Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Dec 28.
Published in final edited form as: Cell Rep. 2016 Nov 1;17(6):1595–1606. doi: 10.1016/j.celrep.2016.10.027

Wnt9a Is Required for the Aortic Amplification of Nascent Hematopoietic Stem Cells

Stephanie Grainger 1,8, Jenna Richter 1,2,8, Raquel Espίn Palazόn 1, Claire Pouget 1, Brianna Lonquich 1, Sara Wirth 1, Kathrin Sabine Grassme 3, Wiebke Herzog 3,4,5, Matthew R Swift 6, Brant M Weinstein 7, David Traver 1,9,*, Karl Willert 1,*
PMCID: PMC6309681  NIHMSID: NIHMS997742  PMID: 27806298

Summary

All mature blood cell types in the adult animal arise from hematopoietic stem and progenitor cells (HSPCs). However, the developmental cues regulating HSPC ontogeny are incompletely understood. In particular, the details surrounding a requirement for Wnt/β-catenin signaling in the development of mature HSPCs are controversial and difficult to consolidate. Using zebrafish, we demonstrate that Wnt signaling is required to direct an amplification of HSPCs in the aorta. Wnt9a is specifically required for this process and cannot be replaced by Wnt9b or Wnt3a. This proliferative event occurs independently of initial HSPC fate specification, and the Wnt9a input is required prior to aorta formation. HSPC arterial amplification occurs prior to seeding of secondary hematopoietic tissues and proceeds, in part, through the cell cycle regulator myca (c-myc). Our results support a general paradigm, in which early signaling events, including Wnt, direct later HSPC developmental processes.

Graphical Abstract

graphic file with name nihms-997742-f0001.jpg

In Brief

Hematopoietic stem and progenitor cells (HSPCs) give rise to all of the blood cells of the adult organism; however, how these cells are derived in vivo is still incompletely understood. Using zebrafish, Grainger et al. find that Wnt9a mediates amplification of HSPCs prior to their migration to secondary hematopoietic sites.

INTRODUCTION

Hematopoietic stem cells (HSCs) both self-renew and generate all mature blood cell types throughout the lifespan of the vertebrate organism. Derivation of HSCs in vitro would allow patient-specific replacement therapies. Currently, deriving an HSC in vitro that is suitable for therapeutic use is not possible. Gaining a more thorough understanding of the molecular cues that direct HSC development in vivo will aid in improving protocols to derive HSCs from pluripotent precursors.

HSCs originate from arterial hemogenic endothelium (HE) during vertebrate development, a cell population derived from posterior lateral mesoderm (PLM) in lower vertebrates, which also forms the vascular cord and subsequently the aorta (Brown et al., 2000; Fouquet et al., 1997; Herbert et al., 2009; Jin et al., 2005; Liao et al., 1997). During the migration of PLM cells, inductive cues from the somites are thought to instruct the fate of HE from shared vascular precursors (Bertrand et al., 2010a; Burns et al., 2005; Butko et al., 2015; Clements et al., 2011; Clements and Traver, 2013; Kobayashi et al., 2014; Leung et al., 2013; Wilkinson et al., 2009; Zhen et al., 2013). Hematopoietic stem and progenitor cells (HSPCs) emerge directly from the floor of the dorsal aorta (DA; aorta hereafter) in a process termed the endothelial-to-hematopoietic transition (EHT) (Bertrand et al., 2010a; Kissa and Herbomel, 2010). In zebrafish, EHT begins at 26 hr post-fertilization (hpf), and the number of emerging HSPCs peaks at around 36 hpf (Bertrand et al., 2010a; Kissa and Herbo-mel, 2010). Following this transition, HSPCs enter circulation through the posterior cardinal vein and migrate to the caudal hematopoietic tissue (CHT) in zebrafish (analogous to the placenta/ fetal liver in mammals) for secondary amplification (Murayama et al., 2006; Tamplin et al., 2015), and finally to the kidney (akin to the mammalian bone marrow), where they reside for the remainder of adult life (Jagannathan-Bogdan and Zon, 2013). Although the anatomical location of these sites varies among organisms, HSC fate is likely instructed by conserved developmental cues. Understanding the inductive signals that instruct HSC fate from the mesoderm will be essential to the eventual derivation of HSCs from pluripotent precursors.

Wnt signaling is vital for the maintenance and development of stem cell populations in many organ systems, including the intestine, skin, and liver (Clevers and Nusse, 2012). Wnt genes encode lipid-modified, secreted growth factors that initiate signaling cascades, including the Wnt/β-catenin pathway (commonly referred to as the ‘‘canonical’’ Wnt pathway). Upon Wnt binding its cognate receptor encoded by a Frizzled (Fzd) gene, the β-catenin protein becomes stabilized and enters the nucleus, where it interacts with the lymphoid enhancer binding factor/T cell factor (LEF/TCF) transcription factors to drive expression of Wnt target genes and regulate a variety of developmental processes.

The role of Wnt function in HSPC development and function remains poorly understood, in part because of conflicting reports. For example, loss of Wnt function depleted the HSPC pool (Fleming et al., 2008; Goessling et al., 2009; Luis et al., 2009; Zhao et al., 2007), and activation of Wnt signaling resulted in an increased HSPC number (Baba et al., 2005; Goessling et al., 2009; Malhotra et al., 2008; Reya et al., 2003; Willert et al., 2003). In contrast, others have observed a depletion of the progenitor pool upon β-catenin overexpression (Kirstetter et al., 2006; Scheller et al., 2006), which may relate to dosage-dependent effects of Wnt signaling on different populations of blood cells (Luis et al., 2011). Although these studies establish that Wnt is essential for the function of adult HSPCs, what is lacking is a clear understanding of Wnt function during the embryonic development of HSPCs. In particular, it is unclear at what stage(s) of HSPC development Wnt is critical. Furthermore, the identification of a specific Wnt ligand regulating HSPC development remains elusive. Here, we demonstrate that Wnt signaling is required prior to formation of the aorta. We further show that the wnt gene wnt9a is expressed in relevant spatiotemporal do-mains and that HSPCs are depleted following loss of function of wnt9a; this loss of function cannot be rescued with ectopic expression of other wnt genes. This Wnt9a cue drives an early aortic amplification of HSPCs, which occurs after HSPC emergence begins. This proliferative event is mediated, at least in part, through regulation of myc-a (also known as c-myc).

RESULTS

Hematopoietic Stem Cell Numbers Are Affected by Wnt Signaling

Using zebrafish, in which complex developmental processes can be readily observed and dissected, we examined the requirement for Wnt signaling during HSPC development. We observed robust Wnt reporter activity in the floor of the dorsal aorta at 26 hpf (during HSPC emergence) using double transgenic 7X TCF:eGFP (Moro et al., 2012); kdrl:mCherry (Bertrand et al., 2010a) embryos, which express eGFP from a Wnt responsive sequence and membrane-bound mCherry in the vasculature (Figure S1A), indicating that endothelial cells have received a Wnt cue.

To monitor the effect of Wnt/β-catenin modulation on HSPCs, we used LiCl, which activates Wnt/β-catenin signaling through inhibition of GSK3b, and IWP-L6 (Wang et al., 2013), which inhibits Porcn, an essential regulator of Wnt ligand maturation and secretion (Kadowaki et al., 1996; Komekado et al., 2007). As previously established, dosages of 0.15 M LiCl or 1.5 mM IWP-L6 did not alter overall embryonic morphogenesis or vasculature, as visualized by kdrl:mCherry expression (Figure S1B), but were able to activate or inhibit Wnt signaling, respectively (van de Water et al., 2001; Wang et al., 2013), as measured by expression of the Wnt target gene axin2 (Jho et al., 2002) (Figure S1C).

HSPCs can be identified as kdrl:mCherry; cmyb:eGFP double positive cells in the floor of the aorta (Bertrand et al., 2010a). To determine if there was an overall function for Wnt leading to HSPC emergence, we treated larvae from 10 hpf to 36 hpf to activate [LiCl] or inhibit [IWP] Wnt and observed emerging HSPCs at 36 hpf, when their numbers peak (Bertrand et al., 2010a; Kissa and Herbomel, 2010). By doing so, we observed a 2-fold decrease and a 1.5-fold increase in HSPC number after Wnt inhibition [IWP] or activation [LiCl], respectively (Figures 1A and 1B). These effects were confirmed with reverse transcription qPCR for the hematopoietic marker cmyb (Figure S1D), indicating that Wnt signaling regulates HSPC number.

Figure 1. Wnt Signaling Is Required Transiently Prior to 20 hpf for HSPC Development.

Figure 1.

Open in a new tab

(A) kdrl:mCherry; cmyb:eGFP fish were treated with IWP-L6 or LiCl to inhibit and activate Wnt signaling, respectively (van de Water et al., 2001; Wang et al., 2013), from 10 hpf to 36 hpf and imaged at 36 hpf. A, aorta; V, vein. Scale bar, 30 mm.

(B) Quantitation of HSPCs per millimeter of aorta.

(C) Schematic of heat shock regimen.

(D) hsp:dntcf fish were heat shocked every hour from 13 hpf to 24 hpf, fixed at 40 hpf, and analyzed for cmyb expression by WISH. Scale bar, 100 mm.

(E) Quantitation of cmyb+ cells from (D).

(F) Schematic of experimental layout.

(G) hsp:dntcf fish were heat shocked at 16.5 hpf, pools were fixed every hour from 23 to 36 hpf, and they were analyzed for cmyb expression by WISH. Scale bar, 100 μm.

(H) Quantitation of cmyb+ cells from (G).

(I) HSPCs are specified as endothelial cells ingress toward the midline. Endothelial cells receive specification cues, at least in part, from somatic cells. At 26 hpf, HSPCs start to emerge from the floor of the dorsal aorta. A, aorta; V, vein.

**p < 0.01; ***p < 0.001; n.s., not significant. Error bars represent SD. See also Figure S1.

Wnt Is Required Transiently Prior to 20 hpf

To identify the window in HSPC development when Wnt is required, we used hsp:dntcf transgenic animals, which carry a dominant-negative version of tcf (dntcf), the expression of which rapidly inhibits expression of Wnt target genes (Figures S1E and S1F) (Clevers and Nusse, 2012; Lewis et al., 2004). We per-formed heat shocks each hour, spanning the window prior to HSPC emergence (13–26 hpf), followed by analysis of cmyb expression at 40 hpf by whole-mount in situ hybridization (WISH) (Kissa et al., 2008). Heat shock before 19 hpf resulted in a profound loss of cmyb expression in the aorta at 40 hpf, whereas heat shock at 20 hpf or later had no effect (Figures 1C–1E). Because the dntcf effect on axin2 expression occurs acutely and is long-lasting (Figure S1F), these results suggested that the role for Wnt in HSPC development occurs prior to 20 hpf. We confirmed these results with drug treatments (Figure S1G). Specification, when HSCs acquire identity cues, occurs as mesodermal cells migrate to the midline underneath the somites to form the aorta and vein (Kobayashi et al., 2014) (Figure 1I), and can be monitored with early expression of HSPC markers, such as runx1. The expression of runx1 at 26 hpf was unaffected following the drug treatment regime (Figure S1H) (Burns et al., 2005); dntcf expression at 13 hpf also did not affect runx1 or cmyb expression at 29 hpf (Figures S1I and S1J). These results indicate that Wnt signaling positively regulates the number of emerging HSPCs after specification.

We then sought to establish the timeline for the loss of HSPCs in the aorta by inducing expression of dntcf at 16.5 hpf and per-forming WISH for cmyb from 23 to 36 hpf. Using this approach, we determined that the earliest loss of cmyb+ cells was detected around 30 to 31 hpf, with an exaggeration of this effect seen through 33 hpf (Figures 1F–1H). Importantly, we could not detect an increase in apoptosis in dntcf animals at 32 hpf (Figure S2A). Therefore, in the absence of Wnt, HSPC numbers were diminished by a mechanism independent of apoptosis.

Wnt Cue Is Required in Cells of the HE

To test whether the Wnt signal is received by endothelial cells, we generated upstream activating sequence (UAS):dntcf and UAS:constitutively active (CA)-β-catenin transgenic animals to drive the previously reported dntcf or CA-β-catenin transgenes with Gal4 in the vasculature (Figures S2B–S2E). Similar to the ubiquitous induction of the hsp:dntcf transgene, endothelial-specific (using fli1a:Gal4) Wnt inhibition resulted in a loss of HSPCs at 40 hpf (Figures 2A–2C), whereas CA-β-catenin expression led to an increase in HSPCs at 40 hpf (Figure S2F), indicating that the Wnt signal acts upon vascular cells to influence HSPC development.

Figure 2. Wnt Cue Is Required in Cells of the HE.

Figure 2.

Open in a new tab

(A) Schematic of transgenic elements used for endothelial specific expression of dntcf in endothelial cells.

(B) WISH for cmyb at 40 hpf in control and in fli1a:Gal4; UAS:dntcf fish.

(C) Quantitation of cmyb+ cells from (B).

(D) Schematic of transgenic elements used for endothelial specific expression of dntcf in the HE.

(E) WISH for cmyb at 40 hpf in control and in gata2b:Gal4; UAS:dntcf fish.

(F) Quantification of cmyb+ cells from (E).

***p < 0.001. Scale bars, 100 μm. Error bars represent SD. See also Figure S2.

To determine if the Wnt cue is required broadly in endothelial cells, or more specifically in HE, we drove dntcf using a gata2b:Gal4 driver, which is expressed in the earliest known population of HE (the transient population of endothelial precursors that can differentiate into HSCs) (Butko et al., 2015). Similar to ubiquitous hsp:dntcf and endothelial-specific transgenes, Wnt inhibition in gata2b+ cells resulted in a loss of HSPCs at 40 hpf (Figures 2D–2F), indicating that the Wnt signal acts upon HE to influence HSPC development.

Wnt9a Is Required for HSPC Development

The data presented above establish an essential role for Wnt signaling in HSPC development. We have previously demonstrated that the ventral somite signals to neighboring endothelial precursors during HSPC migration to the embryonic midline (Clements et al., 2011; Kobayashi et al., 2014). The timing of the Wnt requirement in HSPC development suggested the somite as a possible source of Wnts. To identify candidate wnt gene(s), we surveyed expression of 21 wnt genes by qPCR in myf5-GFP positive (somitic) cells (Chen et al., 2007) prior to (16.5 hpf) and after (20 hpf). We identified wnt9a as our prime candidate because it is expressed at 16.5 hpf, and downregulated at 20 hpf (Figures S3A–S3C). By WISH, wnt9a transcript is detected in the posterior somites at 16.5 hpf; in regions consistent with vasculature at 19 hpf; and in the vasculature and the CHT by 28 hpf (Figure 3A).

Figure 3. Wnt9a Is Required for HSPC Formation.

Figure 3.

Open in a new tab

(A and B) WISH for wnt9a at 16.5 hpf, 19 hpf, and 24 hpf (A). Scale bars, 0.2 mm; representative images of n = 15. Imaged area is shown in (B).

(C and D) Representative images of kdrl:mCherry; cmyb:eGFP injected as listed (C). HSPCs per millimeter of aorta are quantified in (D). Scale bars, 30 mm.

(E) WISH for cmyb in 4 days post fertilization (dpf) fish treated with 0.1 ng or 1 ng of wnt9a MO. Scale bars, 0.2 mm.

(F) Wnt9a mutants were generated by injection of guide RNA targeting the last portion of the first exon. (G and H) Expression of cmyb was examined by WISH in 36 hpf WT, wnt9a+/D and wnt9aD/D- zebrafish

(G) and quantified in (H).

Scale bars, 100 mm. *p < 0.05; ***p < 0.001; n.s., not significant. Error bars represent SD. See also Figure S3.

To determine the effect of loss of wnt9a on HSPC development, we used a splice-blocking morpholino (MO) to knock down wnt9a expression in embryos (Figures S3D and S3E). Upon injection into embryos, this MO decreased Wnt signaling, as demonstrated by reduction in axin2 expression (Figure S3F). We observed a 2-fold decrease in kdrl:mCherry; cmyb: eGFP HSPCs emerging from the floor of the dorsal aorta at 36 hpf using this MO and a second MO designed to block translation of wnt9a (ATG-MO) (Figures 3B–3D). This phenotype was specific to the hematopoietic system because the vasculature, aorta, and pronephros were properly specified in MO-injected embryos (Figure S3G). MO knockdown of the closely related wnt9b gene did not affect HSPCs, suggesting that wnt9a is specifically required for HSPC development (Figures 3C and 3D). To further determine whether or not Wnt9a specifically instructs HSPC development, we performed co-injections of cDNA (to circumvent early lethality) encoding either wnt9a, wnt9b, or wnt3a with the wnt9a splice-blocking MO. Ectopic expression of wnt9a rescued HSPC numbers in wnt9a morphants (Figures 3C and 3D). In contrast, ectopic expression of wnt9b or wnt3a did not rescue the wnt9a MO effect on HSPC numbers (Figures 3C and 3D). These data suggest that Wnt9a specifically drives HSPC development, and that loss of wnt9a cannot be rescued by overexpression of other wnt genes.

The loss of HSPCs in wnt9a morphants persisted to later stages of embryonic hematopoiesis: at 4 days post-fertilization, we observed a dose-dependent loss of cmyb+ cells in the CHT, indicating a substantial decline in the total number of HSPCs (Figure 3E). Similar to enforced expression of dntcf, wnt9a knockdown had no effect on runx1 expression at 26 hpf (Figures S3H and S3I). Finally, because recent reports have indicated that MOs may have non-specific effects (Kok et al., 2015; Schulte-Merker and Stainier, 2014; van Impel et al., 2014), we confirmed that genetic mutation of wnt9a results in loss of cmyb+ cells at 36 hpf as well (Figures 3F–3H). We confirmed that somitic wnt9a is required for HSPC emergence by injecting a UAS:wnt9a cDNA construct into fish with a somitic gal4 driver (phldb1:gal4), in the context of the wnt9a MO, and found that somitic overexpression of wnt9a was sufficient to partially rescue the loss of HSPCs (Figures S3J and S3K). Taken together, these results indicate a defect in the emergence of HSPCs following loss of wnt9a.

Hematopoietic Precursors Expand in the Aorta

Next, we aimed to determine the mechanism underlying HSPC reduction upon loss of Wnt function. HSCs arise from hemogenic cells in the aorta, enter circulation, and seed the CHT, where they proliferate and differentiate before migrating to the adult hematopoietic tissues (Murayama et al., 2006). The observation that diminished Wnt signaling led to a decrease in aortic HSPCs suggested that HSPCs also undergo an expansion in the aorta. HSPCs can also be detected using kdrl:mCherry; gata2b:GFP double transgenic animals (Butko et al., 2015). We used this line for EdU pulse labeling at 26 hpf to detect proliferation events in emerging HSPCs at 33 hpf. With this approach, we could detect gata2b+ cells that had proliferated, prior to exit from the aorta (Figures 4A and 4B). We also detected proliferation events in kdrl:mCherry; cmyb:GFP animals at 32 hpf and as early as 30 hpf (Figures S4A and S4B). To determine the extent to which HSPCs proliferate in the aorta, we treated kdrl:mCherry; gata2b:GFP animals from 26 to 35 hpf with 5-fluorouracil, which selectively kills cells that have undergone DNA synthesis (Heidelberger et al., 1957). This resulted in a 2.5-fold reduction in the average number of HSPCs at 36 hpf (Figures 4C–4E), confirming a requirement for amplification of nascent HSPCs in the aorta.

Figure 4. HSPCs Expand in the Aorta.

Figure 4.

Open in a new tab

(A) The heart tubes of gata2b:GFP fish were injected with 1 nL of 10 mM EdU at 26 hpf, and fixed and stained for cells that had divided as well as GFP at 33 hpf (n = 10).

(B) Representative confocal image of gata2b+ cells that have undergone cell division in the aorta (arrowheads).

(C–E). gata2b:GFP;kdrl:mCherry fish were treated with 10 mM 5ˊ fluorouracil (5FU) from 24 to 35 hpf (C), confocal imaged at 36 hpf (D), and gata2b+ cells quantified (E).

(F and G) G1 arrested (mCherry+) endothelial cells (GFP+) from wnt9a mor-phant and control fish (n = 100 embryos per condition) were collected by FACS at 28 hpf (F) and compared by qPCR for gata2b (G).

Scale bars, 30 μm. Error bars represent SD. See also Figure S4.

Wnt9a Drives HSPC Proliferation in the Aorta through myca

The loss of HSPCs independent of apoptosis and the concomitant requirement for proliferation in the aorta suggested that in the absence of a Wnt cue, HSPCs may be G1 arrested; the FUCCI fish identifies G1-phase cells with the red fluorescent protein mCherry (Bouldin and Kimelman, 2014; Sugiyama et al., 2009). Endothelial cells in the G1 phase can therefore be sorted from kdrl:GFP; FUCCI morphant fish and compared to the same population from uninjected controls. We sorted G1-phase endothelial cells (kdrl:GFP; FUCCI) from morphant and uninjected fish. At 28 hpf, G1 cells from wnt9a MO-injected fish had robust expression of gata2b, whereas we were unable to detect gata2b transcripts in the uninjected sample; gata2b expression in un-sorted fish was similar in morphant and control fish, suggesting that HSPCs are G1 arrested in the absence of wnt9a (Figures 4F and 4G). We could also detect an increase in G1-arrested endothelial cells in wnt9a MO-injected animals (Figures S4C and S4D).

Entrance to the replicative S phase of the cell cycle is governed by a series of cellular events requiring D-class cyclins and their cofactors, cdk2 and cdk4 (Bertoli et al., 2013), which we predicted to be decreased in Wnt-reduced animals. Consistent with this model, we observed a profound loss of cyclinD2b and cdk4, and a small, but significant, decrease in cyclinD1 and cdk2 in Wnt-suppressed (dntcf+) endothelial cells at 30 hpf (Figures 5A and B). The transcriptional regulator and contextspecific Wnt target gene myca, which acts upstream of these cell cycle regulators (Mateyak et al., 1999), was also downregulated in dntcf+ endothelial cells (Figure 5B), whereas normal myca levels increase in endothelial cells during development, concordant with endothelial expansion (Figure S5A). We could not detect a loss of these cell cycle regulators at earlier time points, such as 24 hpf (Figure S5B). Accordingly, introducing myca mRNA in wnt9a morphants was sufficient to rescue the loss of cmyb+ cells at 40 hpf (Figures 5C and 5D) and of cell cycle regulators by 28 hpf (Figure S5C), indicating that at least a portion of Wnt9a function in HSPCs proceeds through myca. Finally, expressing myca expression under control of the gata2b promoter (in gata2b:KalTA4; UAS:myca) was sufficient to rescue the loss of wnt9a in morphants (Figures 5C and 5D), further supporting this requirement in the HE. Taken altogether, our results indicate that Wnt9a drives an early amplification of HSPCs up- stream of the cell cycle regulator myca in the HE (Figure 6).

Figure 5. Wnt9a Affects Endothelial gata2b+ G1-S Cell Cycle Progression through myca.

Figure 5.

Open in a new tab

(A) Endothelial cells (mCherry+) were collected by FACS from hs:dntcf:IRES-GFP; kdrl:mCherry fish at 30 hpf after heat shock at 16 hpf (n = 100 embryos per condition).

(B) Wnt inhibited (dntcf;GFP+) cells were com-pared to control (GFP ) cells by qPCR after being sorted by FACS.

(C and D) AB* fish were injected with wnt9a MO, myca mRNA, or both; phldb4:Gal4 fish were injected with wnt9a MO, UAS;myca plasmid, and transposase mRNA, fixed at 40 hpf, analyzed by WISH for cmyb (C), and quantified in (D).

Scale bar, 100 μm. *p < 0.05; ***p < 0.001; n.s., not significant. Error bars represent SD. See also Figure S5.

Figure 6. Early Wnt9a Cue Is Required for Later Hematopoietic Stem Cell Amplification.

Figure 6.

Open in a new tab

Prior to 20 hpf, ingressing cells of the posterior lateral mesoderm travel beneath the somites. Inductive cues direct from the somite instruct the fate of these cells, some of which are destined to become HE, and later, HSPCs. Wnt9a is expressed in the somite at this stage. By 26 hpf, the aorta has formed and HSPCs have begun to emerge. In the absence of Wnt9a, this early emergence is unaffected, indicating the HSPC fate specification has occurred properly. By 31 hpf, normal HSPCs undergo an expansion event, whereas those in Wnt9a-deficient animals do not.

DISCUSSION

Wnt signaling regulates multiple stages of hematopoiesis, but requirements for the specific molecules that mediate these signals are not well understood. This study sought to understand the regulation of specific wnt genes that instruct early hematopoietic development. We found that a single wnt gene, wnt9a, mediates a critical Wnt signal that is received by the endothelium prior to 20 hpf for HSPC emergence in the zebrafish. The Wnt9a signal stimulates a previously unrecognized HSPC amplification event in the aorta that is mediated through activation of myca, a Wnt-regulated gene, and important regulator of cell proliferation.

Previous work has demonstrated an early Wnt signaling requirement for the production of long-term HSCs in mouse and zebrafish (Goessling et al., 2009; Ruiz-Herguido et al., 2012); however, the identity of Wnt signaling components, particularly which of the numerous Wnts, has remained unclear. Here, we demonstrate a unique requirement for the somatically expressed wnt9a in HSPC development. Knockdown of wnt9a causes a decrease in cmyb+ hematopoietic precursors at 36 hpf, consistent with previous global knockdown of Wnt function in mouse and zebrafish (Goessling et al., 2009; Luis et al., 2009, 2011; Ruiz-Herguido et al., 2012). Extending these studies, we have found that loss of wnt9a expression does not cause a defect in HSPC specification, as evidenced by normal runx1 expression in the aorta at 26 hpf. This is also in contrast to other factors known to affect HSPC development at the level of specification (Butko et al., 2015; Clements et al., 2011; Espίn- Palazόn et al., 2014; Kim et al., 2014; Kobayashi et al., 2014; Lee et al., 2014; Pouget et al., 2014). For example, Wnt16 acts through a non-canonical Wnt pathway upstream of Notch signaling to specify HSPC identity (Clements et al., 2011), a process that is mediated by an interaction between the ventral somite and migrating vascular precursors (Kobayashi et al., 2014).

Loss of wnt9a cannot be compensated for by overexpression of other Wnt genes, suggesting that the requirement for Wnt9a in HSPC development is specific. This specificity is surprising because in many experimental settings, individual Wnt proteins produce similar effects and are often interchangeable. Our current understanding of specific Wnt interactions with their cognate receptors is quite limited and largely restricted to in vitro studies. For example, wingless (the Drosophila Wnt1 ortholog) interacts with the cysteine-rich domains (CRDs) of both Fz and Dfz2 (two Drosophila Fzd proteins that act redundantly in establishing segment polarity in the embryo), but with 10-fold lower affinity for Fz than for Dfz2 (Rulifson et al., 2000). Determining specificities of Wnts for their receptors is confounded by the large number of Wnts and Wnt receptors involved: the mammalian genome contains 19 wnt and 10 Fzd genes and the zebrafish genome contains 20+ wnt and 14 fzd genes. A recent study analyzed the interactions of four Wnt proteins with six Fzd CRDs and found a significant range in binding affinities among individual pairs (Dijksterhuis et al., 2015). Identifying the Fzd(s) and co-receptors expressed in the pre-HE during HSPC development will be informative in studying the interaction of Wnt9a with these potential receptors.

Wnt9a is well conserved among vertebrates (Curtin et al., 2011; Kamel et al., 2013) and is expressed in mouse HSPCs (Wu et al., 2012), indicating possible conservation of function during hematopoietic development. In this context, it is worth noting that in both zebrafish and mammals, the wnt9a gene is syntenic to wnt3a (Nusse, 2001), suggesting coordinate regulation of these two wnt genes. Importantly, Wnt3a has been implicated in HSC self-renewal in the mouse (Luis et al., 2009; Willert et al., 2003), but does not appear to have a role in zebrafish hematopoiesis (Buckles et al., 2004; Clements et al., 2009; Thorpe et al., 2005). A role for Wnt9a in mammalian hematopoietic development has not yet been addressed.

Interestingly, zebrafish embryos that are deficient for Wnt signaling do not show a hematopoietic phenotype until 30 hpf, which is 10 hr removed from the time that the signal is required. This delayed effect of a Wnt signal may be related to the concept of cellular memory put forth by Vincent and colleagues, who pro-posed that earlier signaling events allow persistent expression of relevant target genes (Alexandre et al., 2014). Our data indicate that during this time, cells of the HE are primed for amplification in the dorsal aorta. Upon loss of Wnt signaling via global pathway inhibition or wnt9a knockdown, these emerging HSPCs are arrested in the G1 phase of the cell cycle, causing a decrease in proliferating HSPCs and overall HSPC numbers. This regulation of the cell cycle is mediated, at least in part, by myca (the zebra-fish homolog of mammalian C-MYC), which, among other targets, controls transcription of D-class cyclin genes and their associated cyclin-dependent kinases (Amati et al., 1998; Hanson et al., 1994; Mateyak et al., 1999). These genes are downregulated when Wnt is inhibited, and loss of HSPCs in this context can be rescued with myca. Our findings are consistent with re-ports showing that MYC expression is vital to maintaining HSPC numbers and function (Delgado and Leόn, 2010; Laurenti et al., 2008) and studies using MYC as a factor to facilitate re-programming to HSPC fate (Riddell et al., 2014), and also that MYC is a context-dependent Wnt target (Cole et al., 2010; Kolligs et al., 1999; Muncan et al., 2006; Sansom et al., 2007). Although it appears that Myca operates downstream of the Wnt9a cue, further investigation will be required to determine the nature of the timing delay between 20 and 31 hpf because both myca transcript and protein are known to be tightly controlled, with estimated half-lives of 20–30 min or less (McCormack et al., 1984; Rabbitts et al., 1985). Interestingly, Myca and Notch1 (which is critical to HSC fate specification) have been previously shown to interact (Bertrand et al., 2010b; Bigas et al., 2013; Burns et al., 2005; Kim et al., 2014; Kumano et al., 2003; Palomero et al., 2006). However, we could not detect any differences in Notch reporter expression in wnt9a morphants (data not shown), suggesting that this process occurs independently of Notch signaling. This suggests that tight regulation of cell proliferation by the Wnt signaling pathway through myca is critical for proper hematopoietic development.

Our findings show a unique role for Wnt9a in zebrafish HSPC development. This signal is received by cells of the HE as they ingress to the midline to form the vascular cord prior to 20 hpf. The Wnt9a signal instructs HSPC emergence, but not HSPC specification, via priming HSPCs for later aortic amplification. The specific Wnts necessary to differentiate human pluripotent stem cells to hematopoietic or other lineages are often unknown or unused in protocols. Instead, global small molecule pathway activators or inhibitors are often favored because of their wide- spread availability and inexpensive nature. Our data indicate that the specific molecules that mediate a specific signal during in vivo development may provide more precise developmental instruction than small molecules with non-specific effects on signaling pathways, especially because differences in Wnt requirements could also be reflective of precise timing and ligand requirements. Understanding the precise identity of these instructive signals and their temporal regulation is critical for improving differentiation protocols to develop HSCs in vitro, which one day could be used as a therapeutic alternative to bone-marrow transplants.

EXPERIMENTAL PROCEDURES

Zebrafish Lines and Maintenance

Zebrafish were maintained and propagated according to University of California and local institutional animal care and use committee policies (protocol S04168). AB*, Tg(cmyb:eGFP)zf169Tg, Tg(hsp:Gal4)kca4Tg/+, Tg(kdrl:Cherry-CAAX)y171, Tg(fli1a:eGFP), Tg(kdrl:eGFP)s843, Tg(7X TCF-X.laveis-siamois: eGFP)ia4, Tg(fli1a:Gal4), Tg(gata2b:KalTA4; UAS:Lifeact:eGFP), Tg(Dual FUCCI), Tg(fli1a:EcRF-VP16), Tg(phldb1:KalTA4), and Tg(hsp70l:dntcf7l1a)w26 lines have been previously described (Bertrand et al., 2008, 2010a; Bouldin and Kimelman, 2014; Butko et al., 2015; Espίn-Palazόn et al., 2014; Jin et al., 2005; Kobayashi et al., 2014; Lawson and Weinstein, 2002; Lewis et al., 2004; Moro et al., 2012; North et al., 2007; Sugiyama et al., 2009; Swift et al., 2014). Tg(UAS-dntcf7l1a-CG2), Tg(UAS: wnt9a) and Tg(UAS:myca) founders were established by injecting 25 pg of the constructs described below with 100 pg of transposase mRNA at the one-cell stage. For simplicity in the text, these lines are referred to with shortforms listed in square brackets: Tg(cmyb:eGFP)zf169Tg [cmyb:eGFP], Tg(kdrl:Cherry-CAAX)y171 [kdrl:mCherry], Tg(fli1a:eGFP) [fli1a:eGFP], Tg(kdrl:eGFP)s843 [kdrl:eGFP], Tg(7X TCF-X.laveis-siamois:eGFP)ia4 [7XTCF:eGFP], Tg(gata2b:KalTA4; UAS:Lifeact:eGFP) [gata2b:eGFP] and Tg(hsp70l:dntcf7l1a)w26 [hsp:dntcf], Tg(UAS-dntcf7l1a-CG2)[UAS:dntcf], Tg(UAS: wnt9a) [UAS: wnt9a], Tg(UAS:myca) [UAS:myca], Tg(phldb1:KalTA4) [phldb:KalTA4], and Tg(Dual FUCCI) [FUCCI]. MOs for wnt9a were targeted to retain the first intron (Figure S3D) with sequence 50-GAAAGAATTGTCCTGCCTACCCGAA-3ˊ, or targeted to block the ATG start codon (wnt9a ATG-MO) with sequence 50-CCAGGAGAAGGTGTCCATCCAG CAT-3ˊ from GeneTools. One-cell stage zygotes were injected with 1 ng of wnt9a MO, and retention of the intron was confirmed by PCR. The ATG-MO was used at a concentration of 2 ng per injection. Mutation of the wnt9a locus was achieved by injecting 100 ng of cas9 mRNA (Trilink) and 100 ng of short guide RNA (sgRNA) targeting exon 1 (ATTGGGACGGCTAATAGATT). Muta-tions were confirmed by sequencing individuals. Modulation of Wnt signaling was carried out using 0.15 M LiCl or 1.5 mM IWP-L6 in E3 with PTU as previ-ously described (van de Water et al., 2001; Wang et al., 2013). For heat shock experiments, fish were heat shocked at 38 C for 10 or 30 min and were allowed to return to 28.5 C gradually. 5-Fluorouracil treatments were performed at 10 mM, with DMSO as a vehicle. Rescue experiments were performed using 10-pg myca mRNA synthesized using the SP6 mMessage machine kit (Ambion), according to the manufacturer’s recommendations.

WISH

RNA probe synthesis was carried out according to the manufacturer’s recommendations using the DIG-RNA labeling kit (Roche). Probes for dll4, hey2, notch1b, msr, kdrl, cdh17, cmyb, and runx1 and WISH protocols have been previously described (Clements et al., 2011; Kobayashi et al., 2014; Rowlinson and Gering, 2010), whereas the probe construct for wnt9a was a gift from W. Herzog.

Fluorescence-Activated Cell Sorting and qPCR

Zebrafish were dissociated using Liberase TM (Roche) and filtered through an 80-μm filter. Cells were sorted on a BD Influx cell sorter according to standard procedures. RNA and cDNA were synthesized by standard means and qPCR was performed using FastStart Universal SYBR Green Master Mix (Roche) according to the manufacturer’s recommendations and analyzed using the 2-∆∆Ct method (Schefe et al., 2006). Sequences of primers are shown in the Supplemental Experimental Procedures.

EdU and TUNEL Labeling

Zebrafish larvae were injected with 1 nL of 10 mM EdU into the heart at 26 hpf, fixed at later time points, and stained using the Click-iT EdU imaging kit (Invitrogen) according to the manufacturer’s recommendations. Transgenic reporters were stained using standard immunofluorescence with chicken anti-GFP (Aves Labs) and anti-mCherry [1C51] (abcam). TUNEL staining was carried out as previously described (Espίn-Palazόn et al., 2014).

Quantifying HSPCs

HSPCs were quantified by counting the number of kdrl:mCherry; cmyb:eGFP or kdrl:mCherry; gata2b:GFP double positive cells in the floor of the DA in the region above the yolk extension in a 625-μm confocal Z stack encompassing the entire mediolateral segment of the aorta. The number of HSPCs per millimeter was calculated from these data. Confocal images were generated by stacking one to four individual Z slices. When quantifying WISH data, the number of cmyb+ cells was counted above the yolk extension.

Plasmid Construction

Zebrafish dntcf7l1a lacking the β-catenin-binding domain was amplified by PCR and subcloned to pENTR1a dual selection and recombined with p5E-UAS, p3E-pA, and the Tol2 cmlc2:eGFP destination vector from the Tol2 kit (Kwan et al., 2007). Constructs to express zebrafish myca, wnt3a, wnt9a, and wnt9b were established by subcloning cDNA encoding each gene into pCS2+.

Supplementary Material

supp files

Highlights.

  • An early Wnt cue directs later HSPC proliferation, prior to secondary amplification

  • Wnt9a is uniquely required for early HSPC amplification

  • Myc is downstream of the Wnt cue necessary for proliferation

ACKNOWLEDGMENTS

IWP-L6 was a gift from L. Lum. We thank R. Rainville and K. Ong for fish husbandry; E. D. O’Connor, C. Fine, and K. E. Marquez for FACS assistance; and C. Bickers, E. Butko, B. Weijts, and N. Del Cid for technical assistance and reading of the manuscript. S.G. was supported by awards from the American Heart Association (14POST18340021) and the Leukemia and Lymphoma Society (5431–15). J.R. was supported in part by them CSD Interdisciplinary Stem Cell Training Program (CIRM TG2–01154). This work was supported in part by funding to K.W. from the UCSD Stem Cell Program and was made possible in part by the CIRM Major Facilities grant (FA1–00607) to the Sanford Consortium for Regenerative Medicine. D.T. was supported by Scholar Award 1657–13 from The Leukemia and Lymphoma Society and CIRM (RB4–06158).

REFERENCES

  1. Alexandre C, Baena-Lopez A, and Vincent JP (2014). Patterning and growth control by membrane-tethered Wingless. Nature 505, 180–185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amati B, Alevizopoulos K, and Vlach J (1998). Myc and the cell cycle. Front. Biosci 3, d250–d268. [DOI] [PubMed] [Google Scholar]
  3. Baba Y, Garrett KP, and Kincade PW (2005). Constitutively active beta-catenin confers multilineage differentiation potential on lymphoid and myeloid progenitors. Immunity 23, 599–609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bertoli C, Skotheim JM, and de Bruin RA (2013). Control of cell cycle tran-scription during G1 and S phases. Nat. Rev. Mol. Cell Biol 14, 518–528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bertrand JY, Kim AD, Teng S, and Traver D (2008). CD41+ cmyb+ pre-cursors colonize the zebrafish pronephros by a novel migration route to initiate adult hematopoiesis. Development 135, 1853–1862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bertrand JY, Chi NC, Santoso B, Teng S, Stainier DY, and Traver D (2010a). Haematopoietic stem cells derive directly from aortic endothelium during development. Nature 464, 108–111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bertrand JY, Cisson JL, Stachura DL, and Traver D (2010b). Notch signaling distinguishes 2 waves of definitive hematopoiesis in the zebrafish embryo. Blood 115, 2777–2783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bigas A, Guiu J, and Gama-Norton L (2013). Notch and Wnt signaling in the emergence of hematopoietic stem cells. Blood Cells Mol. Dis 51, 264–270. [DOI] [PubMed] [Google Scholar]
  9. Bouldin CM, and Kimelman D (2014). Dual fucci: a new transgenic line for studying the cell cycle from embryos to adults. Zebrafish 11, 182–183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Brown LA, Rodaway AR, Schilling TF, Jowett T, Ingham PW, Patient RK, and Sharrocks AD (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev 90, 237–252. [DOI] [PubMed] [Google Scholar]
  11. Buckles GR, Thorpe CJ, Ramel MC, and Lekven AC (2004). Combinatorial Wnt control of zebrafish midbrain-hindbrain boundary formation. Mech. Dev 121, 437–447. [DOI] [PubMed] [Google Scholar]
  12. Burns CE, Traver D, Mayhall E, Shepard JL, and Zon LI (2005). Hematopoietic stem cell fate is established by the Notch-Runx pathway. Genes Dev 19, 2331–2342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Butko E, Distel M, Pouget C, Weijts B, Kobayashi I, Ng K, Mosimann C, Poulain FE, McPherson A, Ni C-W, et al. (2015). Gata2b is a restricted early regulator of hemogenic endothelium in the zebrafish embryo. Development 142, 1050–1061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chen YH, Wang YH, Chang MY, Lin CY, Weng CW, Westerfield M, and Tsai HJ (2007). Multiple upstream modules regulate zebrafish myf5 expression. BMC Dev. Biol 7, 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Clements WK, and Traver D (2013). Signalling pathways that control vertebrate haematopoietic stem cell specification. Nat. Rev. Immunol 13, 336–348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Clements WK, Ong KG, and Traver D (2009). Zebrafish wnt3 is expressed in developing neural tissue. Dev. Dyn 238, 1788–1795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Clements WK, Kim AD, Ong KG, Moore JC, Lawson ND, and Traver D (2011). A somitic Wnt16/Notch pathway specifies haematopoietic stem cells. Nature 474, 220–224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Clevers H, and Nusse R (2012). Wnt/b-catenin signaling and disease. Cell 149, 1192–1205. [DOI] [PubMed] [Google Scholar]
  19. Cole AM, Myant K, Reed KR, Ridgway RA, Athineos D, Van den Brink GR, Muncan V, Clevers H, Clarke AR, Sicinski P, et al. (2010). Cyclin D2-cyclin-dependent kinase 4/6 is required for efficient proliferation and tumorigenesis following Apc loss. Cancer Res 70, 8149–8158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Curtin E, Hickey G, Kamel G, Davidson AJ, and Liao EC (2011). Zebra-fish wnt9a is expressed in pharyngeal ectoderm and is required for palate and lower jaw development. Mech. Dev 128, 104–115. [DOI] [PubMed] [Google Scholar]
  21. Delgado MD, and León J (2010). Myc roles in hematopoiesis and leukemia. Genes Cancer 1, 605–616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Dijksterhuis JP, Baljinnyam B, Stanger K, Sercan HO, Ji Y, Andres O, Rubin JS, Hannoush RN, and Schulte G (2015). Systematic mapping of WNT-FZD protein interactions reveals functional selectivity by distinct WNT-FZD pairs. J. Biol. Chem 290, 6789–6798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Espίn-Palazόn R, Stachura DL, Campbell CA, Garcίa-Moreno D, Del Cid N, Kim AD, Candel S, Meseguer J, Mulero V, and Traver D (2014). Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell 159, 1070–1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Fleming HE, Janzen V, Lo Celso C, Guo J, Leahy KM, Kronenberg HM, and Scadden DT (2008). Wnt signaling in the niche enforces hematopoietic stem cell quiescence and is necessary to preserve self-renewal in vivo. Cell Stem Cell 2, 274–283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Fouquet B, Weinstein BM, Serluca FC, and Fishman MC (1997). Vessel patterning in the embryo of the zebrafish: guidance by notochord. Dev. Biol 183, 37–48. [DOI] [PubMed] [Google Scholar]
  26. Goessling W, North TE, Loewer S, Lord AM, Lee S, Stoick-Cooper CL, Weidinger G, Puder M, Daley GQ, Moon RT, et al. (2009). Genetic interaction of PGE2 and Wnt signaling regulates developmental specification of stem cells and regeneration. Cell 136, 1136–1147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hanson KD, Shichiri M, Follansbee MR, and Sedivy JM (1994). Effects of c-myc expression on cell cycle progression. Mol. Cell. Biol 14, 5748–5755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Heidelberger C, Chaudhuri NK, Danneberg P, Mooren D, Griesbach L, Duschinsky R, Schnitzer RJ, Pleven E, and Scheiner J (1957). Fluorinated pyrimidines, a new class of tumour-inhibitory compounds. Nature 179, 663–666. [DOI] [PubMed] [Google Scholar]
  29. Herbert SP, Huisken J, Kim TN, Feldman ME, Houseman BT, Wang RA, Shokat KM, and Stainier DY (2009). Arterial-venous segregation by selective cell sprouting: an alternative mode of blood vessel formation. Sci-ence 326, 294–298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jagannathan-Bogdan M, and Zon LI (2013). Hematopoiesis. Development 140, 2463–2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jho EH, Zhang T, Domon C, Joo CK, Freund JN, and Costantini F (2002). Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol. Cell. Biol 22, 1172–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jin SW, Beis D, Mitchell T, Chen JN, and Stainier DY (2005). Cellular and molecular analyses of vascular tube and lumen formation in zebrafish. Development 132, 5199–5209. [DOI] [PubMed] [Google Scholar]
  33. Kadowaki T, Wilder E, Klingensmith J, Zachary K, and Perrimon N (1996). The segment polarity gene porcupine encodes a putative multitrans-membrane protein involved in Wingless processing. Genes Dev 10, 3116–3128. [DOI] [PubMed] [Google Scholar]
  34. Kamel G, Hoyos T, Rochard L, Dougherty M, Kong Y, Tse W, Shubi-nets V, Grimaldi M, and Liao EC (2013). Requirement for frzb and fzd7a in cranial neural crest convergence and extension mechanisms during zebra-fish palate and jaw morphogenesis. Dev. Biol 381, 423–433. [DOI] [PubMed] [Google Scholar]
  35. Kim AD, Melick CH, Clements WK, Stachura DL, Distel M, Panáková D, MacRae C, Mork LA, Crump JG, and Traver D (2014). Discrete Notch signaling requirements in the specification of hematopoietic stem cells. EMBO J 33, 2363–2373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kirstetter P, Anderson K, Porse BT, Jacobsen SE, and Nerlov C (2006). Activation of the canonical Wnt pathway leads to loss of hematopoietic stem cell repopulation and multilineage differentiation block. Nat. Immunol 7, 1048–1056. [DOI] [PubMed] [Google Scholar]
  37. Kissa K, and Herbomel P (2010). Blood stem cells emerge from aortic endothelium by a novel type of cell transition. Nature 464, 112–115. [DOI] [PubMed] [Google Scholar]
  38. Kissa K, Murayama E, Zapata A, Cortés A, Perret E, Machu C, and Her-bomel P (2008). Live imaging of emerging hematopoietic stem cells and early thymus colonization. Blood 111, 1147–1156. [DOI] [PubMed] [Google Scholar]
  39. Kobayashi I, Kobayashi-Sun J, Kim AD, Pouget C, Fujita N, Suda T, and Traver D (2014). Jam1a-Jam2a interactions regulate haematopoietic stem cell fate through Notch signalling. Nature 512, 319–323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kok FO, Shin M, Ni CW, Gupta A, Grosse AS, van Impel A, Kirchmaier BC, Peterson-Maduro J, Kourkoulis G, Male I, et al. (2015). Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish. Dev. Cell 32, 97–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Kolligs FT, Hu G, Dang CV, and Fearon ER (1999). Neoplastic transformation of RK3E by mutant beta-catenin requires deregulation of Tcf/Lef transcription but not activation of c-myc expression. Mol. Cell. Biol 19, 5696–5706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Komekado H, Yamamoto H, Chiba T, and Kikuchi A (2007). Glycosylation and palmitoylation of Wnt-3a are coupled to produce an active form of Wnt-3a. Genes Cells 12, 521–534. [DOI] [PubMed] [Google Scholar]
  43. Kumano K, Chiba S, Kunisato A, Sata M, Saito T, Nakagami-Yamagu-chi E, Yamaguchi T, Masuda S, Shimizu K, Takahashi T, et al. (2003). Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity 18, 699–711. [DOI] [PubMed] [Google Scholar]
  44. Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Camp-bell DS, Parant JM, Yost HJ, Kanki JP, and Chien CB (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon trans-genesis constructs. Dev. Dyn 236, 3088–3099. [DOI] [PubMed] [Google Scholar]
  45. Laurenti E, Varnum-Finney B, Wilson A, Ferrero I, Blanco-Bose WE, Eh-ninger A, Knoepfler PS, Cheng PF, MacDonald HR, Eisenman RN, et al. (2008). Hematopoietic stem cell function and survival depend on c-Myc and N-Myc activity. Cell Stem Cell 3, 611–624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Lawson ND, and Weinstein BM (2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol 248, 307–318. [DOI] [PubMed] [Google Scholar]
  47. Lee Y, Manegold JE, Kim AD, Pouget C, Stachura DL, Clements WK, and Traver D (2014). FGF signalling specifies haematopoietic stem cells through its regulation of somitic Notch signalling. Nat. Commun 5, 5583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Leung A, Ciau-Uitz A, Pinheiro P, Monteiro R, Zuo J, Vyas P, Patient R, and Porcher C (2013). Uncoupling VEGFA functions in arteriogenesis and hematopoietic stem cell specification. Dev. Cell 24, 144–158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Lewis JL, Bonner J, Modrell M, Ragland JW, Moon RT, Dorsky RI, and Raible DW (2004). Reiterated Wnt signaling during zebrafish neural crest development. Development 131, 1299–1308. [DOI] [PubMed] [Google Scholar]
  50. Liao W, Bisgrove BW, Sawyer H, Hug B, Bell B, Peters K, Grunwald DJ, and Stainier DY (1997). The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development 124, 381–389. [DOI] [PubMed] [Google Scholar]
  51. Luis TC, Weerkamp F, Naber BAE, Baert MRM, de Haas EFE, Ni-kolic T, Heuvelmans S, De Krijger RR, van Dongen JJM, and Staal FJT (2009). Wnt3a deficiency irreversibly impairs hematopoietic stem cell self-renewal and leads to defects in progenitor cell differentiation. Blood 113, 546–554. [DOI] [PubMed] [Google Scholar]
  52. Luis TC, Naber BAE, Roozen PPC, Brugman MH, de Haas EFE, Ghazvini M, Fibbe WE, van Dongen JJM, Fodde R, and Staal FJT (2011). Canonical wnt signaling regulates hematopoiesis in a dosage-depen-dent fashion. Cell Stem Cell 9, 345–356. [DOI] [PubMed] [Google Scholar]
  53. Malhotra S, Baba Y, Garrett KP, Staal FJ, Gerstein R, and Kincade PW (2008). Contrasting responses of lymphoid progenitors to canonical and noncanonical Wnt signals. J. Immunol 181, 3955–3964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Mateyak MK, Obaya AJ, and Sedivy JM (1999). c-Myc regulates cyclin D-Cdk4 and -Cdk6 activity but affects cell cycle progression at multiple inde-pendent points. Mol. Cell. Biol 19, 4672–4683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. McCormack JE, Pepe VH, Kent RB, Dean M, Marshak-Rothstein A, and Sonenshein GE (1984). Specific regulation of c-myc oncogene expres-sion in a murine B-cell lymphoma. Proc. Natl. Acad. Sci. USA 81, 5546–5550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Moro E, Ozhan-Kizil G, Mongera A, Beis D, Wierzbicki C, Young RM, Bournele D, Domenichini A, Valdivia LE, Lum L, et al. (2012). In vivo Wnt signaling tracing through a transgenic biosensor fish reveals novel activity do-mains. Dev. Biol 366, 327–340. [DOI] [PubMed] [Google Scholar]
  57. Muncan V, Sansom OJ, Tertoolen L, Phesse TJ, Begthel H, Sancho E, Cole AM, Gregorieff A, de Alboran IM, Clevers H, et al. (2006). Rapid loss of intestinal crypts upon conditional deletion of the Wnt/Tcf-4 target gene c-Myc. Mol. Cell. Biol 26, 8418–8426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Murayama E, Kissa K, Zapata A, Mordelet E, Briolat V, Lin H-F, Handin RI, and Herbomel P (2006). Tracing hematopoietic precursor migration to successive hematopoietic organs during zebrafish development. Im-munity 25, 963–975. [DOI] [PubMed] [Google Scholar]
  59. North TE, Goessling W, Walkley CR, Lengerke C, Kopani KR, Lord AM, Weber GJ, Bowman TV, Jang IH, Grosser T, et al. (2007). Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature 447, 1007–1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Nusse R (2001). An ancient cluster of Wnt paralogues. Trends Genet 17, 443. [DOI] [PubMed] [Google Scholar]
  61. Palomero T, Lim WK, Odom DT, Sulis ML, Real PJ, Margolin A, Barnes KC, O’Neil J, Neuberg D, Weng AP, et al. (2006). NOTCH1 directly regulates c-MYC and activates a feed-forward-loop transcriptional network promoting leukemic cell growth. Proc. Natl. Acad. Sci. USA 103, 18261–18266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Pouget C, Peterkin T, Simões FC, Lee Y, Traver D, and Patient R (2014). FGF signalling restricts haematopoietic stem cell specification via modulation of the BMP pathway. Nat. Commun 5, 5588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Rabbitts PH, Watson JV, Lamond A, Forster A, Stinson MA, Evan G, Fischer W, Atherton E, Sheppard R, and Rabbitts TH (1985). Metabolism of c-myc gene products: c-myc mRNA and protein expression in the cell cycle. EMBO J 4, 2009–2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Reya T, Duncan AW, Ailles L, Domen J, Scherer DC, Willert K, Hintz L, Nusse R, and Weissman IL (2003). A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423, 409–414. [DOI] [PubMed] [Google Scholar]
  65. Riddell J, Gazit R, Garrison BS, Guo G, Saadatpour A, Mandal PK, Ebina W, Volchkov P, Yuan G-C, Orkin SH, et al. (2014). Reprogramming committed murine blood cells to induced hematopoietic stem cells with defined factors. Cell 157, 549–564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Rowlinson JM, and Gering M (2010). Hey2 acts upstream of Notch in hematopoietic stem cell specification in zebrafish embryos. Blood 116, 2046–2056. [DOI] [PubMed] [Google Scholar]
  67. Ruiz-Herguido C, Guiu J, D’Altri T, Inglés-Esteve J, Dzierzak E, Espi-nosa L, and Bigas A (2012). Hematopoietic stem cell development requires transient Wnt/β-catenin activity. J. Exp. Med 209, 1457–1468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Rulifson EJ, Wu CH, and Nusse R (2000). Pathway specificity by the bifunctional receptor frizzled is determined by affinity for wingless. Mol. Cell 6, 117–126. [PubMed] [Google Scholar]
  69. Sansom OJ, Meniel VS, Muncan V, Phesse TJ, Wilkins JA, Reed KR, Vass JK, Athineos D, Clevers H, and Clarke AR (2007). Myc deletion rescues Apc deficiency in the small intestine. Nature 446, 676–679. [DOI] [PubMed] [Google Scholar]
  70. Schefe JH, Lehmann KE, Buschmann IR, Unger T, and Funke-Kaiser H (2006). Quantitative real-time RT-PCR data analysis: current concepts and the novel ‘‘gene expression’s CT difference’’ formula. J. Mol. Med. (Berl) 84, 901–910. [DOI] [PubMed] [Google Scholar]
  71. Scheller M, Huelsken J, Rosenbauer F, Taketo MM, Birchmeier W, Tenen DG, and Leutz A (2006). Hematopoietic stem cell and multilineage defects generated by constitutive b-catenin activation. Nat. Immunol 7, 1037–1047. [DOI] [PubMed] [Google Scholar]
  72. Schulte-Merker S, and Stainier DYR (2014). Out with the old, in with the new: reassessing morpholino knockdowns in light of genome editing technology. Development 141, 3103–3104. [DOI] [PubMed] [Google Scholar]
  73. Sugiyama M, Sakaue-Sawano A, Iimura T, Fukami K, Kitaguchi T, Kawa-kami K, Okamoto H, Higashijima S, and Miyawaki A (2009). Illuminating cell-cycle progression in the developing zebrafish embryo. Proc. Natl. Acad. Sci. USA 106, 20812–20817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Swift MR, Pham VN, Castranova D, Bell K, Poole RJ, and Weinstein BM (2014). SoxF factors and Notch regulate nr2f2 gene expression during venous differentiation in zebrafish. Dev. Biol 390, 116–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Tamplin OJ, Durand EM, Carr LA, Childs SJ, Hagedorn EJ, Li P, Yzaguirre AD, Speck NA, and Zon LI (2015). Hematopoietic stem cell arrival triggers dynamic remodeling of the perivascular niche. Cell 160, 241–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Thorpe CJ, Weidinger G, and Moon RT (2005). Wnt/beta-catenin regulation of the Sp1-related transcription factor sp5l promotes tail development in zebrafish. Development 132, 1763–1772. [DOI] [PubMed] [Google Scholar]
  77. van de Water S, van de Wetering M, Joore J, Esseling J, Bink R, Clevers H, and Zivkovic D (2001). Ectopic Wnt signal determines the eyeless pheno-type of zebrafish masterblind mutant. Development 128, 3877–3888. [DOI] [PubMed] [Google Scholar]
  78. van Impel A, Zhao Z, Hermkens DM, Roukens MG, Fischer JC, Peter-son-Maduro J, Duckers H, Ober EA, Ingham PW, and Schulte-Merker S (2014). Divergence of zebrafish and mouse lymphatic cell fate specification pathways. Development 141, 1228–1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Wang X, Moon J, Dodge ME, Pan X, Zhang L, Hanson JM, Tuladhar R, Ma Z, Shi H, Williams NS, et al. (2013). The development of highly potent inhibitors for porcupine. J. Med. Chem 56, 2700–2704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Wilkinson RN, Pouget C, Gering M, Russell AJ, Davies SG, Kimelman D, and Patient R (2009). Hedgehog and Bmp polarize hematopoietic stem cell emergence in the zebrafish dorsal aorta. Dev. Cell 16, 909–916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Willert K, Brown JD, Danenberg E, Duncan AW, Weissman IL, Reya T, Yates JR 3rd, and Nusse R (2003). Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423, 448–452. [DOI] [PubMed] [Google Scholar]
  82. Wu JQ, Seay M, Schulz VP, Hariharan M, Tuck D, Lian J, Du J, Shi M, Ye Z, Gerstein M, et al. (2012). Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line. PLoS Genet 8, e1002565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Zhao C, Blum J, Chen A, Kwon HY, Jung SH, Cook JM, Lagoo A, and Reya T (2007). Loss of β-catenin impairs the renewal of normal and CML stem cells in vivo. Cancer Cell 12, 528–541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Zhen F, Lan Y, Yan B, Zhang W, and Wen Z (2013). Hemogenic endothelium specification and hematopoietic stem cell maintenance employ distinct Scl isoforms. Development 140, 3977–3985. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supp files
NIHMS997742-supplement-supp_files.pdf (557.6KB, pdf)

RESOURCES