Bacterial phosphothreonine lyases have been identified to be type III secretion system (T3SS) effectors that irreversibly dephosphorylate host mitogen-activated protein kinase (MAPK) signaling to promote infection. However, the effects of phosphothreonine lyase on nuclear factor κB (NF-κB) signaling remain largely unknown.
KEYWORDS: MAPKs, MSK1, phosphothreonine lyase, p65 degradation
ABSTRACT
Bacterial phosphothreonine lyases have been identified to be type III secretion system (T3SS) effectors that irreversibly dephosphorylate host mitogen-activated protein kinase (MAPK) signaling to promote infection. However, the effects of phosphothreonine lyase on nuclear factor κB (NF-κB) signaling remain largely unknown. In this study, we detected significant phosphothreonine lyase-dependent p65 degradation during Edwardsiella piscicida infection in macrophages, and this degradative effect was blocked by the protease inhibitor MG132. Further analysis revealed that phosphothreonine lyase promotes the dephosphorylation and ubiquitination of p65 by inhibiting the phosphorylation of mitogen- and stress-activated protein kinase-1 (MSK1) and by inhibiting the phosphorylation of extracellular signal-related kinase 1/2 (ERK1/2), p38α, and c-Jun N-terminal kinase (JNK). Moreover, we revealed that the catalytic active site of phosphothreonine lyase plays a critical role in regulating the MAPK-MSK1-p65 signaling axis. Collectively, the mechanism described here expands our understanding of the pathogenic effector in not only regulating MAPK signaling but also regulating p65. These findings uncover a new mechanism by which pathogenic bacteria overcome host innate immunity to promote pathogenesis.
INTRODUCTION
Bacterial phosphothreonine lyases are specialized type III secretion system (T3SS) effectors that specifically inactivate mitogen-activated protein kinase (MAPK) signaling pathways by removing phosphate from phosphothreonine in the pT-X-pY motif (1). Recently, a series of phosphothreonine lyases that includes OspF from Shigella spp., SpvC from Salmonella species, HopAl1 from the plant pathogen Pseudomonas syringae, and EseH from the fish pathogen Edwardsiella piscicida was identified (2–8). These effectors specifically abrogate the phosphorylation and activation of extracellular signal-related kinase 1/2 (ERK1/2), p38α, and c-Jun N-terminal kinase (JNK) signaling, thereby dampening the host immune response to bacterial infection.
In addition to the MAPK pathway, the nuclear factor κB (NF-κB) pathway is a central signaling cascade that is essential for the host immune response (9). Several pathogens also deliver a repertoire of T3SS effectors to interfere with NF-κB signaling to facilitate infection. For example, the Salmonella T3SS effector SpvD prevents the nuclear accumulation of p65 to suppress the production of proinflammatory cytokines (10), and the protease effectors PipA, GtgA, and GogA can inhibit NF-κB signaling by the direct degradation of p65 (11). Moreover, NleC from enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic Escherichia coli (EHEC) is a zinc metalloprotease that suppresses NF-κB activation by degrading p65 (12, 13). In addition to these nonphosphothreonine lyase members, OspF was also found to effectively potentiate the degradation of IκBα after tumor necrosis factor alpha (TNF-α) stimulation by disrupting the p38/TAK1 negative-feedback loop (14). Thus, these results suggest a bifurcated role of bacterial phosphothreonine lyases in regulating NF-κB signaling, which needs to be further clarified.
E. piscicida is a fish pathogen with a broad host range that causes gastrointestinal septicemia in fish and wound infections in humans (15–17). Recently, we identified a T3SS effector, EseH, to be a phosphothreonine lyase that interferes with host ERK1/2, p38α, and JNK-MAPK pathways during E. piscicida infection (8). This promotes E. piscicida virulence and colonization in a zebrafish infection model (8). Although we did not detect an effect on IκBα degradation, whether this newly identified phosphothreonine lyase could interfere with other elements of NF-κB signaling remains unknown. In this study, we observed significant phosphothreonine lyase-dependent p65 degradation during E. piscicida infection in macrophages, and we reveal that phosphothreonine lyase promotes the dephosphorylation and ubiquitination of p65 by inhibiting the phosphorylation of mitogen- and stress-activated protein kinase-1 (MSK1) in an MAPK-dependent manner. Moreover, we demonstrate that the catalytic active site of phosphothreonine lyase plays a critical role in regulating the MAPK-MSK1-p65 signaling axis. These findings suggest that the pathogenic phosphothreonine lyase can interfere not only with MAPK signaling but also with p65 signaling.
RESULTS
EseH promotes p65 degradation during E. piscicida infection.
To investigate the effect of the newly identified phosphothreonine lyase, EseH, during E. piscicida infection, J774A.1 macrophages were infected with the E. piscicida wild-type, ΔeseH mutant, and ΔeseH::pEseH complemented mutant strains. First, we found that the transcription of interleukin-8 (IL-8) was significantly upregulated in J774A.1 cells infected with the ΔeseH mutant (Fig. 1A). Since IL-8 is an important chemokine produced by macrophages and other cell types (18) and its expression is regulated by the NF-κB pathway (19), we stepped forward to analyze the expression level of p65 and p50, the other key subunits of the NF-κB pathway (20). We found that the p65 abundance in J774A.1 cells was reduced in cells infected with the E. piscicida wild-type or ΔeseH::pEseH strain but not in those infected with the ΔeseH strain, while the p50 abundance was not affected during E. piscicida infection (Fig. 1B). These results indicate that EseH might play a critical role in p65 degradation during E. piscicida infection. To further investigate the role of EseH in regulating the transcription level of p65 in this process, we found a comparable level of mRNA expression before and after E. piscicida infection (Fig. 1C). Moreover, we found a comparable level of p65 mRNA expression in EseH-transfected HEK293T cells (Fig. 1D). Taken together, the results suggest that EseH-mediated p65 degradation occurs through posttranslational modification during infection.
FIG 1.
EseH promotes p65 degradation during E. piscicida infection. (A) Expression of IL-8 in J774A.1 cells infected with the E. piscicida wild-type, ΔeseH, and eseH-complemented strains. PBS-treated cells were used as a control. The experiments were performed in triplicate for each group. Error bars indicate the SD for technical replicates. *, P < 0.05. (B) Immunoblotting analysis of p65 expression. J774A.1 cells were infected with the E. piscicida wild-type, ΔeseH, and ΔeseH::pEseH strains at an MOI of 10 for 3.5 h. Cell lysates were probed with anti-p65, anti-p50, and anti-β-actin antibodies. All the densitometry data (presented beneath the gels) were compared to those for the control (for which the densitometry value was set equal to 100). The signal intensities were quantitatively analyzed by ImageJ software, and the data (means ± SD) are representative of those from at least three experiments. *, P < 0.05. (C and D) qPCR analysis of p65 expression during the indicated E. piscicida infection (C) or EseH transfection (D). Total RNA samples were analyzed by using the p65-specific or β-actin-specific primers. Data are representative of those from at least 3 experiments.
Phosphothreonine lyases promote p65 ubiquitination-mediated degradation.
To further confirm the role of phosphothreonine lyases in mediating p65 degradation, we cotransfected HEK293T cells with plasmids producing EseH-hemagglutinin (HA) and p65-Flag and observed a comparable reduced abundance of p65, indicating that EseH can promote p65 degradation in the absence of MG132 treatment (Fig. 2A). Furthermore, we evaluated the role of another phosphothreonine lyase-family protein, OspF from Shigella, and also detected the degradation of p65 (Fig. 2A). Since the catalytic enzyme active sites of phosphothreonine lyases are critical for regulating MAPK signaling cascades (4, 8), we cotransfected HEK293T cells with plasmids producing EseH with a K79R, H81R, or K111A mutation and p65. We found that the p65 abundance was not significantly reduced compared with that in cells transfected with wild-type EseH (Fig. 2B). Meanwhile, the indicated OspF mutants (K102R, H104A, or K134A) did not promote the degradation of p65 (Fig. 2C). Taken together, these results indicate that phosphothreonine lyases promote p65 degradation, which was dependent on their catalytic activity.
FIG 2.
Phosphothreonine lyases promote p65 degradation. (A) HEK293T cells were cotransfected with p65-Flag and EseH-HA or OspF-HA with or without MG132. Cell lysates were collected and probed for anti-Flag, anti-HA, and anti-β-actin antibodies. (B) HEK293T cells were cotransfected with p65-Flag and EseH-HA or the indicated mutants. Cell lysates were collected and probed for anti-Flag, anti-HA, and anti-β-actin antibodies. (C) HEK293T cells were cotransfected with p65-Flag and OspF-HA or the indicated mutants. Cell lysates were collected and probed for anti-Flag, anti-HA, and anti-β-actin antibodies. All the densitometry data (presented beneath the gels) were compared to those for the control (for which the densitometry value was set equal to 100). The data (means ± SD) are representative of those from at least three experiments. The signal intensities were quantitatively analyzed by ImageJ software. *, P < 0.05.
When detecting the expression of exogenous p65 in our transient-expression model, we conducted a parallel experiment for each group treated with MG132, a protease inhibitor (21), and found that the degradation of p65 by both EseH and OspF was impaired in the presence of MG132, which suggests that phosphothreonine lyase-mediated p65 degradation may occur through ubiquitination (Fig. 2A). To confirm this hypothesis, we cotransfected plasmids producing EseH-enhanced green fluorescent protein (EGFP) or OspF-EGFP, p65-Flag, and pRK5-HA-ubiquitin-48 into HEK293T cells, and the cells were administered MG132 to inhibit the degradation of p65. When utilizing the anti-HA-specific antibody to analyze the ubiquitination level of p65, as described in previous studies (22, 23), we found that p65 was increasingly ubiquitinated in the presence of either EseH or OspF, suggesting that phosphothreonine lyase can promote the ubiquitination of p65 (Fig. 3A and B). Furthermore, when we mutated either EseH or OspF at their enzyme catalytic active sites, as in the assay whose results are presented in Fig. 2, the ubiquitinated p65 was comparatively reduced (Fig. 3A and B). Thus, these results suggest that the bacterial phosphothreonine lyase may play an important role in promoting the ubiquitination of p65 to mediate its degradation.
FIG 3.
Phosphothreonine lyases promote p65 ubiquitination. (A) HEK293T cells were cotransfected with p65-Flag, ubiquitin-HA, and the indicated EseH. MG132 was added to protect the exogenous p65 from degradation. Cell lysates were immunoprecipitated (IP) with anti-Flag beads and then analyzed by immunoblotting with anti-HA, anti-Flag, or anti-EGFP antibodies. (B) HEK293T cells were cotransfected with p65-Flag, ubiquitin (Ubi)-HA, and the indicated OspF. MG132 was added to protect the exogenous p65 from degradation. Cell lysates were immunoprecipitated with anti-Flag beads and then analyzed by immunoblotting with anti-HA, anti-Flag, or anti-EGFP antibodies. The data (means ± SD) are representative of those from at least three experiments. The signal intensities were quantitatively analyzed by NIH ImageJ software.
Phosphothreonine lyase inhibits p65 phosphorylation by inhibiting MAPK-MSK1 axis activation.
When the effectors are delivered into host cells during bacterial infection, MAPKs are the direct targets of phosphothreonine lyases (2–8). MSK1 is a kinase downstream of MAPKs (24) and is directly activated by ERK1/2 and p38α by phosphorylation at Ser360 (25), which is responsible for p65 phosphorylation to maintain its stability (26). To confirm that the activation of MSK1 is regulated by the activation of MAPK, we treated the cells with specific inhibitors (27–29). When we treated the cells with U0126 and SB208530, inhibitors of ERK1/2 and p38, respectively, we consistently found a significant inhibition of the phosphorylation of MSK1 (Fig. 4A and B). Interestingly, we also observed a significant inhibition of MSK1 phosphorylation following treatment with SP600125, a specific JNK inhibitor (Fig. 4C). Taken together, our results indicate that the phosphorylation of MSK1 can be inhibited by the inhibition of MAPK activation.
FIG 4.
Phosphothreonine lyases inhibit the phosphorylation of MSK1. (A to C) J774A.1 cells were pretreated with 10 μM U0126 (A), 10 μM SB208530 (B), or 10 μM SP600125 (C), and then TNF-α was administered for 2 h. Cell lysates were probed with anti-phospho-ERK1/2, anti-phospho-p38α, anti-phospho-JNK, anti-phospho-MSK1 (Ser360), and anti-MSK1. β-Actin was probed as a control. (D) J774A.1 cells were infected with the E. piscicida wild-type, ΔeseH, and ΔeseH::pEseH strains at an MOI of 10 for 3.5 h. Cell lysates were collected and probed with anti-phospho-MSK1 (Ser360), anti-MSK1, anti-phospho-ERK1/2, anti-p38α, anti-phospho-JNK, and anti-β-actin antibodies. (E and F) HEK293T cells were cotransfected with the indicated EseH-HA (E) or the indicated OspF-HA (F), and then the cells were treated with TNF-α for 2 h. Cell lysates were collected and probed with anti-MSK1, anti-phospho-MSK1, anti-HA, anti-β-actin, anti-phospho-ERK1/2, anti-phospho-p38α, and anti-phospho-JNK antibodies. All the densitometry data (presented beneath the gels) were compared to those for the control (for which the densitometry value was set equal to 100). The data (mean ± SD) are representative of those from at least three experiments. The signal intensities were quantitatively analyzed by ImageJ software. *, P < 0.05.
Based on the results presented above, we hypothesized that the phosphothreonine lyase-mediated p65 ubiquitination and degradation occur through the MAPK-MSK1 signaling pathway. To confirm this, we first verified the phosphorylation of ERK1/2, p38α, and JNK in macrophages during E. piscicida infection. Consistent with previous results (8), EseH could inhibit the phosphorylation of these MAPKs (Fig. 4D), and the enzyme catalytic active site was critical for regulating this process (Fig. 4E). Thus, we analyzed whether phosphothreonine lyase inhibited the phosphorylation of MSK1. We found that the phosphorylation of MSK1 was inhibited upon infection with the E. piscicida wild-type or ΔeseH::pEseH strain but not with the ΔeseH mutant (Fig. 4D). To analyze whether phosphothreonine lyase can directly affect the phosphorylation of MSK1, we cotransfected HEK293T cells with plasmids producing EseH and its mutants (the K79R, H81R, or K111A mutant) and then administered TNF-α to the cells. We found that the phosphorylation of MSK1 was inhibited by EseH but not by the indicated mutants (Fig. 4E). Consistently, OspF, but not its mutants, could also inhibit the phosphorylation of MSK1 (Fig. 4F). Taken together, these results suggest that phosphothreonine lyase can inhibit the phosphorylation of MSK1.
Phosphothreonine lyase inhibits p65 phosphorylation to promote its ubiquitination.
The phosphorylation of MSK1 leads to the direct phosphorylation of p65 at Ser276, thereby preventing p65 from degradation (30). Moreover, the p65 S276A mutant is degraded by the ubiquitin-proteasome machinery (31). Thus, to further test the hypothesis that phosphothreonine lyase-mediated p65 degradation is associated with the dephosphorylation and ubiquitination of p65, we first evaluated whether the inactive MAPKs could inhibit p65 phosphorylation. We first analyzed the phosphorylation of MSK1 during MAPK- and MSK1-specific inhibitor treatment. Cells were treated with MG132 to protect against p65 degradation. We found that the p65 abundance in each group remained the same after treatment, but the phosphorylation levels of p65 at Ser276 were significantly reduced upon treatment with the inhibitors indicated in Fig. 5A. Next, we investigated the phosphorylation of p65 during E. piscicida infection in J774A.1 cells treated with MG132, to inhibit p65 degradation, and analyzed the phosphorylation of p65. The results revealed that the phosphorylation of p65 was reduced in cells infected with the E. piscicida wild-type or ΔeseH::pEseH strain but not the ΔeseH mutant, which revealed that the phosphorylation of p65 is inhibited by EseH during E. piscicida infection (Fig. 5B).
FIG 5.
Phosphothreonine lyase inhibits the phosphorylation of p65 at Ser276 residues to promote its ubiquitination. (A) J774A.1 cells were pretreated with U0126 (10 μM), SB208530 (10 μM), SP600125 (10 μM), or H89 (50 μM) and then infected with E. piscicida ΔeseH at an MOI of 10 for 3.5 h. Cell lysates were probed with anti-phospho-p65 (Ser276), anti-p65, and anti-β-actin antibodies. (B) J774A.1 cells were infected with the E. piscicida wild-type, ΔeseH, or ΔeseH::pEseH strain at an MOI of 10 for 3.5 h. MG132 was added to inhibit the degradation of p65. Cell lysates were collected and probed with anti-phospho-p65, anti-p65, and anti-β-actin antibodies. (C) HEK293T cells were cotransfected with p65- or p65 (S276)-Flag, EseH-EGFP, and ubiquitin-HA. MG132 was added to inhibit the degradation of p65. Cell lysates were immunoprecipitated with anti-Flag beads and then analyzed by immunoblotting with anti-HA, anti-Flag, or anti-EGFP antibodies. All the densitometry data (presented beneath the gels) were compared to those for the control (for which the densitometry value was set equal to 100). The data (mean ± SD) are representative of those from at least three experiments. The signal intensities were quantitatively analyzed by NIH ImageJ software. *, P < 0.05.
In addition, to analyze the role of p65 Ser276 in regulating the ubiquitination of p65, we cotransfected HEK293T cells with plasmids expressing EGFP or EseH-EGFP and plasmids expressing p65-Flag or p65 (S276A)-Flag with pRK5-HA-ubiquitin-48 expressing ubiquitin-HA. We found that p65 with the S276A mutation was more highly ubiquitinated than wild-type p65, and this ubiquitination was increased in the presence of EseH (Fig. 5C), which suggests that the phosphorylation of Ser276 is critical for preventing p65 from ubiquitination. Taken together, these results indicate that the bacterial phosphothreonine lyase can promote p65 ubiquitination through the inhibition of Ser276 phosphorylation.
DISCUSSION
As p65 is an important component of the NF-κB signaling pathway, pathogens have evolved multiple strategies to subvert this protein (10–13). Previous studies have proved that the phosphothreonine lyase family of proteins can directly inhibit MAPK pathway activation (4, 8) and that MAPK signaling regulates the phosphorylation of downstream MSK1 (32, 33). MSK1 plays a critical role in regulating the phosphorylation of p65 at Ser276, keeping the stability of p65 (30, 34). These signaling cascades connect the MAPK pathway and the NF-κB pathway, which prompted us to analyze the role of bacterial phosphothreonine lyases during infection. A previous study revealed that OspF can interact with HP1γ and alter its phosphorylation at Ser83 by inactivating ERK and, consequently, MSK1 (35). However, the downstream consequences of phosphothreonine lyase acting on NF-κB signaling were unknown. In this study, we revealed the role of the bacterial phosphothreonine lyases EseH and OspF in regulating the MAPK-MSK1 axis and clarified their critical role in promoting p65 degradation (Fig. 6). Interestingly, we found that either during bacterial infection or through the use of pathway inhibitors, JNK-MAPK signaling plays a role in regulating MSK1 phosphorylation, which is different from the effect of OspF on the phosphorylation of HP1γ (35). We found that EseH and OspF dephosphorylate p65 through their lyase activity on ERK, p38, and JNK. Another interesting phenomenon is that we found that EseH can promote the more serious ubiquitination of p65 (S276A) than that of wild-type p65 (Fig. 5C), which indicates that there might be some interesting sites on p65 which could be ubiquitinated by phosphothreonine lyases. Collectively, although our results extend the function of bacterial EseH and OspF during infection, whether other phosphothreonine lyase-family proteins share the same effects on this pathway remains to be clarified.
FIG 6.

Summary of proposed mechanism for the bacterial phosphothreonine lyases. Phosphothreonine lyase targets MAPKs to dephosphorylate MSK1 and p65 and promotes the ubiquitination of p65, which results in the degradation of p65.
Although EseH is not the first effector identified in E. piscicida, the present work is the first to explain how a T3SS effector of E. piscicida interferes with the host NF-κB pathway. In our previous study, we detected the degradation of Iκα during E. piscicida infection in HeLa cells and found that there is no significant difference between wild-type and ΔeseH mutant infection (8). However, both Iκα and p65 are important elements of the NF-κB pathway and remain attractive targets for exploitation by microbial pathogens to modulate host cell events (36). In this study, we analyzed the mechanism of phosphothreonine lyase in regulating p65 degradation during E. piscicida infection in macrophages, revealing the role of this important bacterial T3SS effector not only in targeting MAPKs but also in regulating NF-κB, thereby uncovering a new mechanism by which pathogenic bacteria overcome host innate immunity to promote pathogenesis.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
The strains and plasmids used in this study are listed in Table 1. Escherichia coli DH5α was used for recombinant DNA experiments. Escherichia coli cells were grown in Luria-Bertani (LB) broth or on LB agar at 37°C. Edwardsiella piscicida and derivative strains were grown in Trypticase soy broth or tryptic soy agar at 30°C. When necessary, ampicillin (100 μg/ml) and colistin (16.7 μg/ml) were added to the media.
TABLE 1.
Strains and plasmids used in this study
| Strain or plasmid | Description | Reference or source |
|---|---|---|
| Strains | ||
| Escherichia coli DH5α | Δ(lacZYA-argF)U169 φ80dlacZΔM15 | Lab collection |
| Edwardsiella piscicida | ||
| EIB202 | Edwardsiella piscicida wild-type strain, Colr Cmr | CCTCC no. M208068 |
| ΔeseH | EIB202 with deletion of eseH | 8 |
| ΔeseH::pEseH | The ΔeseH strain complemented with pUTt-0456-EseH-HA, Ampr | 8 |
| Plasmids | ||
| pCDH-HA | pCDH-CMV-MCS derivative containing HA tag | 8 |
| pCDH-EseH-HA | pCDH-CMV-MCS derivative containing EseH-HA fusion | 8 |
| pCDH-EseH (K79R)-HA | pCDH-CMV-MCS derivative containing EseH(K79R)-HA fusion | 8 |
| pCDH-EseH (H81R)-HA | pCDH-CMV-MCS derivative containing EseH(H81R)-HA fusion | 8 |
| pCDH-EseH (K111A)-HA | pCDH-CMV-MCS derivative containing EseH(K111A)-HA fusion | 8 |
| pCDH-OspF-HA | pCDH-CMV-MCS derivative containing OspF-HA fusion | This study |
| pCDH-OspF (K102R)-HA | pCDH-CMV-MCS derivative containing OspF (K102R)-HA fusion | This study |
| pCDH-OspF (H104R)-HA | pCDH-CMV-MCS derivative containing OspF (H104R)-HA fusion | This study |
| pCDH-OspF(K134A)-HA | pCDH-CMV-MCS derivative containing OspF(K134A)-HA fusion | This study |
| pCDH-EGFP | pCDH-CMV-MCS derivative containing EGFP tag | This study |
| pCDH-EseH-EGFP | pCDH-CMV-MCS derivative containing EseH-EGFP fusion | This study |
| pCDH-EseH (K79R)-EGFP | pCDH-CMV-MCS derivative containing EseH(K79R)-EGFP fusion | This study |
| pCDH-EseH (H81R)-EGFP | pCDH-CMV-MCS derivative containing EseH(H81R)-EGFP fusion | This study |
| pCDH-EseH (K111A)-EGFP | pCDH-CMV-MCS derivative containing EseH(K111A)-EGFP fusion | This study |
| pCDH-OspF-EGFP | pCDH-CMV-MCS derivative containing OspF-EGFP fusion | This study |
| pCDH-OspF (K102R)-EGFP | pCDH-CMV-MCS derivative containing OspF (K102R)-EGFP fusion | This study |
| pCDH-OspF (H104R)-EGFP | pCDH-CMV-MCS derivative containing OspF (H104R)-EGFP fusion | This study |
| pCDH-OspF (K134A)-EGFP | pCDH-CMV-MCS derivative containing OspF (K134A)-EGFP fusion | This study |
| pCDH-p65-Flag | pCDH-CMV-MCS derivative containing p65-Flag fusion | This study |
| pCDH-p65 (S276A)-Flag | pCDH-CMV-MCS derivative containing p65 (S276A)-Flag fusion | This study |
| pRK5-HA-ubiquitin-48 | Mammalian expression of HA-tagged ubiquitin with only K48, Ampr | Addgene |
Cell cultures, infection, and transfection.
The murine macrophage-like cell line J774A.1 (ATCC TIB-67; ATCC, Manassas, VA, USA) and human embryonic kidney HEK293T cells (ATCC CRL-3216) were propagated in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA) at 37°C with 5% CO2. J774A.1 cells were infected at a multiplicity of infection (MOI) of 10:1 in DMEM at 35°C for 3.5 h. HEK293T cells were transfected using the standard calcium phosphate method.
Construction of plasmids.
Primers EseH-EGFP-F and EseH-EGFP-R were used to prepare EseH-EGFP and its mutants containing an EGFP tag. The DNA sequence of the OspF gene was synthesized by the Genexiz company (Suzhou, China). Primers OpsF (K102R)-F and OpsF (K102R)-R, OpsF (H104A)-F and OpsF (H104A)-R, and OpsF (K134A)-F and OpsF (K134A)-R were used to insert OspF mutants in pairs. To add pCDH homologous flanks and an HA tag or EGFP tag, primers OspF-HA-F and OspF-HA-R or OspF-EGFP-R were used for an additional amplification using OspF and its mutants as models. In parallel, total cellular RNA was extracted from J774A.1 cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. RNA was reverse transcribed to cDNA using a FastKing one-step reverse transcription (RT)-PCR kit (Tiangen, Beijing, China), and p65 was amplified from total cDNA using primers mp65-F and mp65-R. The PCR product was used as a model to amplify the p65-Flag fragment or p65 (S276A)-Flag containing ends compatible with pCDH. The primers used are listed in Table 2. All fragments were inserted into the linearized pCDH plasmid using a one-step cloning kit (Vazyme Biotech, Jiangsu, China).
TABLE 2.
Primers used in this study
| Primer name | Primer sequence (5′ to 3′) |
|---|---|
| IL-8 (RT)-F | TCGAGACCATTTACTGCAACAG |
| IL-8 (RT)-R | CATTGCCGGTGGAAATTCCTT |
| p65 (RT)-F | TGCGATTCCGCTATAAATGCG |
| p65 (RT)-R | ACAAGTTCATGTGGATGAGGC |
| β-actin (RT)-F | GTGACGTTGACATCCGTAAAGA |
| β-actin (RT)-R | GCCGGACTCATCGTACTCC |
| p65-F | ATGGACGATCTGTTTCCCCTC |
| p65-R | TTAGGAGCTGATCTGACTC |
| Flag-p65-F | CCATAGAAGATATGGACGATCTG |
| Flag-p65-R | GATTTAAATTCTTACTTGTCGTCATCGTCTTTGTAGTCGGAGCTGATC |
| p65 (S276A)-R1 | CGCGATCAGCAGGCCGC |
| p65 (S276A)-F2 | GCGGCCTGCTGATCGCG |
| OspF-HA-F | CCATAGAAGATATGCCCATAAAAAAGCCCTGTC |
| OspF-HA-R | GATTTAAATTCCTAGGCATAGTCTGGGACGTCA |
| OspF(K102R)-F | GGGGACAGGTTTCATATTAG |
| OspF(K102R)-R | CTAATATGAAACCTGTCCCC |
| OspF(H104A)-F | GACAAGTTTGCTATTAGTA |
| OspF(H104A)-R | TACTAATAGCAAACTTGTC |
| OspF(K134A)-F | GATAAATGGGCGATAACTG |
| OspF(K134A)-R | CAGTTATCGCCCATTTATC |
| OspF-EGFP-R | CTCGCCCTTGCTCACGGCATAGTC |
| EseH-EGFP-F | CTGTTTTGTCTAGAATGCCCC |
| EseH-EGFP-R | CCTTGCTCACGCTAGCCTCTGT |
| line-pCDH-F | ATCTTCTATGGAGGTCAAAACAGC |
| line-pCDH-R | GAATTCGAATTTAAATCGGATCCG |
| line-pCDH-EGFP-F | GTGAGCAAGGGCGAG |
RNA extraction and quantitative real-time PCR.
Total RNA was extracted from E. piscicida wild-type-, ΔeseH strain-, and ΔeseH::pEseH strain-infected J774A.1 cells. The TRIzol reagent (1 ml; Invitrogen) was used for each well, and cDNA was generated using a FastKing RT kit (Tiangen). Real-time quantitative PCR (qPCR) was performed with Super Real premix (Tiangen) in eight-well strip tubes. The gene for β-actin was used as a reference to obtain the relative fold changes in expression in the target samples by the comparative ΔΔCT threshold cycle (CT) method. Primers were designed with the Integrated DNA Technologies Primer Quest tool. The primers used are listed in Table 2 and were IL-8 (RT)-F, IL-8 (RT)-R, β-actin (RT)-F, β-actin (RT)-R, p65 (RT)-F, and p65 (RT)-R. RT-qPCR experiments were carried out in 3 biological replicates per strain, and each condition and all qPCRs were performed in three biological replicates.
Ubiquitination detection assay.
Eukaryotic expression vectors pRK5-HA-ubiquitin-48 and pCDH-p65-Flag or pCDH-p65 (S276A)-Flag were transfected with pCDH-EseH-EGFP (or its mutants) or pCDH-OspF-EGFP (or its mutants), and MG132 was added to protect against p65 degradation. At 24 h after transfection, 1 ml lysis buffer (20 mM Tris, 100 mM KCl, 1 mM EDTA, 10 mM Na4P2O7, 10% glycerol, 0.1% NP-40, pH 7.5) was used to lyse the cells in a 10-cm dish, and the supernatants were subjected to immunoprecipitation with anti-Flag M2 magnetic beads (Sigma, St. Louis, MO, USA). Immunoblotting was used to detect ubiquitin with an HA antibody (HuaAN Biotechnology, Oxfordshire, UK).
Pathway inactivation.
For pathway inactivation experiments, 10 μM U0126 (Selleck Chemicals, Houston, TX, USA) was used to inactivate the ERK1/2 pathway, 10 μM SB208530 (Selleck Chemicals) was used to inactivate the p38α pathway, 10 μM SP600125 (Selleck Chemicals) was used to inactivate the JNK pathway, and 50 μM H89 (MedChemExpress, Monmouth Junction, NJ, USA) was used to inactivate the MSK1 pathway. These inhibitors were dissolved in dimethyl sulfoxide (DMSO) and added to the cell culture media for 2 h, while the same volume of DMSO alone was add as a control for the same amount of time. The 26S proteasome inhibitor MG132 (Selleck Chemicals) was dissolved in phosphate-buffered saline (PBS) and used at a concentration of 10 μM.
Western blotting and antibodies.
Harvested cells were lysed in buffer containing 1% Triton X-100, 50 mM Tris, 150 mM NaCl, and 1 mM EDTA (pH 7.4). Lysates were mixed with protein loading buffer, boiled, and centrifuged. Samples were then subjected to SDS-PAGE, and the proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) using a standard electroblotting system. After blocking with 5% bovine serum albumin plus 0.05% PBS–Tween 20 (PBST), the membranes were incubated at room temperature for 2 h with primary antibodies. The phospho-ERK1/2 antibody (catalog number 9101; CST), phospho-p38α antibody (catalog number 9215; CST), phospho-JNK antibody (catalog number 9251; CST), anti-MSK1 (phosphor-S360) antibody (catalog number ab81294; Abcam), p65 (phosphor-S276) antibody (catalog number ab106129; Abcam), MSK1 antibody (catalog number AF2518; R&D Systems), EGFP antibody (catalog number MAB4401; Tiangen), HA antibody (catalog number 0906; HuaAN), Flag antibody (catalog number 0912; HuaAN), p65 antibody (catalog number ET1603-12; HuaAN), β-actin antibody (catalog number M1210-2; HuaAN), and p50 antibody (catalog number AF1246; Beyotime) were probed. Next, the membranes were washed with PBST and incubated with a 1:2,000 dilution of horseradish peroxidase-conjugated secondary antibody (Beyotime) at room temperature for 2 h.
ACKNOWLEDGMENTS
This work was supported by the National Natural Science Foundation of China (31430090 and 31472308) and the Fundamental Research Funds for the Central Universities no. 222201714022 (to Dahai Yang). Dahai Yang was supported by the Young Elite Scientists Sponsorship Program (CAST no. 2016QNRC001), the Shanghai Pujiang Program (no. 16PJD020), the Shanghai Chenguang Program (no. 16CG33), and the Talent Program of the School of Biotechnology of the East China University of Science and Technology.
D.Y., Q.L., and M.H. conceived the study; M.H. performed most of the experiments. W.W. and F.H. helped with plasmid construction. Y.Z. provided expert advice and critically reviewed the manuscript. The manuscript was written by M.H. and D.Y. Q.L. supervised the study. All authors discussed the results and commented on the manuscript.
We declare that there are no conflicts of interest.
REFERENCES
- 1.Dong C, Davis RJ, Flavell RA. 2002. MAP kinases in the immune response. Annu Rev Immunol 20:55–72. doi: 10.1146/annurev.immunol.20.091301.131133. [DOI] [PubMed] [Google Scholar]
- 2.Arbibe L, Kim DW, Batsche E, Pedron T, Mateescu B, Muchardt C, Parsot C, Sansonetti PJ. 2007. An injected bacterial effector targets chromatin access for transcription factor NF-κB to alter transcription of host genes involved in immune responses. Nat Immunol 8:47–56. doi: 10.1038/ni1423. [DOI] [PubMed] [Google Scholar]
- 3.Kramer RW, Slagowski NL, Eze NA, Giddings KS, Morrison MF, Siggers KA, Starnbach MN, Lesser CF. 2007. Yeast functional genomic screens lead to identification of a role for a bacterial effector in innate immunity regulation. PLoS Pathog 3:e21. doi: 10.1371/journal.ppat.0030021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Li H, Xu H, Zhou Y, Zhang J, Long C, Li S, Chen S, Zhou JM, Shao F. 2007. The phosphothreonine lyase activity of a bacterial type III effector family. Science 315:1000–1003. doi: 10.1126/science.1138960. [DOI] [PubMed] [Google Scholar]
- 5.Shan L, He P, Sheen J. 2007. Intercepting host MAPK signaling cascades by bacterial type III effectors. Cell Host Microbe 1:167–174. doi: 10.1016/j.chom.2007.04.008. [DOI] [PubMed] [Google Scholar]
- 6.Zhang J, Shao F, Li Y, Cui H, Chen L, Li H, Zou Y, Long C, Lan L, Chai J, Chen S, Tang X, Zhou JM. 2007. A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants. Cell Host Microbe 1:175–185. doi: 10.1016/j.chom.2007.03.006. [DOI] [PubMed] [Google Scholar]
- 7.Mazurkiewicz P, Thomas J, Thompson JA, Liu M, Arbibe L, Sansonetti P, Holden DW. 2008. SpvC is a Salmonella effector with phosphothreonine lyase activity on host mitogen-activated protein kinases. Mol Microbiol 67:1371–1383. doi: 10.1111/j.1365-2958.2008.06134.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hou M, Chen R, Yang D, Núñez G, Wang Z, Wang Q, Zhang Y, Liu Q. 2017. Identification and functional characterization of EseH, a new effector of the type III secretion system of Edwardsiella piscicida. Cell Microbiol 19:e12638. doi: 10.1111/cmi.12638. [DOI] [PubMed] [Google Scholar]
- 9.Ribet D, Cossart P. 2010. Post-translational modifications in host cells during bacterial infection. FEBS Lett 584:2748–2758. doi: 10.1016/j.febslet.2010.05.012. [DOI] [PubMed] [Google Scholar]
- 10.Rolhion N, Furniss RC, Grabe G, Ryan A, Liu M, Matthews SA, Holden DW. 2016. Inhibition of nuclear transport of NF-κB p65 by the Salmonella type III secretion system effector SpvD. PLoS Pathog 12:e1005653. doi: 10.1371/journal.ppat.1005653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sun H, Kamanova J, Lara-Tejero M, Galán JE. 2016. A family of Salmonella type III secretion effector proteins selectively targets the NF-κB signaling pathway to preserve host homeostasis. PLoS Pathog 12:e1005484. doi: 10.1371/journal.ppat.1005484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yen H, Ooka T, Iguchi A, Hayashi T, Sugimoto N, Tobe T. 2010. NleC, a type III secretion protease, compromises NF-κB activation by targeting p65/RelA. PLoS Pathog 6:e1001231. doi: 10.1371/journal.ppat.1001231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Pearson JS, Riedmaier P, Marchès O, Frankel G, Hartland EL. 2011. A type III effector protease NleC from enteropathogenic Escherichia coli targets NF-κB for degradation. Mol Microbiol 80:219–230. doi: 10.1111/j.1365-2958.2011.07568.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Reiterer V, Grossniklaus L, Tschon T, Kasper CA, Sorg I, Arrieumerlou C. 2011. Shigella flexneri type III secreted effector OspF reveals new crosstalks of proinflammatory signaling pathways during bacterial infection. Cell Signal 23:1188–1196. doi: 10.1016/j.cellsig.2011.03.006. [DOI] [PubMed] [Google Scholar]
- 15.Edrees A, Abdelhamed H, Nho SW, Park SB, Karsi A, Austin FW, Essa M, Pechan T, Lawrence ML. 2018. Construction and evaluation of type III secretion system mutants of the catfish pathogen Edwardsiella piscicida. J Fish Dis 41:805–816. doi: 10.1111/jfd.12784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Schlenker C, Surawicz CM. 2009. Emerging infections of the gastrointestinal tract. Best Pract Res Clin Gastroenterol 23:89–99. doi: 10.1016/j.bpg.2008.11.014. [DOI] [PubMed] [Google Scholar]
- 17.Leung KY, Siame BA, Tenkink BJ, Noort RJ, Mok YK. 2012. Edwardsiella tarda—virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect 14:26–34. doi: 10.1016/j.micinf.2011.08.005. [DOI] [PubMed] [Google Scholar]
- 18.Brat DJ, Bellail AC, Van Meir EG. 2005. The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol 7:122–133. doi: 10.1215/S1152851704001061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kunsch C, Rosen GA. 1993. NF-κB subunit-specific regulation of the interleukin-8 promoter. Mol Cell Biol 13:6137–6146. doi: 10.1128/MCB.13.10.6137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Chen LF, Greene WC. 2004. Shaping the nuclear action of NF-kappa B. Nat Rev Mol Cell Biol 5:392–401. doi: 10.1038/nrm1368. [DOI] [PubMed] [Google Scholar]
- 21.Emanuele S, Calvaruso G, Lauricella M, Giuliano M, Bellavia G, D'Anneo A, Vento R, Tesoriere G. 2002. Apoptosis induced in hepatoblastoma HepG2 cells by the proteasome inhibitor MG132 is associated with hydrogen peroxide production, expression of Bcl-XS and activation of caspase-3. Int J Oncol 21:857–865. doi: 10.3892/ijo.21.4.857. [DOI] [PubMed] [Google Scholar]
- 22.Peng Y, Wang E, Peng G, Lin S-Y. 2016. Ubiquitination assay for mammalian cells. Bio-protocol 6:e1880. [Google Scholar]
- 23.Choo YS, Zhang Z. 2009. Detection of protein ubiquitination. J Vis Exp 19:1293. doi: 10.3791/1293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kefaloyianni E, Gaitanaki C, Beis I. 2006. ERK1/2 and p38-MAPK signalling pathways, through MSK1, are involved in NF-κB transactivation during oxidative stress in skeletal myoblasts. Cell Signal 18:2238–2251. doi: 10.1016/j.cellsig.2006.05.004. [DOI] [PubMed] [Google Scholar]
- 25.Deak M, Clifton AD, Lucocq LM, Alessi DR. 1998. Mitogen- and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB. EMBO J 17:4426–4441. doi: 10.1093/emboj/17.15.4426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ning Z, Zheng Z, Hao W, Duan C, Li W, Wang Y, Li M, Luo S. 2013. The N terminus of Orf virus-encoded protein 002 inhibits acetylation of NF-κB p65 by preventing Ser276 phosphorylation. PLoS One 8:e58854. doi: 10.1371/journal.pone.0058854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tyagi R, Shahani N, Gorgen L, Ferretti M, Pryor W, Chen PY, Swarnkar S, Worley PF, Karbstein K, Snyder SH, Subramaniam S. 2015. Rheb inhibits protein synthesis by activating the PERK-eIF2α signaling cascade. Cell Rep 10:684–693. doi: 10.1016/j.celrep.2015.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yang Z, Wu B, Jia S, Zhao Y, Hou R, Liu X, Wang X, Chen L, Yang X, Lei D, Wang L. 2017. The mechanically activated p38/MMP-2 signaling pathway promotes bone marrow mesenchymal stem cell migration in rats. Arch Oral Biol 76:55–60. doi: 10.1016/j.archoralbio.2017.01.017. [DOI] [PubMed] [Google Scholar]
- 29.Lalaoui N, Hänggi K, Brumatti G, Chau D, Nguyen NN, Vasilikos L, Spilgies LM, Heckmann DA, Ma C, Ghisi M, Salmon JM, Matthews GM, de Valle E, Moujalled DM, Menon MB, Spall SK, Glaser SP, Richmond J, Lock RB, Condon SM, Gugasyan R, Gaestel M, Guthridge M, Johnstone RW, Munoz L, Wei A, Ekert PG, Vaux DL, Wong WW, Silke J. 2016. Targeting p38 or MK2 enhances the anti-leukemic activity of Smac-mimetics. Cancer Cell 29:145–158. doi: 10.1016/j.ccell.2016.01.006. [DOI] [PubMed] [Google Scholar]
- 30.Vermeulen L, De Wilde G, Van Damme P, Vanden Berghe W, Haegeman G. 2003. Transcriptional activation of the NF-κB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J 22:1313–1324. doi: 10.1093/emboj/cdg139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Nihira K, Ando Y, Yamaguchi T, Kagami Y, Miki Y, Yoshida K. 2010. Pim-1 controls NF-κB signalling by stabilizing RelA/p65. Cell Death Differ 17:689–698. doi: 10.1038/cdd.2009.174. [DOI] [PubMed] [Google Scholar]
- 32.Campbell KJ, Perkins ND. 2004. Post-translational modification of RelA(p65) NF-kappaB. Biochem Soc Trans 32:1087–1089. doi: 10.1042/BST0321087. [DOI] [PubMed] [Google Scholar]
- 33.Li B, Wan Z, Huang G, Huang Z, Zhang X, Liao D, Luo S, He Z. 2015. Mitogen- and stress-activated kinase 1 mediates Epstein-Barr virus latent membrane protein 1-promoted cell transformation in nasopharyngeal carcinoma through its induction of Fra-1 and c-Jun genes. BMC Cancer 15:390. doi: 10.1186/s12885-015-1398-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Olson CM, Hedrick MN, Izadi H, Bates TC, Olivera ER, Anguita J. 2007. p38 mitogen-activated protein kinase controls NF-κB transcriptional activation and tumor necrosis factor alpha production through RelA phosphorylation mediated by mitogen- and stress-activated protein kinase 1 in response to Borrelia burgdorferi antigens. Infect Immun 75:270–277. doi: 10.1128/IAI.01412-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Harouz H, Rachez C, Meijer BM, Marteyn B, Donnadieu F, Cammas F, Muchardt C, Sansonetti P, Arbibe L. 2014. Shigella flexneri targets the HP1γ subcode through the phosphothreonine lyase OspF. EMBO J 33:2606–2622. doi: 10.15252/embj.201489244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Rahman MM, McFadden G. 2011. Modulation of NF-κB signalling by microbial pathogens. Nat Rev Microbiol 9:291–306. doi: 10.1038/nrmicro2539. [DOI] [PMC free article] [PubMed] [Google Scholar]





