spermatids residing inside the epithelium was found to be grossly disrupted (84). Subsequent studies have shown that this failure in spermatid transport is caused by a loss of tracklike structures conferred by the tubulin-based MTs across the seminiferous epithelium (17, 18). For instance, in control testes, the MT-conferred tracks were conspicuously detected that lay perpendicular to the basement membrane across the entire seminiferous epithelium. However, in adjudin-treated testes, those MT-based tracks were grossly disrupted, either truncated or misaligned and lying parallel to the basement membrane, failing to support spermatid transport. We have now further expanded these earlier observations as illustrated herein that the motor protein dynein 1 plays a considerable role to support spermatid transport. For instance, it was shown that a downregulation of dynein 1 by ~70% by RNAi or an inactivation of dynein 1 by inhibitor ciliobrevin D could reproduce the phenotype of treating rats with adjudin in which extensive exfoliation of germ cells was detected in the transfected tubules, yet many step 19 spermatids were persistently detected deep inside the seminiferous epithelium, even co-existing with step 9, 10, 11, 12, and 13 spermatids in stage IX, X, XI, XII, and XIII tubules that were not found in control/normal testes. Although the apical ES function was grossly perturbed as illustrated by the mis-localization of spermatid-specific apical ES protein laminin-γ3 chain, these step 19 spermatids failed to undergo spermiation because of the lack of motor protein dynein 1 that is necessary to support spermatid transport as cargoes to the tubule lumen for their release at spermiation.

In summary, cytoplasmic dynein 1, an MT-based motor protein, is crucial to support the function of MT-based cytoskeleton. However, it also plays a crucial role to support the actin- and vimentin-based cytoskeletons, possibly because of its unique role to in supporting intracellular trafficking to maintain cellular homeostasis in the seminiferous epithelium. Work is now in progress to assess to involvement of dynein 1 in supporting spermatid and organelle transport using the adjudin model.

GRANTS

Support for this work was provided by NIH grants (National Institute of Child Health and Human Development R01 HD-056034 to C. Y. Cheng; U54 HD-029990 Project 5 to C. Y. Cheng); Hong Kong Research Grants Council grant (GRF-HKU17100816 to W.-y. Lui); and Natural Science Foundation of China grant (NSFC, SCI-2016-NSFC-008 to C.K. Wong). Q. Wen was supported by a fellowship from The University of Hong Kong (Hong Kong, China), The Baptist University of Hong Kong (Hong Kong, China), The Noopolis Foundation (Rome, Italy), The F. Lau Memorial Fellowship (Hong Kong, China), and The Economic Development Council (New York, NY).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

C.Y.C. conceived and designed research; Q.W., E.I.T., and C.Y.C. performed experiments; Q.W., W.M.L., and C.Y.C. analyzed data; Q.W., E.I.T., W.-y.L., C.K.W., B.S., and C.Y.C. interpreted results of experiments; Q.W. and C.Y.C. prepared figures; C.Y.C. drafted manuscript; C.Y.C. edited and revised manuscript; Q.W., E.I.T., W.-y.L., W.M.L., C.K.W., B.S., and C.Y.C. approved final version of manuscript.

REFERENCES

1.Akhmanova A, Steinmetz MO. Control of microtubule organization and dynamics: two ends in the limelight. Nat Rev Mol Cell Biol 16: 711–726, 2015. doi: 10.1038/nrm4084. [DOI] [PubMed] [Google Scholar]
2.Akhmanova A, Steinmetz MO. Microtubule +TIPs at a glance. J Cell Sci 123: 3415–3419, 2010. doi: 10.1242/jcs.062414. [DOI] [PubMed] [Google Scholar]
3.Alekhina O, Burstein E, Billadeau DD. Cellular functions of WASP family proteins at a glance. J Cell Sci 130: 2235–2241, 2017. doi: 10.1242/jcs.199570. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Ananthanarayanan V. Activation of the motor protein upon attachment: anchors weigh in on cytoplasmic dynein regulation. BioEssays 38: 514–525, 2016. doi: 10.1002/bies.201600002. [DOI] [PubMed] [Google Scholar]
5.Barisic M, Maiato H. The tubulin code: a navigation system for chromosomes during mitosis. Trends Cell Biol 26: 766–775, 2016. doi: 10.1016/j.tcb.2016.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Barlan K, Gelfand VI. Microtubule-based transport and the distribution, tethering, and organization of organelles. Cold Spring Harb Perspect Biol 9: a025817, 2017. doi: 10.1101/cshperspect.a025817. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Bhabha G, Johnson GT, Schroeder CM, Vale RD. How dynein moves along microtubules. Trends Biochem Sci 41: 94–105, 2016. doi: 10.1016/j.tibs.2015.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Bonifacino JS, Neefjes J. Moving and positioning the endolysosomal system. Curr Opin Cell Biol 47: 1–8, 2017. doi: 10.1016/j.ceb.2017.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Bonne D, Heuséle C, Simon C, Pantaloni D. 4′,6-Diamidino-2-phenylindole, a fluorescent probe for tubulin and microtubules. J Biol Chem 260: 2819–2825, 1985. [PubMed] [Google Scholar]
11.Byers S, Hadley MA, Djakiew D, Dym M. Growth and characterization of polarized monolayers of epididymal epithelial cells and Sertoli cells in dual environment culture chambers. J Androl 7: 59–68, 1986. doi: 10.1002/j.1939-4640.1986.tb00871.x. [DOI] [PubMed] [Google Scholar]
12.Carter AP, Diamant AG, Urnavicius L. How dynein and dynactin transport cargos: a structural perspective. Curr Opin Struct Biol 37: 62–70, 2016. doi: 10.1016/j.sbi.2015.12.003. [DOI] [PubMed] [Google Scholar]
13.Chen H, Mruk DD, Xiao X, Cheng CY. Human spermatogenesis and its regulation. In: Male Hypogonadism: Basic, Clinical and Therapeutic Principles, edited by Winters SJ, Huhtaniemi IT. New York: Springer International Publishing, 2017, p. 49–72. doi: 10.1007/978-3-319-53298-1_3. [DOI] [Google Scholar]
14.Chen X, Gays D, Milia C, Santoro MM. Cilia control vascular mural cell recruitment in vertebrates. Cell Reports 18: 1033–1047, 2017. doi: 10.1016/j.celrep.2016.12.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Chen XJ, Levedakou EN, Millen KJ, Wollmann RL, Soliven B, Popko B. Proprioceptive sensory neuropathy in mice with a mutation in the cytoplasmic dynein heavy chain 1 gene. J Neurosci 27: 14515–14524, 2007. doi: 10.1523/JNEUROSCI.4338-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Cheng CY, Mruk DD. The blood-testis barrier and its implications for male contraception. Pharmacol Rev 64: 16–64, 2012. doi: 10.1124/pr.110.002790. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Cheng CY, Mruk DD. Cell junction dynamics in the testis: Sertoli-germ cell interactions and male contraceptive development. Physiol Rev 82: 825–874, 2002. doi: 10.1152/physrev.00009.2002. [DOI] [PubMed] [Google Scholar]
18.Cheng CY, Mruk DD. A local autocrine axis in the testes that regulates spermatogenesis. Nat Rev Endocrinol 6: 380–395, 2010. doi: 10.1038/nrendo.2010.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Cheng CY, Mruk DD. Regulation of spermiogenesis, spermiation and blood-testis barrier dynamics: novel insights from studies on Eps8 and Arp3. Biochem J 435: 553–562, 2011. doi: 10.1042/BJ20102121. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Cheng CY, Silvestrini B, Grima J, Mo MY, Zhu LJ, Johansson E, Saso L, Leone MG, Palmery M, Mruk D. Two new male contraceptives exert their effects by depleting germ cells prematurely from the testis. Biol Reprod 65: 449–461, 2001. doi: 10.1095/biolreprod65.2.449. [DOI] [PubMed] [Google Scholar]
21.Clermont Y, Morales C, Hermo L. Endocytic activities of Sertoli cells in the rat. Ann N Y Acad Sci 513: 1–15, 1987. doi: 10.1111/j.1749-6632.1987.tb24994.x. [DOI] [PubMed] [Google Scholar]
22.de Kretser DM, Kerr JB. The cytology of the testis. In: The Physiology of Reproduction, edited by Knobil E, Neill JB, Ewing LL, Greenwald GS, Markert CL, Pfaff DW. New York: Raven, 1988, vol 1, p. 837–932. [Google Scholar]
23.Diviani D, Scott JD. AKAP signaling complexes at the cytoskeleton. J Cell Sci 114: 1431–1437, 2001. [DOI] [PubMed] [Google Scholar]
24.Du M, Young J, De Asis M, Cipollone J, Roskelley C, Takai Y, Nicholls PK, Stanton PG, Deng W, Finlay BB, Vogl AW. A novel subcellular machine contributes to basal junction remodeling in the seminiferous epithelium. Biol Reprod 88: 60, 2013. doi: 10.1095/biolreprod.112.104851. [DOI] [PubMed] [Google Scholar]
25.Ehmcke J, Wistuba J, Schlatt S. Spermatogonial stem cells: questions, models and perspectives. Hum Reprod Update 12: 275–282, 2006. doi: 10.1093/humupd/dmk001. [DOI] [PubMed] [Google Scholar]
26.Firestone AJ, Weinger JS, Maldonado M, Barlan K, Langston LD, O’Donnell M, Gelfand VI, Kapoor TM, Chen JK. Small-molecule inhibitors of the AAA+ ATPase motor cytoplasmic dynein. Nature 484: 125–129, 2012. doi: 10.1038/nature10936. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Galdieri M, Ziparo E, Palombi F, Russo MA, Stefanini M. Pure Sertoli cell cultures: a new model for the study of somatic-germ cell interactions. J Androl 2: 249–254, 1981. doi: 10.1002/j.1939-4640.1981.tb00625.x. [DOI] [Google Scholar]
28.Gao Y, Lui WY, Lee WM, Cheng CY. Polarity protein Crumbs homolog-3 (CRB3) regulates ectoplasmic specialization dynamics through its action on F-actin organization in Sertoli cells. Sci Rep 6: 28589, 2016. doi: 10.1038/srep28589. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Gao Y, Mruk DD, Lui WY, Lee WM, Cheng CY. F5-peptide induces aspermatogenesis by disrupting organization of actin- and microtubule-based cytoskeletons in the testis. Oncotarget 7: 64203–64220, 2016. doi: 10.18632/oncotarget.11887. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Guttman JA, Kimel GH, Vogl AW. Dynein and plus-end microtubule-dependent motors are associated with specialized Sertoli cell junction plaques (ectoplasmic specializations). J Cell Sci 113: 2167–2176, 2000. [DOI] [PubMed] [Google Scholar]
32.Hancock WO. Bidirectional cargo transport: moving beyond tug of war. Nat Rev Mol Cell Biol 15: 615–628, 2014. doi: 10.1038/nrm3853. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Hermo L, Pelletier RM, Cyr DG, Smith CE. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 1: background to spermatogenesis, spermatogonia, and spermatocytes. Microsc Res Tech 73: 241–278, 2010. doi: 10.1002/jemt.20783. [DOI] [PubMed] [Google Scholar]
34.Hermo L, Pelletier RM, Cyr DG, Smith CE. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 2: changes in spermatid organelles associated with development of spermatozoa. Microsc Res Tech 73: 279–319, 2010. doi: 10.1002/jemt.20787. [DOI] [PubMed] [Google Scholar]
35.Hess RA, Renato de Franca L. Spermatogenesis and cycle of the seminiferous epithelium. Adv Exp Med Biol 636: 1–15, 2008. doi: 10.1007/978-0-387-09597-4_1. [DOI] [PubMed] [Google Scholar]
36.Hess RA, Schaeffer DJ, Eroschenko VP, Keen JE. Frequency of the stages in the cycle of the seminiferous epithelium in the rat. Biol Reprod 43: 517–524, 1990. doi: 10.1095/biolreprod43.3.517. [DOI] [PubMed] [Google Scholar]
37.Hew KW, Heath GL, Jiwa AH, Welsh MJ. Cadmium in vivo causes disruption of tight junction-associated microfilaments in rat Sertoli cells. Biol Reprod 49: 840–849, 1993. doi: 10.1095/biolreprod49.4.840. [DOI] [PubMed] [Google Scholar]
38.Janecki A, Steinberger A. Polarized Sertoli cell functions in a new two-compartment culture system. J Androl 7: 69–71, 1986. doi: 10.1002/j.1939-4640.1986.tb00873.x. [DOI] [PubMed] [Google Scholar]
39.Janke C. The tubulin code: molecular components, readout mechanisms, and functions. J Cell Biol 206: 461–472, 2014. doi: 10.1083/jcb.201406055. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Kaitu’u-Lino TJ, Sluka P, Foo CF, Stanton PG. Claudin-11 expression and localisation is regulated by androgens in rat Sertoli cells in vitro. Reproduction 133: 1169–1179, 2007. doi: 10.1530/REP-06-0385. [DOI] [PubMed] [Google Scholar]
41.Koch M, Olson PF, Albus A, Jin W, Hunter DD, Brunken WJ, Burgeson RE, Champliaud MF. Characterization and expression of the laminin γ3 chain: a novel, non-basement membrane-associated, laminin chain. J Cell Biol 145: 605–618, 1999. doi: 10.1083/jcb.145.3.605. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Lanning LL, Creasy DM, Chapin RE, Mann PC, Barlow NJ, Regan KS, Goodman DG. Recommended approaches for the evaluation of testicular and epididymal toxicity. Toxicol Pathol 30: 507–520, 2002. doi: 10.1080/01926230290105695. [DOI] [PubMed] [Google Scholar]
43.Latendresse JR, Warbrittion AR, Jonassen H, Creasy DM. Fixation of testes and eyes using a modified Davidson’s fluid: comparison with Bouin’s fluid and conventional Davidson’s fluid. Toxicol Pathol 30: 524–533, 2002. doi: 10.1080/01926230290105721. [DOI] [PubMed] [Google Scholar]
44.Lee NP, Mruk DD, Conway AM, Cheng CY. Zyxin, axin, and Wiskott-Aldrich syndrome protein are adaptors that link the cadherin/catenin protein complex to the cytoskeleton at adherens junctions in the seminiferous epithelium of the rat testis. J Androl 25: 200–215, 2004. doi: 10.1002/j.1939-4640.2004.tb02780.x. [DOI] [PubMed] [Google Scholar]
45.Li JC, Lee TW, Mruk TD, Cheng CY. Regulation of Sertoli cell myotubularin (rMTM) expression by germ cells in vitro. J Androl 22: 266–277, 2001. doi: 10.1002/j.1939-4640.2001.tb02180.x. [DOI] [PubMed] [Google Scholar]
46.Li L, Tang EI, Chen H, Lian Q, Ge R, Silvestrini B, Cheng CY. Sperm release at spermiation is regulated by changes in the organization of actin- and microtubule-based cytoskeletons at the apical ectoplasmic specialization - a study using the adjudin model. Endocrinology 158: 4300–4316, 2017. doi: 10.1210/en.2017-00660. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Li MW, Mruk DD, Lee WM, Cheng CY. Disruption of the blood-testis barrier integrity by bisphenol A in vitro: is this a suitable model for studying blood-testis barrier dynamics? Int J Biochem Cell Biol 41: 2302–2314, 2009. doi: 10.1016/j.biocel.2009.05.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Li N, Mruk DD, Mok KW, Li MW, Wong CK, Lee WM, Han D, Silvestrini B, Cheng CY. Connexin 43 reboots meiosis and reseals blood-testis barrier following toxicant-mediated aspermatogenesis and barrier disruption. FASEB J 30: 1436–1452, 2016. doi: 10.1096/fj.15-276527. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Li N, Mruk DD, Tang EI, Lee WM, Wong CK, Cheng CY. Formin 1 regulates microtubule and F-actin organization to support spermatid transport during spermatogenesis in the rat testis. Endocrinology 157: 2894–2908, 2016. doi: 10.1210/en.2016-1133. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Li N, Mruk DD, Wong CK, Lee WM, Han D, Cheng CY. Actin-bundling protein plastin 3 is a regulator of ectoplasmic specialization dynamics during spermatogenesis in the rat testis. FASEB J 29: 3788–3805, 2015. doi: 10.1096/fj.14-267997. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Li N, Mruk DD, Wong CK, Han D, Lee WM, Cheng CY. Formin 1 regulates ectoplamic specialization in the rat testis through its actin nucleation and bundling activity. Endocrinology 156: 2969–2983, 2015. doi: 10.1210/en.2015-1161. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Lie PP, Chan AY, Mruk DD, Lee WM, Cheng CY. Restricted Arp3 expression in the testis prevents blood-testis barrier disruption during junction restructuring at spermatogenesis. Proc Natl Acad Sci USA 107: 11411–11416, 2010. doi: 10.1073/pnas.1001823107. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Lie PP, Cheng CY, Mruk DD. Crosstalk between desmoglein-2/desmocollin-2/Src kinase and coxsackie and adenovirus receptor/ZO-1 protein complexes, regulates blood-testis barrier dynamics. Int J Biochem Cell Biol 42: 975–986, 2010. doi: 10.1016/j.biocel.2010.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Lie PP, Mruk DD, Lee WM, Cheng CY. Cytoskeletal dynamics and spermatogenesis. Philos Trans R Soc Lond B Biol Sci 365: 1581–1592, 2010. doi: 10.1098/rstb.2009.0261. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Lie PP, Mruk DD, Lee WM, Cheng CY. Epidermal growth factor receptor pathway substrate 8 (Eps8) is a novel regulator of cell adhesion and the blood-testis barrier integrity in the seminiferous epithelium. FASEB J 23: 2555–2567, 2009. doi: 10.1096/fj.06-070573. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Liu Z, Steward R, Luo L. Drosophila Lis1 is required for neuroblast proliferation, dendritic elaboration and axonal transport. Nat Cell Biol 2: 776–783, 2000. doi: 10.1038/35041011. [DOI] [PubMed] [Google Scholar]
57.Lui WY, Lee WM, Cheng CY. Transforming growth factor β3 regulates the dynamics of Sertoli cell tight junctions via the p38 mitogen-activated protein kinase pathway. Biol Reprod 68: 1597–1612, 2003. doi: 10.1095/biolreprod.102.011387. [DOI] [PubMed] [Google Scholar]
58.Ma Y, Yang HZ, Xu LM, Huang YR, Dai HL, Kang XN. Testosterone regulates the autophagic clearance of androgen binding protein in rat Sertoli cells. Sci Rep 5: 8894, 2015. doi: 10.1038/srep08894. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Melkov A, Abdu U. Regulation of long-distance transport of mitochondria along microtubules. Cell Mol Life Sci 75: 163–176, 2018. doi: 10.1007/s00018-017-2590-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Miller MG, Mulholland DJ, Vogl AW. Rat testis motor proteins associated with spermatid translocation (dynein) and spermatid flagella (kinesin-II). Biol Reprod 60: 1047–1056, 1999. doi: 10.1095/biolreprod60.4.1047. [DOI] [PubMed] [Google Scholar]
61.Mruk DD, Cheng CY. Enhanced chemiluminescence (ECL) for routine immunoblotting: an inexpensive alternative to commercially available kits. Spermatogenesis 1: 121–122, 2011. doi: 10.4161/spmg.1.2.16606. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Mruk DD, Cheng CY. An in vitro system to study Sertoli cell blood-testis barrier dynamics. Methods Mol Biol 763: 237–252, 2011. doi: 10.1007/978-1-61779-191-8_16. [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Mruk DD, Cheng CY. Testin and actin are key molecular targets of adjudin, an anti-spermatogenic agent, in the testis. Spermatogenesis 1: 137–146, 2011. doi: 10.4161/spmg.1.2.16449. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Nicholls PK, Harrison CA, Gilchrist RB, Farnworth PG, Stanton PG. Growth differentiation factor 9 is a germ cell regulator of Sertoli cell function. Endocrinology 150: 2481–2490, 2009. doi: 10.1210/en.2008-1048. [DOI] [PubMed] [Google Scholar]
65.O’Donnell L. Mechanisms of spermiogenesis and spermiation and how they are disturbed. Spermatogenesis 4: e979623, 2015. doi: 10.4161/21565562.2014.979623. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.O’Donnell L, Nicholls PK, O’Bryan MK, McLachlan RI, Stanton PG. Spermiation: the process of sperm release. Spermatogenesis 1: 14–35, 2011. doi: 10.4161/spmg.1.1.14525. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.O’Donnell L, O’Bryan MK. Microtubules and spermatogenesis. Semin Cell Dev Biol 30: 45–54, 2014. doi: 10.1016/j.semcdb.2014.01.003. [DOI] [PubMed] [Google Scholar]
69.Pizarro-Cerdá J, Chorev DS, Geiger B, Cossart P. The diverse family of Arp2/3 complexes. Trends Cell Biol 27: 93–100, 2017. doi: 10.1016/j.tcb.2016.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Qiu L, Zhang X, Zhang X, Zhang Y, Gu J, Chen M, Zhang Z, Wang X, Wang SL. Sertoli cell is a potential target for perfluorooctane sulfonate-induced reproductive dysfunction in male mice. Toxicol Sci 135: 229–240, 2013. doi: 10.1093/toxsci/kft129. [DOI] [PubMed] [Google Scholar]
71.Redenbach DM, Hall ES, Boekelheide K. Distribution of Sertoli cell microtubules, microtubule-dependent motors, and the Golgi apparatus before and after tight junction formation in developing rat testis. Microsc Res Tech 32: 504–519, 1995. doi: 10.1002/jemt.1070320604. [DOI] [PubMed] [Google Scholar]
72.Roossien DH, Miller KE, Gallo G. Ciliobrevins as tools for studying dynein motor function. Front Cell Neurosci 9: 252, 2015. doi: 10.3389/fncel.2015.00252. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Rotkopf S, Hamberg Y, Aigaki T, Snapper SB, Shilo BZ, Schejter ED. The WASp-based actin polymerization machinery is required in somatic support cells for spermatid maturation and release. Development 138: 2729–2739, 2011. doi: 10.1242/dev.059865. [DOI] [PubMed] [Google Scholar]
74.Russell L. Observations on rat Sertoli ectoplasmic (‘junctional’) specializations in their association with germ cells of the rat testis. Tissue Cell 9: 475–498, 1977. doi: 10.1016/0040-8166(77)90007-6. [DOI] [PubMed] [Google Scholar]
75.Russell LD, Peterson RN. Sertoli cell junctions: morphological and functional correlates. Int Rev Cytol 94: 177–211, 1985. doi: 10.1016/S0074-7696(08)60397-6. [DOI] [PubMed] [Google Scholar]
76.Samsa LA, Givens C, Tzima E, Stainier DY, Qian L, Liu J. Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish. Development 142: 4080–4091, 2015. doi: 10.1242/dev.125724. [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Sasaki S, Mori D, Toyo-oka K, Chen A, Garrett-Beal L, Muramatsu M, Miyagawa S, Hiraiwa N, Yoshiki A, Wynshaw-Boris A, Hirotsune S. Complete loss of Ndel1 results in neuronal migration defects and early embryonic lethality. Mol Cell Biol 25: 7812–7827, 2005. doi: 10.1128/MCB.25.17.7812-7827.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Schlatt S, Ehmcke J. Regulation of spermatogenesis: an evolutionary biologist’s perspective. Semin Cell Dev Biol 29: 2–16, 2014. doi: 10.1016/j.semcdb.2014.03.007. [DOI] [PubMed] [Google Scholar]
79.See SK, Hoogendoorn S, Chung AH, Ye F, Steinman JB, Sakata-Kato T, Miller RM, Cupido T, Zalyte R, Carter AP, Nachury MV, Kapoor TM, Chen JK. Cytoplasmic dynein antagonists with improved potency and isoform selectivity. ACS Chem Biol 11: 53–60, 2016. doi: 10.1021/acschembio.5b00895. [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Setchell BP, Waites GM. Changes in the permeability of the testicular capillaries and of the ‘blood-testis barrier’ after injection of cadmium chloride in the rat. J Endocrinol 47: 81–86, 1970. doi: 10.1677/joe.0.0470081. [DOI] [PubMed] [Google Scholar]
81.Siu MK, Cheng CY. Interactions of proteases, protease inhibitors, and the β1 integrin/laminin γ3 protein complex in the regulation of ectoplasmic specialization dynamics in the rat testis. Biol Reprod 70: 945–964, 2004. doi: 10.1095/biolreprod.103.023606. [DOI] [PubMed] [Google Scholar]
82.Siu MK, Wong CH, Lee WM, Cheng CY. Sertoli-germ cell anchoring junction dynamics in the testis are regulated by an interplay of lipid and protein kinases. J Biol Chem 280: 25029–25047, 2005. doi: 10.1074/jbc.M501049200. [DOI] [PubMed] [Google Scholar]
83.Soldati T, Schliwa M. Powering membrane traffic in endocytosis and recycling. Nat Rev Mol Cell Biol 7: 897–908, 2006. doi: 10.1038/nrm2060. [DOI] [PubMed] [Google Scholar]
84.Tang EI, Lee WM, Cheng CY. Coordination of actin- and microtubule-based cytoskeletons supports transport of spermatids and residual bodies/phagosomes during spermatogenesis in the rat testis. Endocrinology 157: 1644–1659, 2016. doi: 10.1210/en.2015-1962. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Tang EI, Mok KW, Lee WM, Cheng CY. EB1 regulates tubulin and actin cytoskeletal networks at the sertoli cell blood-testis barrier in male rats: an in vitro study. Endocrinology 156: 680–693, 2015. doi: 10.1210/en.2014-1720. [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Tang EI, Mruk DD, Cheng CY. Regulation of microtubule (MT)-based cytoskeleton in the seminiferous epithelium during spermatogenesis. Semin Cell Dev Biol 59: 35–45, 2016. doi: 10.1016/j.semcdb.2016.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Venkatesh D, Mruk D, Herter JM, Cullere X, Chojnacka K, Cheng CY, Mayadas TN. AKAP9, a regulator of microtubule dynamics, contributes to blood-testis barrier function. Am J Pathol 186: 270–284, 2016. doi: 10.1016/j.ajpath.2015.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Vogl AW, Pfeiffer DC, Mulholland D, Kimel G, Guttman J. Unique and multifunctional adhesion junctions in the testis: ectoplasmic specializations. Arch Histol Cytol 63: 1–15, 2000. doi: 10.1679/aohc.63.1. [DOI] [PubMed] [Google Scholar]
89.Vogl AW, Vaid KS, Guttman JA. The Sertoli cell cytoskeleton. Adv Exp Med Biol 636: 186–211, 2008. doi: 10.1007/978-0-387-09597-4_11. [DOI] [PubMed] [Google Scholar]
90.Wang F, Zhang Q, Cao J, Huang Q, Zhu X. The microtubule plus end-binding protein EB1 is involved in Sertoli cell plasticity in testicular seminiferous tubules. Exp Cell Res 314: 213–226, 2008. doi: 10.1016/j.yexcr.2007.09.022. [DOI] [PubMed] [Google Scholar]
91.Wen Q, Li N, Xiao X, Lui WY, Chu DS, Wong CKC, Lian Q, Ge R, Lee WM, Silvestrini B, Cheng CY. Actin nucleator Spire 1 is a regulator of ectoplasmic specialization in the testis. Cell Death Dis 9: 208, 2018. doi: 10.1038/s41419-017-0201-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Wen Q, Tang EI, Xiao X, Gao Y, Chu DS, Mruk DD, Silvestrini B, Cheng CY. Transport of germ cells across the seminiferous epithelium during spermatogenesis-the involvement of both actin- and microtubule-based cytoskeletons. Tissue Barriers 4: e1265042, 2016. doi: 10.1080/21688370.2016.1265042. [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Wen Q, Wang Y, Tang J, Cheng CY, Liu YX. Sertoli cell Wt1 regulates peritubular myoid cell and fetal Leydig cell differentiation during fetal testis development. PLoS One 11: e0167920, 2016. doi: 10.1371/journal.pone.0167920. [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Wong CH, Mruk DD, Lui WY, Cheng CY. Regulation of blood-testis barrier dynamics: an in vivo study. J Cell Sci 117: 783–798, 2004. doi: 10.1242/jcs.00900. [DOI] [PubMed] [Google Scholar]
95.Xiao X, Mruk DD, Tang EI, Massarwa R, Mok KW, Li N, Wong CK, Lee WM, Snapper SB, Shilo BZ, Schejter ED, Cheng CY. N-wasp is required for structural integrity of the blood-testis barrier. PLoS Genet 10: e1004447, 2014. doi: 10.1371/journal.pgen.1004447. [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Xiao X, Mruk DD, Wong CK, Cheng CY. Germ cell transport across the seminiferous epithelium during spermatogenesis. Physiology (Bethesda) 29: 286–298, 2014. doi: 10.1152/physiol.00001.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Yan HH, Cheng CY. Laminin α 3 forms a complex with β3 and γ3 chains that serves as the ligand for α 6β1-integrin at the apical ectoplasmic specialization in adult rat testes. J Biol Chem 281: 17286–17303, 2006. doi: 10.1074/jbc.M513218200. [DOI] [PubMed] [Google Scholar]
98.Zhao J, Wang Y, Xu H, Fu Y, Qian T, Bo D, Lu YX, Xiong Y, Wan J, Zhang X, Dong Q, Chen XJ. Dync1h1 mutation causes proprioceptive sensory neuron loss and impaired retrograde axonal transport of dorsal root ganglion neurons. CNS Neurosci Ther 22: 593–601, 2016. doi: 10.1111/cns.12552. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B1] 1.Akhmanova A, Steinmetz MO. Control of microtubule organization and dynamics: two ends in the limelight. Nat Rev Mol Cell Biol 16: 711–726, 2015. doi: 10.1038/nrm4084. [DOI] [PubMed] [Google Scholar]

[B2] 2.Akhmanova A, Steinmetz MO. Microtubule +TIPs at a glance. J Cell Sci 123: 3415–3419, 2010. doi: 10.1242/jcs.062414. [DOI] [PubMed] [Google Scholar]

[B3] 3.Alekhina O, Burstein E, Billadeau DD. Cellular functions of WASP family proteins at a glance. J Cell Sci 130: 2235–2241, 2017. doi: 10.1242/jcs.199570. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4.Ananthanarayanan V. Activation of the motor protein upon attachment: anchors weigh in on cytoplasmic dynein regulation. BioEssays 38: 514–525, 2016. doi: 10.1002/bies.201600002. [DOI] [PubMed] [Google Scholar]

[B5] 5.Barisic M, Maiato H. The tubulin code: a navigation system for chromosomes during mitosis. Trends Cell Biol 26: 766–775, 2016. doi: 10.1016/j.tcb.2016.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6.Barlan K, Gelfand VI. Microtubule-based transport and the distribution, tethering, and organization of organelles. Cold Spring Harb Perspect Biol 9: a025817, 2017. doi: 10.1101/cshperspect.a025817. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 8.Bhabha G, Johnson GT, Schroeder CM, Vale RD. How dynein moves along microtubules. Trends Biochem Sci 41: 94–105, 2016. doi: 10.1016/j.tibs.2015.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 9.Bonifacino JS, Neefjes J. Moving and positioning the endolysosomal system. Curr Opin Cell Biol 47: 1–8, 2017. doi: 10.1016/j.ceb.2017.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 10.Bonne D, Heuséle C, Simon C, Pantaloni D. 4′,6-Diamidino-2-phenylindole, a fluorescent probe for tubulin and microtubules. J Biol Chem 260: 2819–2825, 1985. [PubMed] [Google Scholar]

[B10] 11.Byers S, Hadley MA, Djakiew D, Dym M. Growth and characterization of polarized monolayers of epididymal epithelial cells and Sertoli cells in dual environment culture chambers. J Androl 7: 59–68, 1986. doi: 10.1002/j.1939-4640.1986.tb00871.x. [DOI] [PubMed] [Google Scholar]

[B11] 12.Carter AP, Diamant AG, Urnavicius L. How dynein and dynactin transport cargos: a structural perspective. Curr Opin Struct Biol 37: 62–70, 2016. doi: 10.1016/j.sbi.2015.12.003. [DOI] [PubMed] [Google Scholar]

[B12] 13.Chen H, Mruk DD, Xiao X, Cheng CY. Human spermatogenesis and its regulation. In: Male Hypogonadism: Basic, Clinical and Therapeutic Principles, edited by Winters SJ, Huhtaniemi IT. New York: Springer International Publishing, 2017, p. 49–72. doi: 10.1007/978-3-319-53298-1_3. [DOI] [Google Scholar]

[B13] 14.Chen X, Gays D, Milia C, Santoro MM. Cilia control vascular mural cell recruitment in vertebrates. Cell Reports 18: 1033–1047, 2017. doi: 10.1016/j.celrep.2016.12.044. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 15.Chen XJ, Levedakou EN, Millen KJ, Wollmann RL, Soliven B, Popko B. Proprioceptive sensory neuropathy in mice with a mutation in the cytoplasmic dynein heavy chain 1 gene. J Neurosci 27: 14515–14524, 2007. doi: 10.1523/JNEUROSCI.4338-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 16.Cheng CY, Mruk DD. The blood-testis barrier and its implications for male contraception. Pharmacol Rev 64: 16–64, 2012. doi: 10.1124/pr.110.002790. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 17.Cheng CY, Mruk DD. Cell junction dynamics in the testis: Sertoli-germ cell interactions and male contraceptive development. Physiol Rev 82: 825–874, 2002. doi: 10.1152/physrev.00009.2002. [DOI] [PubMed] [Google Scholar]

[B17] 18.Cheng CY, Mruk DD. A local autocrine axis in the testes that regulates spermatogenesis. Nat Rev Endocrinol 6: 380–395, 2010. doi: 10.1038/nrendo.2010.71. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 19.Cheng CY, Mruk DD. Regulation of spermiogenesis, spermiation and blood-testis barrier dynamics: novel insights from studies on Eps8 and Arp3. Biochem J 435: 553–562, 2011. doi: 10.1042/BJ20102121. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 20.Cheng CY, Silvestrini B, Grima J, Mo MY, Zhu LJ, Johansson E, Saso L, Leone MG, Palmery M, Mruk D. Two new male contraceptives exert their effects by depleting germ cells prematurely from the testis. Biol Reprod 65: 449–461, 2001. doi: 10.1095/biolreprod65.2.449. [DOI] [PubMed] [Google Scholar]

[B20] 21.Clermont Y, Morales C, Hermo L. Endocytic activities of Sertoli cells in the rat. Ann N Y Acad Sci 513: 1–15, 1987. doi: 10.1111/j.1749-6632.1987.tb24994.x. [DOI] [PubMed] [Google Scholar]

[B21] 22.de Kretser DM, Kerr JB. The cytology of the testis. In: The Physiology of Reproduction, edited by Knobil E, Neill JB, Ewing LL, Greenwald GS, Markert CL, Pfaff DW. New York: Raven, 1988, vol 1, p. 837–932. [Google Scholar]

[B22] 23.Diviani D, Scott JD. AKAP signaling complexes at the cytoskeleton. J Cell Sci 114: 1431–1437, 2001. [DOI] [PubMed] [Google Scholar]

[B23] 24.Du M, Young J, De Asis M, Cipollone J, Roskelley C, Takai Y, Nicholls PK, Stanton PG, Deng W, Finlay BB, Vogl AW. A novel subcellular machine contributes to basal junction remodeling in the seminiferous epithelium. Biol Reprod 88: 60, 2013. doi: 10.1095/biolreprod.112.104851. [DOI] [PubMed] [Google Scholar]

[B24] 25.Ehmcke J, Wistuba J, Schlatt S. Spermatogonial stem cells: questions, models and perspectives. Hum Reprod Update 12: 275–282, 2006. doi: 10.1093/humupd/dmk001. [DOI] [PubMed] [Google Scholar]

[B25] 26.Firestone AJ, Weinger JS, Maldonado M, Barlan K, Langston LD, O’Donnell M, Gelfand VI, Kapoor TM, Chen JK. Small-molecule inhibitors of the AAA+ ATPase motor cytoplasmic dynein. Nature 484: 125–129, 2012. doi: 10.1038/nature10936. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 27.Galdieri M, Ziparo E, Palombi F, Russo MA, Stefanini M. Pure Sertoli cell cultures: a new model for the study of somatic-germ cell interactions. J Androl 2: 249–254, 1981. doi: 10.1002/j.1939-4640.1981.tb00625.x. [DOI] [Google Scholar]

[B27] 28.Gao Y, Lui WY, Lee WM, Cheng CY. Polarity protein Crumbs homolog-3 (CRB3) regulates ectoplasmic specialization dynamics through its action on F-actin organization in Sertoli cells. Sci Rep 6: 28589, 2016. doi: 10.1038/srep28589. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 29.Gao Y, Mruk DD, Lui WY, Lee WM, Cheng CY. F5-peptide induces aspermatogenesis by disrupting organization of actin- and microtubule-based cytoskeletons in the testis. Oncotarget 7: 64203–64220, 2016. doi: 10.18632/oncotarget.11887. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 31.Guttman JA, Kimel GH, Vogl AW. Dynein and plus-end microtubule-dependent motors are associated with specialized Sertoli cell junction plaques (ectoplasmic specializations). J Cell Sci 113: 2167–2176, 2000. [DOI] [PubMed] [Google Scholar]

[B30] 32.Hancock WO. Bidirectional cargo transport: moving beyond tug of war. Nat Rev Mol Cell Biol 15: 615–628, 2014. doi: 10.1038/nrm3853. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 33.Hermo L, Pelletier RM, Cyr DG, Smith CE. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 1: background to spermatogenesis, spermatogonia, and spermatocytes. Microsc Res Tech 73: 241–278, 2010. doi: 10.1002/jemt.20783. [DOI] [PubMed] [Google Scholar]

[B32] 34.Hermo L, Pelletier RM, Cyr DG, Smith CE. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 2: changes in spermatid organelles associated with development of spermatozoa. Microsc Res Tech 73: 279–319, 2010. doi: 10.1002/jemt.20787. [DOI] [PubMed] [Google Scholar]

[B33] 35.Hess RA, Renato de Franca L. Spermatogenesis and cycle of the seminiferous epithelium. Adv Exp Med Biol 636: 1–15, 2008. doi: 10.1007/978-0-387-09597-4_1. [DOI] [PubMed] [Google Scholar]

[B34] 36.Hess RA, Schaeffer DJ, Eroschenko VP, Keen JE. Frequency of the stages in the cycle of the seminiferous epithelium in the rat. Biol Reprod 43: 517–524, 1990. doi: 10.1095/biolreprod43.3.517. [DOI] [PubMed] [Google Scholar]

[B35] 37.Hew KW, Heath GL, Jiwa AH, Welsh MJ. Cadmium in vivo causes disruption of tight junction-associated microfilaments in rat Sertoli cells. Biol Reprod 49: 840–849, 1993. doi: 10.1095/biolreprod49.4.840. [DOI] [PubMed] [Google Scholar]

[B36] 38.Janecki A, Steinberger A. Polarized Sertoli cell functions in a new two-compartment culture system. J Androl 7: 69–71, 1986. doi: 10.1002/j.1939-4640.1986.tb00873.x. [DOI] [PubMed] [Google Scholar]

[B37] 39.Janke C. The tubulin code: molecular components, readout mechanisms, and functions. J Cell Biol 206: 461–472, 2014. doi: 10.1083/jcb.201406055. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 40.Kaitu’u-Lino TJ, Sluka P, Foo CF, Stanton PG. Claudin-11 expression and localisation is regulated by androgens in rat Sertoli cells in vitro. Reproduction 133: 1169–1179, 2007. doi: 10.1530/REP-06-0385. [DOI] [PubMed] [Google Scholar]

[B39] 41.Koch M, Olson PF, Albus A, Jin W, Hunter DD, Brunken WJ, Burgeson RE, Champliaud MF. Characterization and expression of the laminin γ3 chain: a novel, non-basement membrane-associated, laminin chain. J Cell Biol 145: 605–618, 1999. doi: 10.1083/jcb.145.3.605. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 42.Lanning LL, Creasy DM, Chapin RE, Mann PC, Barlow NJ, Regan KS, Goodman DG. Recommended approaches for the evaluation of testicular and epididymal toxicity. Toxicol Pathol 30: 507–520, 2002. doi: 10.1080/01926230290105695. [DOI] [PubMed] [Google Scholar]

[B41] 43.Latendresse JR, Warbrittion AR, Jonassen H, Creasy DM. Fixation of testes and eyes using a modified Davidson’s fluid: comparison with Bouin’s fluid and conventional Davidson’s fluid. Toxicol Pathol 30: 524–533, 2002. doi: 10.1080/01926230290105721. [DOI] [PubMed] [Google Scholar]

[B42] 44.Lee NP, Mruk DD, Conway AM, Cheng CY. Zyxin, axin, and Wiskott-Aldrich syndrome protein are adaptors that link the cadherin/catenin protein complex to the cytoskeleton at adherens junctions in the seminiferous epithelium of the rat testis. J Androl 25: 200–215, 2004. doi: 10.1002/j.1939-4640.2004.tb02780.x. [DOI] [PubMed] [Google Scholar]

[B43] 45.Li JC, Lee TW, Mruk TD, Cheng CY. Regulation of Sertoli cell myotubularin (rMTM) expression by germ cells in vitro. J Androl 22: 266–277, 2001. doi: 10.1002/j.1939-4640.2001.tb02180.x. [DOI] [PubMed] [Google Scholar]

[B44] 46.Li L, Tang EI, Chen H, Lian Q, Ge R, Silvestrini B, Cheng CY. Sperm release at spermiation is regulated by changes in the organization of actin- and microtubule-based cytoskeletons at the apical ectoplasmic specialization - a study using the adjudin model. Endocrinology 158: 4300–4316, 2017. doi: 10.1210/en.2017-00660. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 47.Li MW, Mruk DD, Lee WM, Cheng CY. Disruption of the blood-testis barrier integrity by bisphenol A in vitro: is this a suitable model for studying blood-testis barrier dynamics? Int J Biochem Cell Biol 41: 2302–2314, 2009. doi: 10.1016/j.biocel.2009.05.016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 48.Li N, Mruk DD, Mok KW, Li MW, Wong CK, Lee WM, Han D, Silvestrini B, Cheng CY. Connexin 43 reboots meiosis and reseals blood-testis barrier following toxicant-mediated aspermatogenesis and barrier disruption. FASEB J 30: 1436–1452, 2016. doi: 10.1096/fj.15-276527. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 49.Li N, Mruk DD, Tang EI, Lee WM, Wong CK, Cheng CY. Formin 1 regulates microtubule and F-actin organization to support spermatid transport during spermatogenesis in the rat testis. Endocrinology 157: 2894–2908, 2016. doi: 10.1210/en.2016-1133. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 50.Li N, Mruk DD, Wong CK, Lee WM, Han D, Cheng CY. Actin-bundling protein plastin 3 is a regulator of ectoplasmic specialization dynamics during spermatogenesis in the rat testis. FASEB J 29: 3788–3805, 2015. doi: 10.1096/fj.14-267997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 51.Li N, Mruk DD, Wong CK, Han D, Lee WM, Cheng CY. Formin 1 regulates ectoplamic specialization in the rat testis through its actin nucleation and bundling activity. Endocrinology 156: 2969–2983, 2015. doi: 10.1210/en.2015-1161. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 52.Lie PP, Chan AY, Mruk DD, Lee WM, Cheng CY. Restricted Arp3 expression in the testis prevents blood-testis barrier disruption during junction restructuring at spermatogenesis. Proc Natl Acad Sci USA 107: 11411–11416, 2010. doi: 10.1073/pnas.1001823107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 53.Lie PP, Cheng CY, Mruk DD. Crosstalk between desmoglein-2/desmocollin-2/Src kinase and coxsackie and adenovirus receptor/ZO-1 protein complexes, regulates blood-testis barrier dynamics. Int J Biochem Cell Biol 42: 975–986, 2010. doi: 10.1016/j.biocel.2010.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 54.Lie PP, Mruk DD, Lee WM, Cheng CY. Cytoskeletal dynamics and spermatogenesis. Philos Trans R Soc Lond B Biol Sci 365: 1581–1592, 2010. doi: 10.1098/rstb.2009.0261. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 55.Lie PP, Mruk DD, Lee WM, Cheng CY. Epidermal growth factor receptor pathway substrate 8 (Eps8) is a novel regulator of cell adhesion and the blood-testis barrier integrity in the seminiferous epithelium. FASEB J 23: 2555–2567, 2009. doi: 10.1096/fj.06-070573. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 56.Liu Z, Steward R, Luo L. Drosophila Lis1 is required for neuroblast proliferation, dendritic elaboration and axonal transport. Nat Cell Biol 2: 776–783, 2000. doi: 10.1038/35041011. [DOI] [PubMed] [Google Scholar]

[B55] 57.Lui WY, Lee WM, Cheng CY. Transforming growth factor β3 regulates the dynamics of Sertoli cell tight junctions via the p38 mitogen-activated protein kinase pathway. Biol Reprod 68: 1597–1612, 2003. doi: 10.1095/biolreprod.102.011387. [DOI] [PubMed] [Google Scholar]

[B56] 58.Ma Y, Yang HZ, Xu LM, Huang YR, Dai HL, Kang XN. Testosterone regulates the autophagic clearance of androgen binding protein in rat Sertoli cells. Sci Rep 5: 8894, 2015. doi: 10.1038/srep08894. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 59.Melkov A, Abdu U. Regulation of long-distance transport of mitochondria along microtubules. Cell Mol Life Sci 75: 163–176, 2018. doi: 10.1007/s00018-017-2590-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 60.Miller MG, Mulholland DJ, Vogl AW. Rat testis motor proteins associated with spermatid translocation (dynein) and spermatid flagella (kinesin-II). Biol Reprod 60: 1047–1056, 1999. doi: 10.1095/biolreprod60.4.1047. [DOI] [PubMed] [Google Scholar]

[B59] 61.Mruk DD, Cheng CY. Enhanced chemiluminescence (ECL) for routine immunoblotting: an inexpensive alternative to commercially available kits. Spermatogenesis 1: 121–122, 2011. doi: 10.4161/spmg.1.2.16606. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 62.Mruk DD, Cheng CY. An in vitro system to study Sertoli cell blood-testis barrier dynamics. Methods Mol Biol 763: 237–252, 2011. doi: 10.1007/978-1-61779-191-8_16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 63.Mruk DD, Cheng CY. Testin and actin are key molecular targets of adjudin, an anti-spermatogenic agent, in the testis. Spermatogenesis 1: 137–146, 2011. doi: 10.4161/spmg.1.2.16449. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 64.Nicholls PK, Harrison CA, Gilchrist RB, Farnworth PG, Stanton PG. Growth differentiation factor 9 is a germ cell regulator of Sertoli cell function. Endocrinology 150: 2481–2490, 2009. doi: 10.1210/en.2008-1048. [DOI] [PubMed] [Google Scholar]

[B63] 65.O’Donnell L. Mechanisms of spermiogenesis and spermiation and how they are disturbed. Spermatogenesis 4: e979623, 2015. doi: 10.4161/21565562.2014.979623. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 66.O’Donnell L, Nicholls PK, O’Bryan MK, McLachlan RI, Stanton PG. Spermiation: the process of sperm release. Spermatogenesis 1: 14–35, 2011. doi: 10.4161/spmg.1.1.14525. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 67.O’Donnell L, O’Bryan MK. Microtubules and spermatogenesis. Semin Cell Dev Biol 30: 45–54, 2014. doi: 10.1016/j.semcdb.2014.01.003. [DOI] [PubMed] [Google Scholar]

[B66] 69.Pizarro-Cerdá J, Chorev DS, Geiger B, Cossart P. The diverse family of Arp2/3 complexes. Trends Cell Biol 27: 93–100, 2017. doi: 10.1016/j.tcb.2016.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 70.Qiu L, Zhang X, Zhang X, Zhang Y, Gu J, Chen M, Zhang Z, Wang X, Wang SL. Sertoli cell is a potential target for perfluorooctane sulfonate-induced reproductive dysfunction in male mice. Toxicol Sci 135: 229–240, 2013. doi: 10.1093/toxsci/kft129. [DOI] [PubMed] [Google Scholar]

[B68] 71.Redenbach DM, Hall ES, Boekelheide K. Distribution of Sertoli cell microtubules, microtubule-dependent motors, and the Golgi apparatus before and after tight junction formation in developing rat testis. Microsc Res Tech 32: 504–519, 1995. doi: 10.1002/jemt.1070320604. [DOI] [PubMed] [Google Scholar]

[B69] 72.Roossien DH, Miller KE, Gallo G. Ciliobrevins as tools for studying dynein motor function. Front Cell Neurosci 9: 252, 2015. doi: 10.3389/fncel.2015.00252. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B70] 73.Rotkopf S, Hamberg Y, Aigaki T, Snapper SB, Shilo BZ, Schejter ED. The WASp-based actin polymerization machinery is required in somatic support cells for spermatid maturation and release. Development 138: 2729–2739, 2011. doi: 10.1242/dev.059865. [DOI] [PubMed] [Google Scholar]

[B71] 74.Russell L. Observations on rat Sertoli ectoplasmic (‘junctional’) specializations in their association with germ cells of the rat testis. Tissue Cell 9: 475–498, 1977. doi: 10.1016/0040-8166(77)90007-6. [DOI] [PubMed] [Google Scholar]

[B72] 75.Russell LD, Peterson RN. Sertoli cell junctions: morphological and functional correlates. Int Rev Cytol 94: 177–211, 1985. doi: 10.1016/S0074-7696(08)60397-6. [DOI] [PubMed] [Google Scholar]

[B73] 76.Samsa LA, Givens C, Tzima E, Stainier DY, Qian L, Liu J. Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish. Development 142: 4080–4091, 2015. doi: 10.1242/dev.125724. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B74] 77.Sasaki S, Mori D, Toyo-oka K, Chen A, Garrett-Beal L, Muramatsu M, Miyagawa S, Hiraiwa N, Yoshiki A, Wynshaw-Boris A, Hirotsune S. Complete loss of Ndel1 results in neuronal migration defects and early embryonic lethality. Mol Cell Biol 25: 7812–7827, 2005. doi: 10.1128/MCB.25.17.7812-7827.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B75] 78.Schlatt S, Ehmcke J. Regulation of spermatogenesis: an evolutionary biologist’s perspective. Semin Cell Dev Biol 29: 2–16, 2014. doi: 10.1016/j.semcdb.2014.03.007. [DOI] [PubMed] [Google Scholar]

[B76] 79.See SK, Hoogendoorn S, Chung AH, Ye F, Steinman JB, Sakata-Kato T, Miller RM, Cupido T, Zalyte R, Carter AP, Nachury MV, Kapoor TM, Chen JK. Cytoplasmic dynein antagonists with improved potency and isoform selectivity. ACS Chem Biol 11: 53–60, 2016. doi: 10.1021/acschembio.5b00895. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B77] 80.Setchell BP, Waites GM. Changes in the permeability of the testicular capillaries and of the ‘blood-testis barrier’ after injection of cadmium chloride in the rat. J Endocrinol 47: 81–86, 1970. doi: 10.1677/joe.0.0470081. [DOI] [PubMed] [Google Scholar]

[B78] 81.Siu MK, Cheng CY. Interactions of proteases, protease inhibitors, and the β1 integrin/laminin γ3 protein complex in the regulation of ectoplasmic specialization dynamics in the rat testis. Biol Reprod 70: 945–964, 2004. doi: 10.1095/biolreprod.103.023606. [DOI] [PubMed] [Google Scholar]

[B79] 82.Siu MK, Wong CH, Lee WM, Cheng CY. Sertoli-germ cell anchoring junction dynamics in the testis are regulated by an interplay of lipid and protein kinases. J Biol Chem 280: 25029–25047, 2005. doi: 10.1074/jbc.M501049200. [DOI] [PubMed] [Google Scholar]

[B80] 83.Soldati T, Schliwa M. Powering membrane traffic in endocytosis and recycling. Nat Rev Mol Cell Biol 7: 897–908, 2006. doi: 10.1038/nrm2060. [DOI] [PubMed] [Google Scholar]

[B81] 84.Tang EI, Lee WM, Cheng CY. Coordination of actin- and microtubule-based cytoskeletons supports transport of spermatids and residual bodies/phagosomes during spermatogenesis in the rat testis. Endocrinology 157: 1644–1659, 2016. doi: 10.1210/en.2015-1962. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B82] 85.Tang EI, Mok KW, Lee WM, Cheng CY. EB1 regulates tubulin and actin cytoskeletal networks at the sertoli cell blood-testis barrier in male rats: an in vitro study. Endocrinology 156: 680–693, 2015. doi: 10.1210/en.2014-1720. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B83] 86.Tang EI, Mruk DD, Cheng CY. Regulation of microtubule (MT)-based cytoskeleton in the seminiferous epithelium during spermatogenesis. Semin Cell Dev Biol 59: 35–45, 2016. doi: 10.1016/j.semcdb.2016.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B84] 87.Venkatesh D, Mruk D, Herter JM, Cullere X, Chojnacka K, Cheng CY, Mayadas TN. AKAP9, a regulator of microtubule dynamics, contributes to blood-testis barrier function. Am J Pathol 186: 270–284, 2016. doi: 10.1016/j.ajpath.2015.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B85] 88.Vogl AW, Pfeiffer DC, Mulholland D, Kimel G, Guttman J. Unique and multifunctional adhesion junctions in the testis: ectoplasmic specializations. Arch Histol Cytol 63: 1–15, 2000. doi: 10.1679/aohc.63.1. [DOI] [PubMed] [Google Scholar]

[B86] 89.Vogl AW, Vaid KS, Guttman JA. The Sertoli cell cytoskeleton. Adv Exp Med Biol 636: 186–211, 2008. doi: 10.1007/978-0-387-09597-4_11. [DOI] [PubMed] [Google Scholar]

[B87] 90.Wang F, Zhang Q, Cao J, Huang Q, Zhu X. The microtubule plus end-binding protein EB1 is involved in Sertoli cell plasticity in testicular seminiferous tubules. Exp Cell Res 314: 213–226, 2008. doi: 10.1016/j.yexcr.2007.09.022. [DOI] [PubMed] [Google Scholar]

[B88] 91.Wen Q, Li N, Xiao X, Lui WY, Chu DS, Wong CKC, Lian Q, Ge R, Lee WM, Silvestrini B, Cheng CY. Actin nucleator Spire 1 is a regulator of ectoplasmic specialization in the testis. Cell Death Dis 9: 208, 2018. doi: 10.1038/s41419-017-0201-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B89] 92.Wen Q, Tang EI, Xiao X, Gao Y, Chu DS, Mruk DD, Silvestrini B, Cheng CY. Transport of germ cells across the seminiferous epithelium during spermatogenesis-the involvement of both actin- and microtubule-based cytoskeletons. Tissue Barriers 4: e1265042, 2016. doi: 10.1080/21688370.2016.1265042. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B90] 93.Wen Q, Wang Y, Tang J, Cheng CY, Liu YX. Sertoli cell Wt1 regulates peritubular myoid cell and fetal Leydig cell differentiation during fetal testis development. PLoS One 11: e0167920, 2016. doi: 10.1371/journal.pone.0167920. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B91] 94.Wong CH, Mruk DD, Lui WY, Cheng CY. Regulation of blood-testis barrier dynamics: an in vivo study. J Cell Sci 117: 783–798, 2004. doi: 10.1242/jcs.00900. [DOI] [PubMed] [Google Scholar]

[B92] 95.Xiao X, Mruk DD, Tang EI, Massarwa R, Mok KW, Li N, Wong CK, Lee WM, Snapper SB, Shilo BZ, Schejter ED, Cheng CY. N-wasp is required for structural integrity of the blood-testis barrier. PLoS Genet 10: e1004447, 2014. doi: 10.1371/journal.pgen.1004447. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B93] 96.Xiao X, Mruk DD, Wong CK, Cheng CY. Germ cell transport across the seminiferous epithelium during spermatogenesis. Physiology (Bethesda) 29: 286–298, 2014. doi: 10.1152/physiol.00001.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B94] 97.Yan HH, Cheng CY. Laminin α 3 forms a complex with β3 and γ3 chains that serves as the ligand for α 6β1-integrin at the apical ectoplasmic specialization in adult rat testes. J Biol Chem 281: 17286–17303, 2006. doi: 10.1074/jbc.M513218200. [DOI] [PubMed] [Google Scholar]

[B95] 98.Zhao J, Wang Y, Xu H, Fu Y, Qian T, Bo D, Lu YX, Xiong Y, Wan J, Zhang X, Dong Q, Chen XJ. Dync1h1 mutation causes proprioceptive sensory neuron loss and impaired retrograde axonal transport of dorsal root ganglion neurons. CNS Neurosci Ther 22: 593–601, 2016. doi: 10.1111/cns.12552. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Dynein 1 supports spermatid transport and spermiation during spermatogenesis in the rat testis

Qing Wen

Elizabeth I Tang

Wing-yee Lui

Will M Lee

Chris K C Wong

Bruno Silvestrini

C Yan Cheng

Abstract

INTRODUCTION

MATERIALS AND METHODS

Animals and ethics statement.

Antibodies.

Table 1.

Isolation and primary Sertoli cell cultures.

Knockdown of Dync1h1 by RNA interference or an inactivation of dynein by inhibitor ciliobrevin D in Sertoli cells cultured in vitro.

Table 2.

Knockdown of Dync1h1 or inactivation of dynein by inhibitor ciliobrevin D in adult rat testes in vivo.

Assessment of Sertoli cell TJ-permeability barrier in vitro.

BTB integrity assay.

MT spin-down assay.

Tubulin polymerization assay.

F-actin spin-down assay.

IF, F-actin staining, and image analysis.

Histological analysis.

RNA extraction, RT-PCR, and qPCR.

Table 3.

Protein lysate preparation, protein estimation, and IB analysis.

Statistical analysis.

RESULTS

Knockdown of dynein 1 by RNAi or its inactivation by inhibitor in Sertoli cells perturbs TJ-barrier function via changes in BTB-associated proteins at the cell-cell interface.

Fig. 1.

Fig. 2.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 perturbs MT organization and polymerization kinetics.

Fig. 3.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 perturbs F-actin organization in Sertoli cells.

Fig. 4.

Knockdown of Dync1h1 or inactivation of dynein 1 by ciliobrevin D in the testis in vivo perturbs spermatogenesis.

Fig. 5.

Fig. 6.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 in the testis in vivo perturbs MT organization through changes in the spatial expression of EB1.

Fig. 7.

Fig. 8.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 in the testis in vivo perturbs F-actin organization.

Fig. 9.

Fig. 10.

Knockdown of Dync1h1 or the use of ciliobrevin D to inactivate dynein 1 in the testis in vivo perturbs distribution of adhesion protein complexes at the BTB, leading to a loss of BTB integrity.

Fig. 11.

F-actin disorganization in the seminiferous epithelium following Dync1h1 knockdown or dynein 1 inactivation by ciliobrevin D is mediated by changes in the spatiotemporal expression of actin regulatory proteins Arp3 and Eps8.

Fig. 12.

DISCUSSION

GRANTS

DISCLOSURES

AUTHOR CONTRIBUTIONS

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases