Summary
Background
Coronary Artery Disease (CAD) is one of the most widespread non-communicable diseases. Vitamin Dbinding protein (VDBP) and its genetic poly morphisms have been highlighted as the susceptible components for CAD. The aim of the present study was to examine the association of VDBP single nucleotide poly morphisms (SNPs) - rs7041 and rs4588 - with CAD susceptibility among the Iranian population.
Methods
A total of 143 men with CAD and 145 healthy age-sex matched controls underwent genotyping for the - rs7041 and rs4588 polymorphisms using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) method. Serum level of 25(OH)D was assayed using microplate colorimetric enzyme immunoassay.
Results
We found a significant association between GG genotype (rs7041) and CAD (p=0.02, OR=0.537 95% CI =0.306-0.944). Regarding rs4588 polymorphism, a significant difference was observed in which the CA genotype (p=0.00032, OR=2.578, 95% CI=1.579-4.208) and allele A (P=0.028, OR=1.491, 95% CI=1.043-2.132) were significantly higher in CAD patients compared to controls. In spite of lower serum levels of 25(OH)D in CAD patients, we found no significant association between these SNPs and Vitamin D serum concentrations.
Conclusion
We concluded that VDBP polymorphisms affect the susceptibility to CAD in Iranian men. Therefore, further studies are required to clarify the association of VDBP phenotypes and its serum levels with CAD.
Keywords: coronary artery disease, polymorphism, vitamin D-binding protein, 25(OH)D
Kratak sadržaj
Uvod
Koronarna arterijska bolest (CAD) jedno je od najrasprostranjenijih hroničnih oboljenja. Vitamin D-vezuju}i protein (VDBP) i njegovi genetski polimorfizmi predočeni su kao podložne komponente za CAD. Cilj ove studije bio je da se ispita povezanost između polimorfizama pojedinačnih nukleotida (SNPs) proteina VDBP –rs7041 i rs4588 i podložnosti CAD u populaciji Iranaca.
Metode
Ukupno 143 muškarca sa CAD i 145 zdravih kontrolnih ispitanika odgovarajućeg uzrasta i pola podvrgnuto je genotipizaciji za polimorfizme –rs7041 i rs4588 pomoću metode lančane reakcije polimeraze odnosno polimorfizama dužine restrikcionih fragmenata (PCR-RFLP). Nivo 25(OH)D u serumu određen je pomoću kolorimetrijskog enzimskog imunoeseja na mikroploči.
Rezultati
Otkrili smo značajnu povezanost između genotipa GG (rs7041) i CAD (p=0,02, OR=0,537 95% CI=0,306– 0,944). [to se tiče polimorfizma rs4588, uočena je značajna razlika, pri ~emu su genotip CA (P=0,00032, OR=2,578, 95% CI=1,579–4,208) i alel A (P=0,028, OR=1,491, 95% CI=1,043–2,132) bili značajno viši kod obolelih od CAD u poređenju s kontrolom. Uprkos nižim serumskim nivoima 25(OH)D kod pacijenata sa CAD, nije otkrivena značajna povezanost između ovih polimorfizama i koncentracija vitamina D u serumu.
Zaključak
Zaključili smo da polimorfizmi VDBP utiču na podložnost CAD kod iranskih muškaraca. Dakle, potrebne su dalje studije kako bi se razjasnila povezanost između fenotipova VDBP i njegovih nivoa u serumu i CAD.
Ključne reči: koronarna arterijska bolest, polimorfizam, vitamin D-vezujuči protein, 25(OH)D
Introduction
Coronary artery disease (CAD) is one of the significant leading causes of morbidity and mortality in the general population around the world (1, 2, 3, 4). Its incidence is rapidly increasing in developing countries such as Iran (5, 6, 7, 8). In spite of sufficient treatments, patients have a considerable mortality rate (7). A number of meta-analyses on prospective and interventional studies have constantly indicated that low circulating 25-hydroxy vitamin D (25(OH)D) points to increased risk of cardiovascular disease and its consequent mortality (9, 10, 11, 12, 13, 14, 15, 16, 17). Studies also reported that the active form of vitamin D is absolutely involved in the regulation of the renin angiotensin aldosterone system and immune system (18).
The presence of the vitamin D receptor (VDR) in almost all organs including the heart has motivated researchers to study the role of this vitamin in the context of general and cardiovascular health (19, 20, 21, 22). Recent studies have focused on the role of its transporter, vitamin D-binding protein (VDBP), which is well known as Gc-globulin. VDBP binds to considerable amounts of the biologically active metabolite 1,25(OH)2D and also 25(OH)D (23). Moreover, VDBP participates in immune regulation, fatty acid carriage, cell differentiation and cell proliferation, apoptosis and anti-angiogenesis (24, 25).
In humans, the VDBP gene is mapped on chromosome 4q12-q13 and consists of 13 exons and 12 introns. This gene is extremely polymorphic, with three major variants and about 124 rare ones (26). Two common point mutations of SNPs, rs7041 and rs4588, found in exon 11, make up three major iso-forms and protein products including GC1F (Asp416, Thr 420; T,C), GC1S (Glu 416, Thr 420; G,C), and GC2 (Asp416, Lys420; T,A) (24, 27). These SNPs have diverse ethnic and geographic distributions and also various levels of protein activity, which affect its vitamin D binding ability and response to vitamin D supplementation (25, 28).
There is evidence that decreased levels of VDBP are associated with low flow in coronary arteries, endothelial disruption and atherosclerosis in patients with normal coronary arteries on coronary angiography (29). Furthermore, reduction in circulating levels of VDBP in young post-MI patients was statistically linked with the number of involved coronary arteries (30).
Although several studies have investigated the associations of 25(OH)D with the risk of CAD, there is a limited number of studies on the associations between VDBP and incidence of CAD. This study was designed to explore the associations of two common VDBP polymorphisms, rs7041 and rs4588, with CAD susceptibility in the Iranian population.
Materials and Methods
Study population
This case-control study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences (Number: IR.SBMU.RAM.REC. 1394.192). The patients recruited in this study were a total of 145 men with the median (IQR) age of 56.8±9.9 that were diagnosed with three vessels CAD. The severity of CAD was determined based on the number of involved vessels with more than 50% stenosis. The patients were candidates for coronary artery bypass graft (CABG) referred to Tehran Heart Center, Tehran, Iran. The patients were under antihypertensive and cholesterol-lowering treatments, while Aspirin was discontinued at least one week befor CABG preparations.
Furthermore, the study included 145 sex-age matched healthy controls with the median (IQR) age of 55.2±14.2 with confirmed 5 to 10 percent stenosis in their coronary arteries referred to the mentioned clinics. The healthy controls were not using antihypertensive and cholesterol-lowering agents. All control subjects were selected after careful inspection by a cardiovascular specialist.
For all subjects, a complete medical history, with questions about smoking habits, history of hypertension and diabetes mellitus, was obtained for their clinical records.
The individuals with diabetes mellitus, malignancy, myocardial infarction, unstable angina, previous coronary intervention, inflammatory diseases and other chronic diseases were not included. Moreover, subjects receiving antioxidant therapy or vitamin D supplement in the previous 12 months, and smokers were not included in the study. Informed consent was obtained from all participants according to the Declaration of Helsinki and accepted codes of the university ethics committee.
Measurements
Systolic and diastolic blood pressures were measured twice on the right arm of the subjects after resting for at least 10 min in a comfortable position (Omron, M6 Comfort HEM-7321-E, Japan). Body Mass Index (BMI) was calculated as weight in kilograms divided by the height in meters squared. The Waist Circumference was taken at the midpoint between the iliac crest and the lower rib margin.
Fasting blood samples were obtained from CAD patients between 6:00 and 7:00 AM into vacutainer tubes before CABG. Fasting blood samples of healthy controls were drawn after angiography. Total Cholesterol (TC), High-Density Lipoprotein Cholesterol (HDL-C), Low Density Lipoprotein Cholesterol (LDL-C), Triglyceride (TG), and Fasting Blood Glucose (FBG) were measured by an enzymatic colorimetric method using commercial kits (Pars Azmon Inc., Iran) on an auto-analyzer (Hitachi 917 Ltd, Tokyo, Japan). Calcium and phosphorus were measured using commercial kits (Griener Diagnostic, Bahlingen, Germany).
VDBP Genotyping
DNA was isolated from peripheral blood leukocytes using a salting out method (31). VDBP genotypes of rs7041 and rs4588 polymorphisms were detected using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) technique. The oligonucleotide primer sequences were obtained from (32) and were confirmed in NCBI (Table I). In each 0.20 mL PCR reaction tube, 1 mL of genomic DNA (∼100 ng/mL), 1 mL of each primer (10 mmol/L), 10 mL of 2× Prime Taq Premix (ampliqon 2× master mix red), and 7 µL ddH2O were added regarding the following protocol: initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s min, and final extension at 72 °C for 5 min. The 483 bp PCR product was digested by relevant restriction enzymes. The DNA fragments 297 and 186 bp for rs7041 obtained by Hae III, and 305 and 178 bp fragments for rs4588 obtained by Sty I, were observed by electrophoresis on 2% agarose gel with red gel staining. Sequencing method was used for random PCR products to confirm the RFLP procedure.
Table I.
Primer sequences of rs7041 and rs4588 polymorphisms.
| SNP primer sequences | |
| Forward | 5’AAATAATGAGCAAATGAAAGAAGAC 3’ |
| Reverse | 5’CAATAACAGCAAAGAAATGAGTAGA 3’ |
Vitamin D circulating levels
The serum levels of 25(OH)D were measured using a competitive ELISA kit (AccuBind® Monobind Inc. Lake Forest, CA 92630, USA, Product code: 7725-300), according to the protocol. The kit measured both 25(OH) D3 and 25(OH) D2. The sensitivity of the kit was 0.67 ng/mL and the within and between assay precision were 4.62% and 5.38%, respectively.
Statistical analysis
Data were analyzed by the statistical software SPSS 20 (SPSS, Chicago, IL). Differences in genotypic and allelic frequencies between patients and controls were reported as percentages and odds ratio (OR) with 95% confidence intervals (CI) and were examined by Chi-Square (χ2) test. Quantitative variables were tested for normality by the Shapiro-Wilk test. The normally distributed variables were expressed as Mean ± SD and tested by t-test or ANOVA, where indicated. The continuous variables without normal distribution were displayed as Median (interquartile range) and tested by Mann-Whitney U or Kruskal-Wallis. P values of less than 0.05 were considered statistically significant. Tests for deviation from the Hardy-Weinberg equilibrium (HWE), haplotypes and linkage disequilibrium (LD) measures were obtained by SHEsis software (33, 34).
Results
In the current study, 143 men with the median (IQR) age of 57 (53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63) with confirmed CAD and also 145 healthy controls with the median (IQR) age of 55 (49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64) underwent genotyping for two SNPs in the VDBP gene. Two cases were excluded due to missing clinical data.
There were no significant differences in median age between the affected patients and controls. The demographic and clinical characteristics and the results of genotype and allele frequencies are given in Tables II and III respectively. Allelic and genotypic frequencies of rs7041 and rs4588 polymorphisms were in the Hardy-Weinberg equilibrium (P>0.05).
Table II.
Anthropometric data and clinical characteristics of CAD patients and Control group.
| Characteristics | CAD | Healthy controls | Mann-Whitney U |
|---|---|---|---|
| Median (IQR) | Median (IQR) | p-value | |
| Age (yr) | 57 (53–63) | 55 (49–64) | 0.058 |
| BMI (kg/m2) | 26 (24–29) | 26 (24–29) | 0.818 |
| WC (cm) | 98 (92–105) | 94 (88–97) | 0.001 |
| FBG (mmol/L) | 5.16 (4.77–5.49) | 5.05 (4.66–5.49) | 0.416 |
| LDL-C (mmol/L) | 2.56 (2.07–3.10) | 2.25 (1.83–2.84) | 0.014 |
| HDL-C (mmol/L) | 0.9 (0.75–1.01) | 1.03 (0.85–1.21) | <0.001 |
| TC (mmol/L) | 4.14 (3.60–4.97) | 3.60 (3.03–4.35) | <0.001 |
| TG (mmol/L) | 1.24 (0.94–1.75) | 1.51 (1.11–2.22) | 0.001 |
| Ca (mmol/L) | 2.25 (2.25–2.50) | 2.25 (2.25–2.25) | 0.842 |
| Phos (mmol/L) | 0.95 (0.81–1.13) | 1.01 (0.84–1.13) | 0.278 |
| 25(OH)D (nmol/L) | 25.38 (15.63–38.56) | 29.66 (20.65–51.88) | 0.018 |
| SBP (mmHg) | 120 (120–130) | 120 (110–120) | 0.048 |
| DBP (mmHg) | 80 (70–80) | 72 (70–80) | 0.041 |
Continuous variables are presented as median (interquartile range: P25–P75).
Differences between cases and controls were obtained based on the Mann-Whitney U test.
CAD, Coronary Artery Disease; BMI, Body Mass Index; WC, Waist Circumference; FBG, Fasting Blood Glucose; HbA1c, Glycated Hemoglobin; Ca, Calcium; Phos, Phosphorus; LDL-C, Low Density Lipoprotein Cholesterol; HDL-C, High Density Lipoprotein Cholesterol; TG, Triglyceride; TC, Total Cholesterol; T2DM, Type 2 Diabetes Mellitus; SBP, Systolic Blood Pressure; DBP, Diastolic Blood Pressure
Table III.
Allelic and genotypic frequencies of rs7041 and rs4588 polymorphisms in CAD patients and control group.
| Alleles/ Genotypes | CAD | Control | |||||
|---|---|---|---|---|---|---|---|
| Models | N (%) | N (%) | OR (95% CI) | p-value* | AIC | ||
| rs4588 | C | allelic | 187 (65.4%) | 214 (73.8%) | Referent | 0.028 | |
| A | 99 (34.6%) | 70 (26.2%) | 1.491 (1.043–2.132) | ||||
| CC | Co-dominant | 50 (35.0%) | 80 (55.2%) | Referent | 0.00032 | 389 | |
| CA | 87 (60.8%) | 54 (37.2%) | 2.578 (1.579–4.208) | ||||
| AA | 6 (4.2%) | 11 (7.6%) | 0.873 (0.535–1.425) | ||||
| CA+AA | Dominant | 93 (65%) | 65 (44.8%) | Referent | 0.001 | 391.3 | |
| CC | 50 (35%) | 80 (55.2%) | 0.437 (0.272–0.702) | ||||
| CC+CA | Recessive | 137 (95.8%) | 134 (92.4%) | Referent | 0.222 | 401.7 | |
| AA | 6 (4.2%) | 11 (7.6%) | 0.534 (0.192–1.484) | ||||
| CC+AA | Over-dominant | 56 (39.2%) | 91 (62.8%) | Referent | <0.001 | 387 | |
| CA | 87 (60.8%) | 54 (37.2%) | 2.617 (1.626–4.219) | ||||
| HWE | 0.655 | ||||||
| rs7041 | T | allelic | 150 (52.4%) | 137 (47.2%) | 0.812 (0.585–1.126) | 0.211 | |
| G | 136 (47.6%) | 153 (52.8%) | Referent | ||||
| TT | Co-dominant | 32 (22.4%) | 33 (22.8%) | 1.590 (0.891–2.837) | 0.070 | 399.9 | |
| TG | 86 (60.1%) | 71 (49.0%) | 1.986 (1.113–3.544) | ||||
| GG | 25 (17.5%) | 41 (28.3%) | Referent | ||||
| TT+TG | Dominant | 118 (82.5%) | 104 (71.7%) | Referent | 0.029 | 398.5 | |
| GG | 25 (17.5%) | 41 (28.3%) | 0.537 (0.306–0.944) | ||||
| TG+GG | Recessive | 111 (77.6) | 112 (77.2%) | Referent | 0.938 | 403.2 | |
| TT | 32 (22.4) | 33 (22.8%) | 0.978 (0.563–1.701) | ||||
| TT+GG | Over-dominant | 57 (39.9%) | 74 (51%) | Referent | 0.057 | 399.6 | |
| TG | 86 (60.1%) | 71 (49%) | 1.572 (0.986–2.506) | ||||
| HWE | 0.831 | ||||||
CAD, Coronary Artery Disease; OR, Odds Ratio; CI, Confidence Interval, AIC, Akaike Information Criterion
Chi-square test; HWE, Hardy-Weinberg Equilibrium test p-value
The WC (P-value = 0.001), HDL-C (P-value < 0.001), LDL-C (P-value = 0.014), TC (P-value <0.001), TG (P-value = 0.001), SBP (P-value = 0.048), DBP (P-value = 0.041) and 25(OH)D serum levels (P-value = 0.018) were significantly different between cases and controls (Table II).
We found significant differences in allelic (A) and genotypic (CA) frequencies for the rs4588 polymorphism (P = 0.028, OR = 1.491, 95% CI = 1.043–2.132 and P = 0.0032, OR = 2.578, 95% CI = 1.579–4.208 respectively) and the GG genotype for rs7041 (P = 0.029, OR = 0.537, 95% CI = 0.306–0.944) (Table III). Further, we analyzed the association of rs4588 genotypes with CAD under four genetic models (co-dominant, dominant, recessive and overdominant) to choose the best fitted model. The AIC (Akaike’s Information Criterion) was calculated. The fitted model of inheritance with the lowest AIC value was over-dominant and dominant for rs4588 and rs7041, respectively.
Moreover, we observed that CA/GG, CA/GT, and CA/TT diplotypes were remarkably linked with CAD. Table V shows that there were no significant associations between demographic and clinical characteristics, with the genotypes of rs7041 and rs4588 polymorphisms.
Table V.
Association of demographic data with genotypic frequencies for rs4588 and rs7041 polymorphisms.
| rs4588 | Kruskal- | rs7041 | Kruskal- | |||||
|---|---|---|---|---|---|---|---|---|
| Characte - | CC | CA | AA | Wallis | TT | TG | GG | Wallis |
| ristics | Median | Median | Median | Median | Median | Median | ||
| p-value | p-value | |||||||
| (IQR) | (IQR) | (IQR) | (IQR) | (IQR) | (IQR) | |||
| 54 | 57 | 58 | 58 | 56 | 57 | |||
| Age (yr) | 0.046 | 0.235 | ||||||
| (50–59) | (52–64) | (52–66) | (52–65) | (51–63) | (51–60) | |||
| 26 | 26 | 26 | 26 | 26 | 27 | |||
| BMI (kg/m2) | 0.482 | 0.350 | ||||||
| (24–29) | (24–29) | (24–26) | (24–28) | (24–29) | (25–29) | |||
| 97 | 96 | 92 | 95 | 96 | 100 | |||
| WC (cm) | 0.209 | 0.375 | ||||||
| (91–105) | (91–102) | (88–96) | (90–99) | (90–103) | (93–105) | |||
| FBG | 5.10 | 5.10 | 4.88 | 5.05 | 5.10 | 5.16 | ||
| 0.706 | 0.713 | |||||||
| (mmol/L) | (4.71–5.49) | (4.665.49) | (85–97) | (4.77–5.55) | (4.66–5.43) | (4.71–5.55) | ||
| LDL-C | 2.35 | 2.46 | 2.40 | 2.66 | 2.30 | 2.35 | ||
| 0.662 | 0.093 | |||||||
| (mmol/L) | (1.96–2.87) | (1.86–3.21) | (1.89–3.15) | (2.14–3.28) | (1.83–2.95) | (2.02–2.79) | ||
| HDL-C | 0.98 | 0.90 | 1.06 | 0.93 | 0.95 | 0.93 | ||
| 0.082 | 0.820 | |||||||
| (mmol/L) | (0.80–1.16) | (0.77–1.03) | (0.90–1.13) | (0.80–1.11) | (0.77–1.13) | (0.75–1.06) | ||
| TC | 3.85 | 4.01 | 4.09 | 4.14 | 3.78 | 4.09 | ||
| 0.621 | 0.075 | |||||||
| (mmol/L) | (3.28–4.61) | (3.18–4.92) | (3.18–4.92) | (3.44–4.97) | (3.13–4.79) | (3.49–4.66) | ||
| TG | 1.33 | 1.41 | 1.29 | 1.41 | 1.38 | 1.29 | ||
| 0.624 | 0.920 | |||||||
| (mmol/L) | (1.02–1.92) | (0.97–2.12) | (0.83–2.09) | (0.96–2.14) | (1–1.94) | (0.99–2.02) | ||
| Ca | 2.25 | 2.25 | 2.25 | 2.25 | 2.25 | 2.25 | ||
| 0.205 | 0.154 | |||||||
| (mmol/L) | (2.25–2.50) | (2.25–2.25) | (2.25–2.25) | (2.25–2.50) | (2.25–2.50) | (2.25–2.25) | ||
| Phos | 0.95 | 0.96 | 1.01 | 0.95 | 0.98 | 0.93 | ||
| 0.381 | 0.253 | |||||||
| (mmol/L) | (0.83–1.11) | (0.84–1.13) | (0.85–1.27) | (0.85–1.09) | (0.82–1.14) | (0.87–1.11) | ||
| 25(OH)D | 26.44 | 27.29 | 22.94 | 24.53 | 26.62 | 32.92 | ||
| 0.816 | 0.233 | |||||||
| (nmol/L) | (19.56–42.67) | (16.28–41.11) | (21.31–58.52) | (16.43–36.89) | (17.79–39.36) | (17.59–55.53) | ||
| SBP | 26.44 | 120 (110– | 120 (115– | 120 (110– | 120 | |||
| 0.997 | 120 (110–120) | 0.386 | ||||||
| (mmHg) | (19.56–42.67) | 130) | 121.5) | 130) | (110–130) | |||
| DBP (mmHg) | 73 (70–80) | 78 (70–80) | 80 (75–80) | 0.491 | 80 (70–80) | 80 (70–80) | (6070 –73) | 0.070 |
Continuous variables are presented as median (interquartile range: P25-P75).
Differences between cases and controls are obtained based on the Mann-Whitney U test.
CAD, Coronary Artery Disease; BMI, Body Mass Index; WC, Waist Circumference
FBG, Fasting Blood Glucose; HbA1c, Glycated Hemoglobin; Ca, Calcium; Phos, Phosphorus;
LDL-C, Low Density Lipoprotein Cholesterol; HDL-C, High Density Lipoprotein Cholesterol;
TG, Triglyceride; TC, Total Cholesterol; T2DM, Type 2 Diabetes Mellitus; SBP, Systolic Blood Pressure;
DBP, Diastolic Blood Pressure
Table IV.
Diplotype frequencies of rs4588 and rs7041 polymorphisms in CAD patients and control group.
| rs4588/rs7041 diplotype | CAD | Control | p-value | OR (95% CI) |
|---|---|---|---|---|
| CC/GG | 18 (11.3%) | 40 (27.6%) | 1 | Referent |
| AA/TT | 3 (1.9%) | 11 (7.6%) | 0.478 | 0.606 (0.151–2.439) |
| CA/GG | 7 (4.4%) | 1 (0.7%) | 0.002 | 15.556 (1.780–135.956) |
| CA/TG | 57 (35.8%) | 40 (27.6%) | 0.001 | 3.167 (1.592–6.299) |
| CA/TT | 23 (14.5%) | 13 (9%) | 0.002 | 3.932 (1.633–9.466) |
| CC/TG | 26 (16.4%) | 31 (21.4%) | 0.108 | 1.864 (0.870–3.995) |
| CC/TT | 6 (3.8%) | 9 (6.2%) | 0.510 | 1.481 (0.458–4.789) |
CAD, Coronary Artery Disease; OR, Odds Ratio; CI, Confidence Interval
Discussion
In this case-control study, we observed that rs4588 A-allele and CA-genotype, and rs 7041 GG-genotype were associated with CAD susceptibility. Moreover, circulating levels of 25(OH)D were significantly lower in CAD patients as compared to healthy controls. However, there was no association between the circulating levels of 25(OH)D and genotypes of rs4588/rs7041. Low circulating levels of 25(OH)D have been linked with the increased risk of CAD, and this relation may differ in various populations (9, 10, 11, 12, 13, 14, 15, 16, 17). Ethnic variations in VDBP polymorphisms might be responsible for the altered bioavailability (25, 28). Several investigations have been conducted to explore the associations of vitamin D with the risk of CAD; however, we still do not know clearly whether VDBP plays a role in the CAD pathogenesis.
The association of rs7041 and rs4588 polymorphisms of the VDBP gene and the risk of several diseases has been the subject of several investigations but the results have been controversial (35, 36, 37, 38). VDBP is the principal factor in determining serum vitamin D concentration, and therefore it has been considered as a critical factor for CAD pathogenesis.
According to our results, rs4588 A-allele and CA-genotype were associated with CAD. On the contrary,
Michos et al. (39) found that rs4588 had no effect on coronary heart disease (CHD) incidence in both black and white races of USA in the AIRC (Atherosclerosis Risk in Communities) study (40). Nissen et al. (41) mentioned that the A-allele of rs4588 was significantly associated with lower serum 25(OH)D concentrations. However, we did not find such links between 25(OH)D circulating levels and rs4588. These discrepancies might be due to the ethnic-based variations in communities. However, Maneechay et al. (42) reported that rs4588 affects 25(OH)D levels. This study revealed an association between the A allele of rs4588 and cancer in men under 60 years of age suffering from colorectal cancer, which is similar to our findings.
We observed significant differences between cases and controls regarding the frequency of rs7041 genotypes. Our findings are in contrast with the Michos et al. study. They showed that there was no main effect of rs7041 on CHD incidence in both white and black races of USA in the AIRC study (42). Moreover, Jorde et al. found no association between CVD risk factors and rs7041 or other GC gene SNPs (43). However, Pamela et al. (39) have revealed that the risk of heart failure (HF) is increased by low circulating levels of 25(OH)D and the rs7041 G allele. These inconsistencies might be explained based on the different pathomechanisms of CAD and HF, sample size and ethnic diversity.
In contrast to several studies, we did not find any significant differences regarding the circulating levels of 25(OH)D among various VDBP genotypes (44, 45, 46). However, Lafi et al. (47) reported that the genotypes TT and TG of rs7041 and AA and AC of rs4588 were linked with lower 25(OH)D levels in healthy Jordanian people. Moreover, in unhealthy patients, merely a variant allele of rs7041 (TT) was associated with higher 25(OH)D levels (47). Similar to our findings, Almesri et al. (48) reported that rs7041 minor allele (G) and rare genotype (GG) did not influence 25(OH)D levels. However, a minor allele of rs4588 (C) was associated with low 25(OH)D plasma levels.
One limitation of this study is that we could not determine the VDBP circulating levels and gene expression. However, our recruited homogeneous samples of Iranian men with confirmed CAD could enable us to make reliable conclusions about the association of VDBP genotypes with CAD.
In conclusion, VDBP polymorphisms affect the susceptibility to CAD among Iranian men. Therefore, further studies are suggested for the association of VDBP phenotypes and its serum levels with CAD. Also, based on the available data reported here, it seems that different populations show different results according to their various forms of these SNPs and there is still a need for further investigation in our region to obtain better explanations.
Acknowledgements
The present study was supported by a grant (1395-9-7181) from Shahid Beheshti University of Medical Sciences, Tehran, Iran. This article was extracted from a MSc thesis. The authors thank Shahid Beheshti Deputy of Research Affairs for funding this project. We would like to thank all participants and also the members of Tehran Heart Center who kindly helped us with this investigation.
Footnotes
Conflict of interest statement The authors stated that they have no conflicts of interest regarding the publication of this article.
References
- 1.Dong H, Li X, Tang Y. Serum Retinol-Binding Protein-4 Level is a High Risk Factor for Coronary Heart Disease in Chinese. Clinical Laboratory. 2014;61:1675. doi: 10.7754/clin.lab.2015.141216. –. [DOI] [PubMed] [Google Scholar]
- 2.Shanaki M, Hossein-Nezhad A, Meshkani R, Beigy M, Shirzad M. Effects of resveratrol on crosstalk between canonical b-catenin/Wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: a case control study. Iranian Journal of Pharma - ceutical Research. 2016;15(3):547. et al. –. [PMC free article] [PubMed] [Google Scholar]
- 3.Rashid MA, Edwards D, Walter FM, Mant J. Medication taking in coronary artery disease: a systematic review and qualitative synthesis. The Annals of Family Medicine. 2014;12(3):224. doi: 10.1370/afm.1620. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.McCullough PA.. Coronary artery disease. Clinical Journal of the American Society of Nephrology. 2007;2(3):611. doi: 10.2215/CJN.03871106. –. [DOI] [PubMed] [Google Scholar]
- 5.Khalili D, Sheikholeslami FH, Bakhtiyari M, Azizi F, Momenan AA, Hadaegh F. The incidence of coronary heart disease and the population attributable fraction of its risk factors in Tehran: a 10-year population-based cohort study. PLOS ONE. 2014;9(27)(8):e105804. doi: 10.1371/journal.pone.0105804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Nizal Sarrafzadegan M, Sadeghi M, Shahram Oveisg - haran M, Marshall T. Incidence of cardiovascular diseases in an Iranian population: the Isfahan Cohort Study. Archives of Iranian Medicine. 2013;16(3):138. [PubMed] [Google Scholar]
- 7.Kazemi T, Sharifzadeh G, Zarban A, Fesharakinia A. Comparison of components of metabolic syndrome in premature myocardial infarction in an Iranian population: a case-control study. International Journal of Pre - ventive Medicine. 2013;4(1):110. [PMC free article] [PubMed] [Google Scholar]
- 8.Kazemi T, Sharifzadeh G, Javadinia SA, Salehiniya H. Prevalence of Cardiovascular Risk Factors among Nurse Population in the East of Iran. 2011. International Journal of Travel Medicine and Global Health 2015. 3(26)(4):133. –. [Google Scholar]
- 9.Wang L, Song Y, Manson JE, Pilz S, März W, Michaëlsson K. Circulating 25-hydroxy-vitamin D and risk of cardiovascular disease a meta-analysis of prospective studies. Circulation: Cardiovascular Quality and Outcomes. 2012;5(6):819. doi: 10.1161/CIRCOUTCOMES.112.967604. et al. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Brøndum-Jacobsen P, Benn M, Jensen GB, Nordestgaard BG. 25-hydroxyvitamin D levels and risk of ischemic heart disease, myocardial infarction, and early death population-based study and meta-analyses of 18 and 17 studies. Arteriosclerosis, Thrombosis, and Vascular Biology. 2012;32(11):2794. doi: 10.1161/ATVBAHA.112.248039. –. [DOI] [PubMed] [Google Scholar]
- 11.Sokol SI, Tsang P, Aggarwal V, Melamed ML, Srinivas V. Vitamin D status and risk of cardiovascular events: lessons learned via systematic review and meta-analysis. Cardiology in Review. 2011;19(4):192. doi: 10.1097/CRD.0b013e31821da9a5. –. [DOI] [PubMed] [Google Scholar]
- 12.Pittas AG, Chung M, Trikalinos T, Mitri J, Brendel M, Patel K. Systematic review: vitamin D and cardiometabolic outcomes. Annals of Internal Medicine. 2010;152(5):307. doi: 10.1059/0003-4819-152-5-201003020-00009. et al. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Tomson J, Emberson J, Hill M, Gordon A, Armitage J, Shipley M. Vitamin D and risk of death from vascular and non-vascular causes in the Whitehall study and meta-analyses of 12 000 deaths. European Heart Journal. 2013;34(18):1365. doi: 10.1093/eurheartj/ehs426. et al. –. [DOI] [PubMed] [Google Scholar]
- 14.Fan H, Yu W, Cao H, Li J, Liu B, Wang J. Metaanalysis of circulating 25-hydroxyvitamin D levels and risk of cardiovascular and all-cause mortality in elderly population. International Journal of Cardiology. 2014;176(3):1025. doi: 10.1016/j.ijcard.2014.07.074. et al. [DOI] [PubMed] [Google Scholar]
- 15.Chowdhury R, Kunutsor S, Vitezova A, Oliver-Williams C, Chowdhury S, Kiefte-de-Jong JC. Vitamin D and risk of cause specific death: systematic review and metaanalysis of observational cohort and randomised intervention studies. BMJ. 2014;190(1):1. doi: 10.1136/bmj.g1903. et al. 348: g. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Theodoratou E, Tzoulaki I, Zgaga L, Ioannidis JP. Vitamin D and multiple health outcomes: umbrella review of systematic reviews and meta-analyses of observational studies and randomised trials. BMJ. 2014;348(1):1-19. doi: 10.1136/bmj.g2035. g2035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Schöttker B, Jorde R, Peasey A, Thorand B, Jansen EH, de Groot L. Vitamin D and mortality: meta-analysis of individual participant data from a large consortium of cohort studies from Europe and the United States. BMJ. 2014;17(348):1-15. doi: 10.1136/bmj.g3656. et al. g3656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pérez-Hernández N, Aptilon-Duque G, Nostroza-Her - nán dez MC, Vargas-Alarcón G, Rodríguez-Pérez JM, Blachman-Braun R. Vitamin D and its effects on cardiovascular diseases: a comprehensive review. The Korean Journal of Internal Medicine. 2016;31(6):1018. doi: 10.3904/kjim.2015.224. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bonelli P, Buonocore R, Aloe R, Lippi G. Blood sampling seasonality as an important preanalytical factor for assessment of vitamin D status. J Med Biochem. 2016;35:113. doi: 10.1515/jomb-2015-0014. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pludowski P, Holick MF, Pilz S, Wagner CL, Hollis BW, Grant WB. Vitamin D effects on musculoskeletal health, immunity, autoimmunity, cardiovascular disease, cancer, fertility, pregnancy, dementia and mortality-a review of recent evidence. Autoimmunity Reviews. 2013;12(10):976. doi: 10.1016/j.autrev.2013.02.004. et al. –. [DOI] [PubMed] [Google Scholar]
- 21.Rosen CJ, Adams JS, Bikle DD, Black DM, Demay MB, Manson JE. The nonskeletal effects of vitamin D: an Endocrine Society scientific statement. Endocrine Reviews. 2012;33(3):456. doi: 10.1210/er.2012-1000. et al. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Holick MF. Vitamin D deficiency. New England Journal of Medicine. 2007;357(3):266. doi: 10.1056/NEJMra070553. –. [DOI] [PubMed] [Google Scholar]
- 23.Daiger SP, Schanfield MS, Cavalli-Sforza L. Group-specific component (Gc) proteins bind vitamin D and 25- hydroxyvitamin D. Proceedings of the National Academy of Sciences. 1975;72(6):2076. doi: 10.1073/pnas.72.6.2076. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chishimba L, Thickett D, Stockley R, Wood A. The vitamin D axis in the lung: a key role for vitamin D-binding protein. Thorax. 2010;65(5):456. doi: 10.1136/thx.2009.128793. –. [DOI] [PubMed] [Google Scholar]
- 25.Speeckaert M, Huang G, Delanghe JR, Taes YE. Biological and clinical aspects of the vitamin D binding protein (Gc-globulin) and its polymorphism. Clinica Chimica Acta. 2006;372(1):33. doi: 10.1016/j.cca.2006.03.011. –. [DOI] [PubMed] [Google Scholar]
- 26.Cleve H, Constans J. The Mutants of the Vita min D Binding Protein: More than 120 Variants of the GC/DBP System. Vox Sanguinis. 1988;54(4):215. doi: 10.1111/j.1423-0410.1988.tb03908.x. –. [DOI] [PubMed] [Google Scholar]
- 27.Wood A, Bassford C, Webster D, Newby P, Rajesh P, Stockley R. Vitamin D-binding protein contributes to COPD by activation of alveolar macrophages. Thorax. 2011;66(3):205. doi: 10.1136/thx.2010.140921. et al. –. [DOI] [PubMed] [Google Scholar]
- 28.Fu L, Yun F, Oczak M, Wong BY, Vieth R, Cole DE. Common genetic variants of the vitamin D binding protein (DBP) predict differences in response of serum 25- hydroxyvitamin D [25 (OH) D] to vitamin D supplementation. Clinical Biochemistry. 2009;42(10):1174. doi: 10.1016/j.clinbiochem.2009.03.008. –. [DOI] [PubMed] [Google Scholar]
- 29.Oz F, Cizgici AY, Oflaz H, Elitok A, Karaayvaz EB, Merca - noglu F. Impact of vitamin D insufficiency on the epicardial coronary flow velocity and endothelial function. Coronary Artery Disease. 2013;24(5):392. doi: 10.1097/MCA.0b013e328362b2c8. et al. –. [DOI] [PubMed] [Google Scholar]
- 30.Rocchiccioli S, Andreassi MG, Cecchettini A, Carpe - ggiani C, L’Abbate A, Citti L. Correlation between vitamin D binding protein expression and angiographic-proven coronary artery disease. Coronary Artery Disease. 2012;23(7):426. doi: 10.1097/MCA.0b013e328358781c. –. [DOI] [PubMed] [Google Scholar]
- 31.Mohammadoo-Khorasani M, Salimi S, Tabatabai E, Sandoughi M, Zakeri Z, Farajian-Mashhadi F. Interleukin- 1b (IL-1b) & IL-4 gene polymorphisms in patients with systemic lupus erythematosus (SLE) & their association with susceptibility to SLE. The Indian Journal of Medical Research. 2016;143(5):591. doi: 10.4103/0971-5916.187107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Li F, Jiang L, Willis-Owen SA, Zhang Y, Gao J. Vitamin D binding protein variants associate with asthma susceptibility in the Chinese Han population. BMC Medical Genetics. 2011;12(1):1. doi: 10.1186/1471-2350-12-103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Li Z, Zhang Z, He Z, Tang W, Li T, Zeng Z. A partition- ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHEsis (http://analysis.bio-x.cn) Cell Res. 2009;19(4):519. doi: 10.1038/cr.2009.33. et al. –. [DOI] [PubMed] [Google Scholar]
- 34.Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construc- tion, and genetic association at polymorphism loci. Cell Res. 2005;15(2):97. doi: 10.1038/sj.cr.7290272. –. [DOI] [PubMed] [Google Scholar]
- 35.Gouni-Berthold I, Krone W, Berthold HK. Vitamin D, cardiovascular disease Current Vascular Pharmacology. 2009;7(3):414. doi: 10.2174/157016109788340686. –. [DOI] [PubMed] [Google Scholar]
- 36.Chen H, Zhang L, He Z, Zhong X, Zhang J, Li M. Vitamin D binding protein gene polymorphisms and chronic obstructive pulmonary disease: a meta-analysis. Journal of Thoracic Disease. 2015;7(8):1423. doi: 10.3978/j.issn.2072-1439.2015.08.16. et al. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Pehlevan OS, Karatekin G, Koksal V, Benzer D, Gursoy T, Yavuz T. Association of vitamin D binding protein polymorphisms with bronchopulmonary dysplasia: a case-control study of gc globulin and bronchopulmonary dysplasia. Journal of Perinatology. 2015;35(9):763. doi: 10.1038/jp.2015.58. et al. –. [DOI] [PubMed] [Google Scholar]
- 38.Grzegorzewska AE, Ostromecki G, Mostowska A, Sowinska A, Jagodzinski PP. Clinical aspects of vitamin Dbinding protein gene polymorphisms in hemodialysis patients. Pol Arch Med Wewn. 2015;125:8. doi: 10.20452/pamw.2636. –. [DOI] [PubMed] [Google Scholar]
- 39.Michos ED, Misialek JR, Selvin E, Folsom AR, Pankow JS, Post WS. 25-hydroxyvitamin D levels, vitamin D binding protein gene polymorphisms and incident coronary heart disease among whites and blacks: the ARIC study. Atherosclerosis. 2015;241(1):12. doi: 10.1016/j.atherosclerosis.2015.04.803. et al. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Lutsey PL, Michos ED, Misialek JR, Pankow JS, Loehr L, Selvin E. Race and vitamin D binding protein gene polymorphisms modify the association of 25-hydroxyvitamin D and incident heart failure: the ARIC (Athero scle - rosis Risk in Communities) study. JACC: Heart Failure. 2015;3(5):347. doi: 10.1016/j.jchf.2014.11.013. et al. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Nissen J, Rasmussen LB, Ravn-Haren G, Andersen EW, Hansen B, Andersen R. Common variants in CYP2R1 and GC genes predict vitamin D concentrations in healthy Danish children and adults. PLOS ONE. 2014;9(2):e89907. doi: 10.1371/journal.pone.0089907. et al. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Maneechay W, Boonpipattanapong T, Kanngurn S, Puttawibul P, Geater SL, Sangkhathat S. Single Nucleo - tide Polymorphisms in the Gc Gene for Vitamin D Binding Protein in Common Cancers in Thailand. Asian Pacific Journal of Cancer Prevention. 2015;16(8):3339. doi: 10.7314/apjcp.2015.16.8.3339. –. [DOI] [PubMed] [Google Scholar]
- 43.Jorde R, Schirmer H, Wilsgaard T, Joakimsen RM, Mathiesen EB, Njølstad I. Polymorphisms Related to the Serum 25-Hydroxyvitamin D Level and Risk of Myocardial Infarction, Diabetes, Cancer and Mortality. The Tromsø Study. PLOS ONE. 2012;7(5):e37295. doi: 10.1371/journal.pone.0037295. et al. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Ismail MF, Elnady HG, Fouda EM. Genetic variants in vitamin D pathway in Egyptian asthmatic children: a pilot study. Human Immunology. 2013;74(12):1659. doi: 10.1016/j.humimm.2013.08.284. –. [DOI] [PubMed] [Google Scholar]
- 45.Muindi JR, Adjei AA, Wu ZR, Olson I, Huang H, Groman A. Serum vitamin D metabolites in colorectal cancer patients receiving cholecalciferol supplementation: correlation with polymorphisms in the vitamin D genes. Hormones and Cancer. 2013;4(4):242. doi: 10.1007/s12672-013-0139-9. et al. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Cervellin G, Salvagno G, Bonfanti L, Bonelli P, Cesare Guidi G, Lippi G. Association of hyponatremia and hypovitaminosis D in ambulatory adults. J Med Biochem. 2015;34:450. doi: 10.1515/jomb-2015-0003. –. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Lafi ZM, Irshaid YM, El-Khateeb M, Ajlouni KM, Hyassat D. Association of rs7041 and rs4588 Polymorphisms of the Vitamin D Binding Protein and the rs10741657 Polymorphism of CYP2R1 with Vitamin D Status Among Jordanian Patients. Genetic Testing and Molecular Biomarkers. 2015;19(11):629. doi: 10.1089/gtmb.2015.0058. –. [DOI] [PubMed] [Google Scholar]
- 48.Almesri N, Das NS, Ali ME, Gumaa K, Giha HA. Inde - pendent associations of polymorphisms in vitamin D binding protein (GC) and vitamin D receptor (VDR) genes with obesity and plasma 25OHD3 levels demonstrate sex dimorphism. Applied Physiology, Nutrition, and Metabolism. 2015;41(4):345. doi: 10.1139/apnm-2015-0284. –. [DOI] [PubMed] [Google Scholar]
