Abstract
Premise of the Study
Psammosilene tunicoides (Caryophyllaceae) is a narrowly distributed and endemic plant species in southwestern China. The overexploitation of natural P. tunicoides has led to the destruction of many populations. Population and genetic studies will provide crucial data for the protection and management of P. tunicoides. In this study, we develop simple sequence repeat markers of P. tunicoides to analyze population diversity.
Methods and Results
Microsatellite loci of P. tunicoides were isolated with FIASCO. Eleven polymorphic and 10 monomorphic primers were developed. The 11 polymorphic primers were tested in three P. tunicoides populations, yielding two to nine alleles per locus. Levels of observed heterozygosity varied from 0.000 to 1.000, and levels of expected heterozygosity ranged from 0.000 to 0.615. In addition, three of these loci were successfully amplified, and showed polymorphism, in three Silene species.
Conclusions
These microsatellite markers can be valuable tools to investigate the genetic diversity and population structure of P. tunicoides.
Keywords: Caryophyllaceae, cross‐amplification, genetic diversity, microsatellite, Psammosilene tunicoides, Silene
Psammosilene tunicoides W. C. Wu & C. Y. Wu (Caryophyllaceae), a perennial and monotypic herb endemic to southwestern China, was described more than 500 years ago and is highly valued in traditional Chinese medicine for pain relief, coagulative effects, and promoting blood circulation (Qu et al., 2011). However, population sizes of this species have been declining dramatically in recent years due to overharvesting, and it is currently listed in the China Plant Red Data Book as a rare and endangered species (Fu and Chin, 1992). This species urgently requires protection. Previous genetic diversity analysis developed for P. tunicoides conservation strategies were mostly dependent on molecular markers, including amplified fragment length polymorphisms (AFLP) (Dai et al., 2007), direct amplification of length polymorphisms (DALP) (Qu et al., 2010; Li et al., 2016), and DNA sequencing (Zhang et al., 2011). The DALP and AFLP markers are often composed of multiple fragments in large genome templates, which complicates their use for genetic analysis.
As molecular markers, microsatellites (also known as simple sequence repeats [SSRs]) are DNA motifs composed of one to six nucleotides, which have gained considerable importance in plant genetics analysis and breeding due to their many desirable attributes, including codominant inheritance, stability, extensive genome coverage, and amenability to automation. SSRs have been found ubiquitously in genetic diversity research, genome evolution, species conservation, and marker‐assisted selection breeding (Cavagnaro et al., 2010; Kalia et al., 2011; Wei et al., 2011; Passos et al., 2013). Because P. tunicoides is an endangered species and cultivated herb, it is necessary to develop SSR markers for both conservation strategies and marker‐assisted selection breeding. However, the National Center for Biotechnology Information (NCBI) database contains no SSR sequences for P. tunicoides based on Sanger sequencing data. In this study, we report the development and characterization of 11 novel polymorphic genomic SSR markers for P. tunicoides. Additionally, we cross‐amplified these loci in three species of the genus Silene L.: S. gracilicaulis C. L. Tang, S. huguettiae Bocquet, and S. gonosperma (Rupr.) Bocquet.
METHODS AND RESULTS
Total genomic DNA was extracted from silica gel–dried leaf tissue from seven samples of P. tunicoides from different populations (Appendix 1) using the DNeasy Plant Mini Kit (Tiangen Biotech, Beijing, China). These microsatellite markers were developed using the Fast Isolation by AFLP of Sequences COntaining repeats protocol (FIASCO) with modifications (Zane et al., 2002). Approximately 500 ng of genomic DNA was digested with MseI restriction enzyme (New England Biolabs, Beverly, Massachusetts, USA). Then, using the universal adapter pair (F: TACTCAGGACTCAT, R: GACGATGAGTCCTGAG) combined with its fragment, the digested product was placed at 37°C. This mixture was amplified by PCR using a reaction program containing an initial denaturation of 94°C for 3 min; followed by 20 cycles of 94°C for 30 s, 55°C for 60 s, and 72°C for 60 s; with a final extension of 72°C for 8 min.
PCR product hybridization was performed with 5′‐biotinylated (AC)15/(AG)15 probes, and hybridization products were enriched using magnetic beads. The collected enriched products were used as a template to conduct a PCR reaction according to the above program. After the amplified product was purified, the purified product was ligated into a pGM‐T vector (Tiangen Biotech) and transformed using Trans1‐T1 Phage Resistant Chemically Competent Cells (TransGen Biotech, Beijing, China) to carry out amplification and expression. Positive strains were selected using Luria–Bertani medium containing ampicillin. A total of 359 positive clones were selected and sequenced using the ABI PRISM 3730XL DNA sequencer (Applied Biosystems, Foster City, California, USA), including 217 sequences containing an SSR. Out of these 217 sequences, 46 successfully yielded clear bands; the others showed multi‐banding patterns or no amplification.
Polymorphisms were validated using the 46 designed primers in 30 samples of P. tunicoides that were collected from three locations in China: Yunnan, Sichuan, and Guizhou (Appendix 1). PCR was performed in a 25‐μL reaction volume, containing 1 μL of template DNA (5 ng/μL), 0.5 μL of reference primer, 1 unit of Taq polymerase (TaKaRa Biotechnology Co., Dalian, China), 2.5 μL of 10× PCR buffer, 2.0 μL of MgCl2 (25 mM), 0.5 μL of dNTP mixture (10 mM each), and 17.8 μL ddH2O. The amplification reaction was conducted using the following protocol: initial denaturation at 95°C for 3 min; followed by 30 cycles of 95°C for 30 s, 45–56°C for 1 min (Table 1), and 72°C for 30 s; and a final extension at 72°C for 10 min. After PCR amplification, PCR products were separated and visualized using an ABI 3730 automated sequencer (ABI 3730XL, Applied Biosystems), and the size of the alleles at each locus was scored by GeneMapper version 3.2 (Applied Biosystems). All sequences were deposited in GenBank (Table 1).
Table 1.
Characteristics of 11 polymorphic microsatellite loci developed for Psammosilene tunicoides
| Locus | Primer sequences (5′–3′) | Repeat motif | T a (°C) | Allele size range (bp) | A | GenBank accession no. |
|---|---|---|---|---|---|---|
| E2 | F: TCCCTCCATACTCATACA | (GAA)5 | 45 | 278–284 | 4 | KJ159956 |
| R: ATGCAAACCTTATTCTTC | ||||||
| E5 | F: TCCGACGAAGGGAATGCT | (GA)10 | 53 | 175–179 | 3 | KJ159945 |
| R: CGCCTGAAACTTCCACCA | ||||||
| E7 | F: GCGGCCTCCTAGTCACATT | (TCT)9 | 53 | 283–291 | 3 | KJ159947 |
| R: CACCACCTTTGCCTTCCTT | ||||||
| E10 | F: CACCGTCACTCCTAACCA | (TC)9 | 50 | 193–205 | 4 | KJ159951 |
| R: ATGCAGGAAAGGAAGTCG | ||||||
| Z3 | F: GTCGGAGAACTATCGAGAT | (CT)11 | 53 | 123–135 | 3 | KJ159953 |
| R: GAGGAAGAGCGTGGAGGA | ||||||
| Z5 | F: ATATGTTTTACTTGGTGG | (AG)13 | 50 | 190–201 | 5 | KJ159957 |
| R: CTTCCTCTTATTTGCTAG | ||||||
| Z6 | F: TCCCAATTTGCACTTTCA | (CTT)9 | 50 | 174–195 | 4 | KJ159955 |
| R: ACCCACCAACAACATAAGC | ||||||
| Z11 | F: GGTTGTATGCCATCGTCG | (AG)3AA(AG)6 | 50 | 201–208 | 2 | KJ159952 |
| R: CCTTTCTGCCGTGATTTT | ||||||
| Z12 | F: ATTGTTTTCATCGCTCTA | (TC)10 | 50 | 190–201 | 9 | KJ159949 |
| R: GGAGAAAGGTTGATAGGAG | ||||||
| Z14 | F: CAGGTGGTGGGCTGGTAAT | (GA)6 | 56 | 170–180 | 3 | KJ159941 |
| R: CCTCGGTTCCGCCATTTGT | ||||||
| Z16 | F: CCCTCGGTTCCGCCATTT | (GT)7 | 52 | 155–170 | 2 | KJ159937 |
| R: GGTGGTGGGCTGGTAATG |
A = number of alleles; T a = annealing temperature.
Numbers of alleles per locus, observed heterozygosity (H o), and expected heterozygosity (H e) were calculated by GenAlEx 6.5 (Peakall and Smouse, 2012); linkage disequilibrium and deviations from Hardy–Weinberg equilibrium were estimated using GENEPOP version 3.4 (Rousset, 2008). Only 11 primer pairs displayed polymorphism among these three populations (Table 1), and the amplification products were within the expected size range. The number of alleles per locus ranged from two to nine, with an average of 3.81 alleles. The average levels of H o and H e in all three populations were 0.31 ± 0.06 and 0.29 ± 0.04, respectively (Table 2). Five loci (E10, Z6, Z11, Z14, Z16) in the Lijiang population, three loci (Z5, Z11, Z14) in the Yanyuan population, and four loci (E7, E10, Z11, Z12) in the Weining population showed significant deviations from Hardy–Weinberg equilibrium, indicating heterozygote deficiencies. In addition to the 11 polymorphic loci, 10 monomorphic microsatellite loci were obtained and the sequence information was deposited to NCBI (Appendix 2).
Table 2.
Genetic properties of 11 newly developed polymorphic microsatellite markers for Psammosilene tunicoides.a
| Locus | Lijiang population (n = 18) | Yanyuan population (n = 20) | Weining population (n = 20) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e b | A | H o | H e b | A | H o | H e b | |
| E2 | 2 | 0.200 | 0.180 | 2 | 0.100 | 0.095 | 2 | 0.200 | 0.180 |
| E5 | 3 | 0.200 | 0.185 | 1 | 0.000 | 0.000 | 3 | 0.500 | 0.395 |
| E7 | 2 | 0.400 | 0.420 | 1 | 0.000 | 0.000 | 2 | 0.000 | 0.420** |
| E10 | 3 | 1.000 | 0.545** | 4 | 1.000 | 0.615 | 3 | 1.000 | 0.545** |
| Z3 | 1 | 0.000 | 0.000 | 2 | 0.100 | 0.095 | 2 | 0.100 | 0.095 |
| Z5 | 1 | 0.000 | 0.000 | 3 | 0.100 | 0.485** | 2 | 0.100 | 0.095 |
| Z6 | 3 | 0.100 | 0.185*** | 2 | 0.100 | 0.095 | 3 | 0.300 | 0.615 |
| Z11 | 2 | 0.900 | 0.495** | 2 | 1.000 | 0.500** | 2 | 1.000 | 0.500** |
| Z12 | 5 | 0.600 | 0.720 | 3 | 0.400 | 0.595 | 4 | 0.600 | 0.595** |
| Z14 | 2 | 0.000 | 0.180** | 2 | 0.000 | 0.180** | 2 | 0.100 | 0.095 |
| Z16 | 2 | 0.000 | 0.180** | 2 | 0.100 | 0.255 | 2 | 0.100 | 0.095 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals.
Locality and voucher information are provided in Appendix 1.
Significant deviation from Hardy–Weinberg equilibrium (*P < 0.01, **P < 0.05, ***P < 0.001).
We also tested 11 primer pairs in three species of the related genus Silene: S. gracilicaulis, S. huguettiae, and S. gonosperma. The results revealed that only three primers (E5, Z3, and Z14) show amplified bands, with lower H o and H e in these loci (Table 3).
Table 3.
Cross‐amplification of microsatellite loci developed for Psammosilene tunicoides in three related Silene species.a
| Locus | Silene gracilicaulis (n = 6) | Silene huguettiae (n = 5) | Silene gonosperma (n = 6) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | Allele size range (bp) | A | H o | H e | Allele size range (bp) | A | H o | H e | Allele size range (bp) | |
| E2 | — | — | — | — | — | — | — | — | — | — | — | — |
| E5 | 4 | 0.667 | 0.681 | 193–209 | 1 | 0.000 | 0.000 | 201–231 | 1 | 0.000 | 0.000 | 183–209 |
| E7 | — | — | — | — | — | — | — | — | — | — | — | — |
| E10 | — | — | — | — | — | — | — | — | — | — | — | — |
| Z3 | 1 | 0.000 | 0.000 | 225 | 1 | 0.000 | 0.000 | 225 | 2 | 0.200 | 0.180 | 225 |
| Z5 | — | — | — | — | — | — | — | — | — | — | — | — |
| Z6 | — | — | — | — | — | — | — | — | — | — | — | — |
| Z11 | — | — | — | — | — | — | — | — | — | — | — | — |
| Z12 | — | — | — | — | — | — | — | — | — | — | — | — |
| Z14 | 1 | 0.000 | 0.000 | 201 | 1 | 0.000 | 0.000 | 201–217 | 2 | 0.333 | 0.278 | 201–217 |
| Z16 | — | — | — | — | — | — | — | — | — | — | — | — |
— = unsuccessful amplification; A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals.
Locality and voucher information are provided in Appendix 1.
CONCLUSIONS
This is the first study to characterize microsatellite markers specifically for P. tunicoides. The 11 polymorphic markers developed here will enable further studies investigating the population genetic structure, the development of conservation strategies, and marker‐assisted selection breeding of this species. However, the cross‐species amplification of these markers indicates that they may be less useful in related genera, such as Silene, because of the distant phylogenetic relationships between P. tunicoides and other species in Caryophyllaceae.
DATA ACCESSIBILITY
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.
ACKNOWLEDGMENTS
The study was supported by the National Natural Science Foundation of China (grant no. 81560613 to G.‐D.L.), the Yunnan Provincial Science and Technology Department–Applied Basic Research Joint Special Funds of Yunnan University of Traditional Chinese Medicine (grant no. 2015FB205(‐015) to G.‐D.L.), and the Key Laboratory Training Program in Yunnan (2017DG006).
APPENDIX 1. Voucher and locality information of three populations of Psammosilene tunicoides and three Silene species used in the study.a
| Taxon | Population code | Voucher specimen accession no.b | N | Locality | Geographic coordinates | Altitude (m) |
|---|---|---|---|---|---|---|
| Psammosilene tunicoides W. C. Wu & C. Y. Wu | LJ | LGD2016005 | 18 | Lijiang, Yunnan Province, China | 26°16′06″N, 100°16′16″E | 2381 |
| P. tunicoides | YY | LGD2016018 | 20 | Yanyuan, Sichuan Province, China | 27°06′37″N, 100°42′09″E | 2650 |
| P. tunicoides | WN | LGD2016020 | 20 | Weining, Guizhou Province, China | 27°06′58″N, 104°07′27″E | 2400 |
| Silene gracilicaulis C. L. Tang | XGLL | MS2017230 | 6 | Xianggelila, Yunnan Province, China | 27°32′18″N, 99°43′08″E | 3240 |
| S. huguettiae Bocquet | XJ | MS2017506 | 5 | Xiaojin, Sichuan Province, China | 30°54′42″N, 102°53′49″E | 5040 |
| S. gonosperma (Rupr.) Bocquet | JL | MS2017536 | 6 | Jiulong, Sichuan Province, China | 28°22′39″N, 101°37′32″E | 2135 |
N = sample size for each population.
Vouchers are stored in the herbarium of Yunnan University of Traditional Chinese Medicine, Kunming, Yunnan, China.
LGD = Guodong Li; MS = Xiangguang Ma and Wenguang Sun.
APPENDIX 2. Characteristics of 10 monomorphic microsatellite loci developed in Psammosilene tunicoides.
| Locus | Primer sequences (5′–3′) | Repeat motif | T a (°C) | Allele size (bp) | GenBank accession no. |
|---|---|---|---|---|---|
| E1 | F: CCCTTAGTTGTTACTTTCTC | (CA)3A(CA)5 | 50 | 230 | KJ159936 |
| R: TTGATTACTTCTTCGCCAC | |||||
| E3 | F: ACTTCGAGCAGAACAGACT | (CA)6 | 50 | 122 | KJ159939 |
| R: CAAATGGGACACTATAAATG | |||||
| E4 | F: TTTCTATCCAAAAGGCACT | (CT)4TT(CT)6 | 48 | 221 | KJ159941 |
| R: CAAACATAAGCAACATTCA | |||||
| E6 | F: TGGTCAAAGTAGGCAACA | (AG)8 | 52 | 117 | KJ159942 |
| R: CCACGTACCCAATCAAAT | |||||
| E8 | F: GCCATTGATTACTTCTTCG | (GT)5T(GT)3 | 56 | 236 | KJ159943 |
| R: AGCCCTTAGTTGTTACTTTCTC | |||||
| E9 | F: AACGCAACGCAGTCCCTC | (TC)6 | 52 | 222 | KJ159944 |
| R: ACCCAAGAATCCGTCCTA | |||||
| E11 | F: CCACGTACCCAATCAAATA | (CT)7 | 50 | 147 | KJ159946 |
| R: TGGTCAAAGTAGGCAACAC | |||||
| E12 | F: GAGAATTGGAGGGTGTAG | (GT)5 | 48 | 147 | KJ159948 |
| R: ACCTGAGAAAGATGGGAC | |||||
| Z1 | F: GCCATTGATTACTTCTTCG | (TC)6 | 53 | 192 | KJ159950 |
| R: AGCCCTTAGTTGTTACTTTCTC | |||||
| Z2 | F: TCAATGCAATTTAGGAGGAA | (GA)4 | 50 | 238 | KJ159954 |
| R: TGCTTGTTGAACCCTGTG |
T a = annealing temperature.
Zhang, A.‐L. , Gao Y.‐F., Li G.‐D., and Qian Z.‐G.. 2018. Development, characterization, and cross‐amplification of microsatellite markers for Psammosilene tunicoides (Caryophyllaceae). Applications in Plant Sciences 6(12): e1199.
Contributor Information
Guo‐Dong Li, Email: gammar116@163.com.
Zi‐Gang Qian, Email: qianzig@aliyun.com.
LITERATURE CITED
- Cavagnaro, P. F. , Senalik D. A., Yang L., Simon P. W., Harkins T. T., Kodira C. D., Weng Y., et al. 2010. Genome‐wide characterization of simple sequence repeats in cucumber (Cucumis sativus L.). BMC Genomics 11(1): 569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dai, Z. B. , Zhu C. C., Qian Z. G., and Pu C. X.. 2007. Genetic diversity analysis of germplasm resources of Psammosilene tunicoides . Chinese Traditional and Herbal Drugs 38(7): 1070–1073. [Google Scholar]
- Fu, L. G. , and Chin C. M.. 1992. China plant red data book: Rare and endangered plants. Science Press, Beijing, China. [Google Scholar]
- Kalia, R. K. , Rai M. K., Kalia S., Singh R., and Dhawan A. K.. 2011. Microsatellite markers: An overview of the recent progress in plants. Euphytica 177: 309–334. [Google Scholar]
- Li, J. , Song M., Xiong C., Zhao B., and Sun W.. 2016. Application of barcode high‐resolution melting for rapid authentication of the medicinal plant Psammosilene tunicoides . Biotechnology and Biotechnological Equipment 30: 1–7. [Google Scholar]
- Passos, M. A. , de Cruz V. O., Emediato F. L., de Teixeira C. C., Azevedo V. C., Brasileiro A. C., Togawa R. C., et al. 2013. Analysis of the leaf transcriptome of Musa acuminata during interaction with Mycosphaerella musicola: Gene assembly, annotation and marker development. BMC Genomics 14(1): 78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qu, Y. , Yu H., Wu G., Ma R.‐F., and Li Y.‐Y.. 2010. Genetic diversity and population structure of the endangered species Psammosilene tunicoides revealed by DALP analysis. Biochemical Systematics and Ecology 38: 880–887. [Google Scholar]
- Qu, Y. , Yu H., and Zhou X. L.. 2011. Review on study advances on rare and endangered medicinal herb Psammosilene tunicoides . China Journal of Traditional Chinese Medicine and Pharmacy 26: 1795–1797. [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete re‐implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Wei, W. , Qi X., Wang L., Zhang Y., Hua W., Li D., Zhang X., et al. 2011. Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired‐end sequencing and development of EST‐SSR markers. BMC Genomics 12: 451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zane, L. , Patarnello T., Ludwig A., Fontana F., and Congiu L.. 2002. Isolation and characterization of microsatellites in the Adriatic sturgeon (Acipenser naccarii). Molecular Ecology Resources 2: 586–588. [Google Scholar]
- Zhang, Q. Y. , Zhao Y. J., and Gong X.. 2011. Genetic variation and phylogeography of Psammosilene tunicoides (Caryophyllaceae), a narrowly distributed and endemic species in south‐western China. Australian Journal of Botany 59: 450–459. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.
