Skip to main content
International Journal of Genomics logoLink to International Journal of Genomics
. 2018 Dec 20;2018:4989602. doi: 10.1155/2018/4989602

The β-Lactamase Gene Profile and a Plasmid-Carrying Multiple Heavy Metal Resistance Genes of Enterobacter cloacae

Chongyang Wu 1,2, Chaoqin Lin 1,2, Xinyi Zhu 1,2, Hongmao Liu 1,2, Wangxiao Zhou 2, Junwan Lu 3, Licheng Zhu 3, Qiyu Bao 2, Cong Cheng 3,, Yunliang Hu 1,2,
PMCID: PMC6317114  PMID: 30671441

Abstract

In this work, by high-throughput sequencing, antibiotic resistance genes, including class A (bla CTX-M, bla Z, bla TEM, bla VEB, bla KLUC, and bla SFO), class C (bla SHV, bla DHA, bla MIR, bla AZECL-29, and bla ACT), and class D (bla OXA) β-lactamase genes, were identified among the pooled genomic DNA from 212 clinical Enterobacter cloacae isolates. Six bla MIR-positive E. cloacae strains were identified, and pulsed-field gel electrophoresis (PFGE) showed that these strains were not clonally related. The complete genome of the bla MIR -positive strain (Y546) consisted of both a chromosome (4.78 Mb) and a large plasmid pY546 (208.74 kb). The extended-spectrum β-lactamases (ESBLs) (bla SHV-12 and bla CTX-M-9a) and AmpC (bla MIR) were encoded on the chromosome, and the pY546 plasmid contained several clusters of genes conferring resistance to metals, such as copper (pco), arsenic (ars), tellurite (ter), and tetrathionate (ttr), and genes encoding many divalent cation transporter proteins. The comparative genomic analyses of the whole plasmid sequence and of the heavy metal resistance gene-encoding regions revealed that the plasmid sequences of Klebsiella pneumoniae (such as pKPN-332, pKPN-3967, and pKPN-262) shared the highest similarity with those of pY546. It may be concluded that a variety of β-lactamase genes present in E. cloacae which confer resistance to β-lactam antibiotics and the emergence of plasmids carrying heavy metal resistance genes in clinical isolates are alarming and need further surveillance.

1. Introduction

Bacteria of the Enterobacter cloacae complex (ECC), which comprises six species, namely, E. cloacae, E. asburiae, E. hormaechei, E. kobei, E. ludwigii, and E. nimipressuralis [1], are widely distributed in nature. As pathogens, ECC species are highly adapted to the environment and are able to contaminate hospital medical devices. Currently, E. cloacae and E. hormaechei are most frequently isolated from human clinical specimens, and E. cloacae is among the Enterobacter sp. that have most commonly caused nosocomial infections in the last decade [2]. Furthermore, E. cloacae has assumed clinical importance and has emerged as a major human pathogen; it accounts for up to 5% of hospital-acquired bacteremia cases, 5% of nosocomial pneumonia cases, 4% of nosocomial urinary tract infections, and 10% of postsurgical peritonitis cases [3].

Owing to the low-level but inducible expression of a chromosomal ampC gene encoding the AmpC β-lactamase, E. cloacae is intrinsically resistant to ampicillin, amoxicillin-clavulanate, and first-generation cephalosporins [4]. Generally, the resistance of E. cloacae to third-generation cephalosporins is caused by its overproduction of the AmpC β-lactamases when the production of this cephalosporinase is inducible in the presence of strong β-lactam antibiotics (cefoxitin and imipenem); thus, treatment with third-generation cephalosporins may promote the development of AmpC-overproducing mutants. AmpC-producing organisms become resistant to almost all β-lactam antibiotics, with the exception of cefepime, cefpirome, and carbapenems. Most chromosomal ampC genes are inducible in the presence of certain agents such as cefoxitin and imipenem. Inducible AmpC expression is regulated by AmpR in the presence of two other gene products, namely, AmpD and AmpG. The regulation of AmpC production has been historically understood to require three proteins: AmpG, a plasma membrane-bound permease; AmpD, a cytosolic peptidoglycan-recycling amidase; and AmpR, the transcriptional regulator of AmpC. Derepression has been associated previously with structural defects within the ampD gene or with decreased ampD expression. Derepression represents the inability of AmpR to keep AmpC expression at constitutively low wild-type levels [5]. As a result, the AmpC enzyme confers resistance to third-generation cephalosporins and is not inhibited by common β-lactamase inhibitors. However, fourth-generation cephalosporins still retain activity against most Enterobacteriaceae strains.

In addition to therapeutic antibiotic agents, a large number of other chemical substances with antibacterial activities, such as heavy metals and detergents, are used in human health care and agricultural practices. Recently, concerns have been raised regarding coselection for antibiotic resistance among bacteria exposed to disinfectants and heavy metals (particularly copper, zinc, and mercury) used in some livestock species as growth promoters and therapeutic agents [6]. Enterobacteriaceae (including E. coli, K. pneumoniae, and E. cloacae) are highly adept at acquiring resistance genes to all disinfectants, heavy metals, and antibiotics through horizontal gene transfer between different bacteria within the environment; such genes include extended-spectrum beta-lactamases (ESBLs), copper and arsenic resistance systems (the pco and ars operons), and enzymes that hydrolyze cephalosporins (AmpC enzymes) [7, 8]. Many gram-negative organisms (such as E. coli, E. cloacae, and K. pneumoniae) encode broad-substrate efflux pumps [6, 7, 9], and a variety of multidrug pumps that have activity against disinfectants are similarly encoded by some gram-positive organisms, including Staphylococcus aureus [9, 10]. Besides the efflux pumps, other mechanisms such as chemisorption facilitating cadmium to bind to the bacterial surface also played a role in the heavy metal (cadmium) resistance [11]. Alternatively, in both gram-positive and gram-negative bacteria, mechanisms of acquired resistance to disinfectants may be associated with efflux pump-encoding genes introduced on mobile genetic elements or, in gram-negative bacteria, with mutations causing the constitutive overexpression of efflux pumps. Compared with antibiotics and disinfectants, heavy metals (copper, arsenic, zinc, and mercury) are very persistent in the environment and may accumulate in soil, water, and sediments from agricultural practices as well as from other sources such as aquacultural and industrial effluents [12]. Like the mechanisms of resistance to disinfectants, efflux pumps can expel heavy metal ions; such pumps include elements of the czc system, which encodes a pump for zinc, cobalt, and cadmium, and pcoA, which is an element of a copper extrusion system (W. [13]).

In this study, we identified β-lactamase genes in 212 clinical E. cloacae isolates and sequenced a bla MIR gene-carrying strain. Molecular analyses were performed to analyze the function of the resistance genes, and a comparative genomics analysis was conducted to elucidate the potential horizontal gene transfer patterns of genes related to both antibiotic and heavy metal resistance between bacteria of different species or genera. Our analysis revealed the distinct structure of a large plasmid carrying multiple clusters of heavy metal resistance genes that, to our knowledge, have not been described previously in E. cloacae.

2. Materials and Methods

2.1. Bacterial Strain Collection, Genomic DNA Extraction, and High-Throughput Sequencing

A total of 212 nonduplicate clinically significant E. cloacae strains were isolated from the First Affiliated Hospital of Wenzhou Medical University (Zhejiang, China) between 2008 and 2012. These isolates were identified by a VITEK 60 microbial autoanalyzer (bioMérieux, Lyon, France). Bacteria and plasmids used in this study are listed in Table 1. Among the isolates, 31, 36, 43, 32, and 70 strains were isolated in the years 2008, 2009, 2010, 2011, and 2012, respectively. All strains were resistant to a minimum of one or two antibiotics. For pooled genomic DNA sequencing, each clinical strain was incubated in 5 mL of Luria-Bertani (LB) broth at 37°C for approximately 16 h to obtain a concentration equivalent to an optimum optical density (OD600 = 1.5 ± 0.2). The cultures were pooled, and genomic DNA was extracted from 100 mL of the mixed bacteria using an AxyPrep Bacterial Genomic DNA Miniprep Kit (Axygen Scientific, Union City, CA, USA). The pooled genomic DNA was sequenced with a HiSeq 2500 DNA sequencer at Annoroad Gene Technology Co. Ltd. (Beijing, China). Reads derived from the HiSeq 2500 sequencing were initially assembled de novo with SOAPdenovo software to obtain contigs of the genome sequences. Glimmer software (http://ccb.jhu.edu/software/glimmer) was used to predict protein-coding genes with potential open reading frames (ORF) > 150 bp in length. BLASTX (https://blast.ncbi.nlm.nih.gov) was used to annotate the predicted protein-coding genes against the nonredundant protein database with an e-value threshold of 1E-5.

Table 1.

Bacteria and plasmids used in this study.

Strain Relevant characteristic(s) Reference or source
BL21 E. coli BL21 was used as a host for the cloned bla MIR gene [14]
ATCC25922 E. coli ATCC25922 is FDA clinical isolate [14]
CG34 bla MIR-producing isolate of E. cloacae CG34 This study
CG76 bla MIR-producing isolate of E. cloacae CG76 This study
CG85 bla MIR-producing isolate of E. cloacae CG85 This study
Y546 bla MIR-producing isolate of E. cloacae Y546 This study
Y482 bla MIR-producing isolate of E. cloacae Y482 This study
Y490 bla MIR-producing isolate of E. cloacae Y490 This study
pET28a/BL21 BL21 carrying expression vector pET28a, kmr This study
pET28a-bla MIR-CG34/BL21 BL21 carrying recombinant plasmid pET28a-bla MIR-CG34 This study
pET28a-bla MIR-Y490/BL21 BL21 carrying recombinant plasmid pET28a-bla MIR-Y490 This study
pET28a-bla MIR-CG76/BL21 BL21 carrying recombinant plasmid pET28a-bla MIR-CG76 This study
pET28a-bla MIR-Y546/BL21 BL21 carrying recombinant plasmid pET28a-bla MIR-Y546 This study
pET28a-bla MIR-CG85/BL21 BL21 carrying recombinant plasmid pET28a-bla MIR-CG85 This study
pET28a-bla MIR-Y482/BL21 BL21 carrying recombinant plasmid pET28a-bla MIR-Y482 This study
pET28a-bla CTX-M-9a-Y546/BL21 BL21 carrying recombinant plasmid pET28a-bla CTX-M-9a-Y546 This study
pET28a-bla SHV-12-Y546/BL21 BL21 carrying recombinant plasmid pET28a-blaSHV-12-Y546 This study

km: kanamycin; r: resistant.

2.2. Collection of Reference Sequences for Resistance Genes and Mapping of Sequencing Reads to the Reference Genes

The nucleotide sequences of all β-lactamase genes, including those encoding for Ambler class A, B, C, and D β-lactamases, were obtained from the GenBank nucleotide database, and the high-throughput sequencing reads were mapped to the reference sequences of the β-lactamase genes as previously described [14]. The relative abundance (sequencing depth) of a certain gene was calculated as the cumulative nucleotide length of the mapped short reads on the gene divided by the gene size.

2.3. Screening of β-Lactamase Gene-Positive Strains and Cloning and Phylogenetic Analysis of bla MIR Genes

The E. cloacae strains were screened by PCR amplification for the presence of β-lactamase genes as previously described [1518]. The primers used for the cloning of complete ORFs contained a pair of flanking restriction endonuclease adapters (BamHI for the forward primers and HindIII for the reverse primers) and were designed using the Primer Premier 5.0 software package; the primers are shown in Table 2. Genomic DNA was extracted from each of the 212 clinical E. cloacae isolates using the AxyPrep Bacterial Genomic DNA Miniprep kit (Axygen Scientific, Union City, CA, USA) and was used as the template for PCR amplification. Positive amplification products were verified by sequencing with an ABI 3730 automated sequencer (Shanghai Sunny Biotechnology Co. Ltd., Shanghai, China), and the sequencing results were compared with Basic Local Alignment Search Tool (BLAST) algorithms (https://blast.ncbi.nlm.nih.gov/blast.cgi). The amplicons of the bla ORFs were digested with the corresponding restriction endonucleases and ligated into the pET-28a vector with a T4 DNA ligase cloning kit (Takara Bio Inc., Dalian, China). The recombinant plasmid was transformed into competent E. coli BL21 cells using the calcium chloride method and cultured on LB agar plates supplemented with ampicillin (200 μg/mL), and the cloned ORFs were confirmed by sequencing. For the phylogenetic analysis, all bla MIR gene sequences were collected from the NCBI nucleotide database using bla MIR as the key search term. A phylogenetic tree of the MIR amino acid sequences from both the database and this work was reconstructed by the maximum likelihood method, and the resulting trees were analyzed with bootstrap values of 100 replicates using MEGA 6.0 (https://www.megasoftware.net/).

Table 2.

Primers used in the study for the detection of β-lactamase-encoding genes.

Primer Target(s) Sequence (5′-3′) Annealing temperature (°C) Amplicon size (bp) Reference
veb-sf bla VEB GATTGCTTTAGCCGTTTTGTC 50 452 [15]
veb-sr ATCGGTTACTTCCTGTTGTTGTTTC
z-sf bla Z ACAGTTCACATGCCAAAGAGT 50 479 [16]
z-sr CTTACCGAAAGCAGCAGGTG
mir-sf bla MIR GCCGCACCGATGTCCGAAAAA 50 545 [18]
mir-sr GGTTTAAAGACCCGCGTCGTCATGG
azecl-29-sf bla AZECL-29 GTCTTTACGCTAACACCAGCATCGG 50 381 [17]
azecl-29-sr TCAGCATTTCCCAGCCCAATC
veb-ff bla VEB CGGGATCCATGAAAATCGTAAAAAGGATATTAT 50 918 This study
veb-fr CCCAAGCTTTATTTATTCAAATAGTAATTCCACG
z-ff bla Z CGGGATCCATGAAAAAGTTAATATTTTTAATTG 50 864 This study
z-fr CCCAAGCTTTAAAATTCCTTCATTACACTCTTG
mir-ff bla MIR CGGGATCCATGATGACAAAATCCCTAAGCTGTG 66 1164 This study
mir-fr CCCAAGCTTTACTGCAGCGCGTCGAGGATACGG
azecl-29-ff bla AZECL-29 CGGAATTCATGATGAAAAAAAACCTAAGCTGTG 60 1164 This study
azecl-29-fr CCCAAGCTTTACTGCAGCGCGTCGAGGATACG
ctx-m-9a-ff bla CTX-M-9a CGGGATCCATGGTGACAAAGAGAGTGCAACGGA 60 876 This study
ctx-m-9a-fr CCAAGCTTTTACAGCCCTTCGGCGATGATTCTC
shv-12-ff bla SHV-12 CGGGATCCGTGGTTATGCGTTATATTCGCCTGT 60 867 This study
shv-12-fr CCAAGCTTTTAGCGTTGCCAGTGCTCGATCAGC

Underlined sequences denote restriction endonuclease sites. sf: forward screening primer; sr: reverse screening primer; ff: forward full-length primer; fr: reverse full-length primer.

2.4. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing was conducted for all tested antibiotics by the agar dilution method, and the minimum inhibitory concentrations (MICs) were interpreted based on the Clinical and Laboratory Standards Institute (CLSI) breakpoint criteria (CLSI, 2018) (https://clsi.org/standards/products/packages/m02-m07-m100-package/). Strain ATCC 25922 was used as the quality control strain. The 14 antibiotics (or antibiotics combination) used in this work were cephamycins (cefoxitin and cefminox), semisynthetic broad-spectrum penicillins (ampicillin and piperacillin), a first-generation cephalosporin (cefazolin), third-generation cephalosporins (ceftazidime, cefoperazone, cefotaxime, and ceftriaxone), a fourth-generation cephalosporin (cefoselis), a monobactam (aztreonam), an aminoglycoside (kanamycin), and combinations of antibiotics with β-lactamase inhibitors (piperacillin/tazobactam and imipenem/cilastatin sodium hydrate) (Table 3).

Table 3.

The MIC values of antibacterial drugs for the strains (μg/mL).

Strains AMP KAN CAZ CTX CPZ CMN CEF CFZ FOX CRO ATM PRL PTZ IMC
ATCC25922 4 2 0.25 0.0625 0.125 1 0.125 2 4 0.0313 0.125 2 4 0.25
BL21 0.5 4 0.0625 0.0156 0.0156 1 0.0313 2 2 0.0156 0.0156 0.5 0.5 0.5
pET-28a/BL21 0.5 32 0.0625 0.0156 0.0156 1 0.0313 2 2 0.0156 0.0156 0.5 0.5 0.5
CG34 256 0.5 0.125 0.125 0.0625 1024 0.0625 512 1024 0.0313 0.25 2 2 4
Y490 256 2 0.5 0.25 1 >1024 0.125 512 1024 0.5 0.0313 2 4 2
CG76 >1024 8 128 128 64 1024 16 >1024 1024 512 32 512 32 8
Y546 512 2 2 1 2 >1024 0.25 1024 1024 2 1 8 8 4
CG85 >1024 4 1 1 1 >1204 0.25 1024 >1024 1 0.25 4 4 4
Y482 64 2 0.25 0.125 0.25 1024 256 512 0.0625 0 0.125 2 2 0.5
pET-28a-bla MIR (CG34)/BL21 128 64 4 4 1 32 0.125 256 32 4 1 8 8 1
pET-28a-bla MIR (Y490)/BL21 128 64 4 4 0.5 32 0.0625 256 32 4 1 8 4 1
pET-28a-bla MIR (CG76)/BL21 128 64 4 4 1 32 0.0313 256 32 4 1 8 4 1
pET-28a-bla MIR (Y546)/BL21 128 64 4 4 1 32 0.0625 256 32 4 1 8 8 1
pET-28a-bla MIR (CG85)/BL21 128 64 4 4 1 32 0.125 256 32 4 1 8 8 1
pET-28a-bla MIR (Y482)/BL21 128 64 4 4 1 32 0.125 256 32 4 1 8 8 1
pET-28a-bla CTX-M-9a/BL21 8 64 0.25 4 1 4 0.03 64 4 0.03 0.03 2 1 1
pET-28a-bla SHV-12/BL21 8 64 2 4 1 4 0.25 64 4 0.03 0.03 32 2 2

IPTG was added to a final concentration of 1 mmol/L to standard Mueller-Hinton (M-H) agar plates. All MIC determinations were performed by agar dilution assays. FOX: cefoxitin; CAZ: ceftazidime; CTX: cefotaxime; AMP: ampicillin; KAN: kanamycin; CPZ: cefoperazone; CMN: cefminox; CEF: cefoselis; CFZ: cefazolin; CRO: ceftriaxone; ATM: aztreonam; PRL: piperacillin; PTZ: piperacillin/tazobactam; IMC: imipenem/cilastatin sodium hydrate.

2.5. Whole Genome Sequencing (WGS) of Y546 and Comparative Genomics Analysis

The E. cloacae Y546 genomic DNA was extracted with the AxyPrep Bacterial Genomic DNA Miniprep Kit (Axygen Scientific, Union City, CA, USA) and sequenced with Illumina HiSeq 2500 and Pacific Biosciences sequencers at Annoroad Gene Technology Co. Ltd. (Beijing, China). Reads derived from HiSeq 2500 sequencing were initially assembled de novo with SOAPdenovo software to obtain genome sequence contigs. Reads of approximately 10-20 kb in length from the Pacific Biosciences sequencing were mapped onto the primary assembly for contig scaffolding. Gaps were filled either by remapping the short reads from the HiSeq 2500 sequencing or by sequencing the gap PCR product. Potential ORFs were predicted and annotated using Glimmer3 (http://www.cbcb.umd.edu/software/glimmer) and BASys [19], respectively. GC view software was used to construct the basic genomic features. Annotations were revised using UniProt (http://www.uniprot.org/) and BLAST (https://blast.ncbi.nlm.nih.gov/blast.cgi). Plasmid replicons and plasmid incompatibility groups were predicted using Plasmid Finder (https://cge.cbs.dtu.dk//services/PlasmidFinder/). Furthermore, the multilocus sequence typing (MLST) database for E. cloacae (https://pubmLst.org/ecloacae/) was used to determine the sequence type of E. cloacae Y546.

The plasmid and chromosomal genomic sequences used in this study for the whole genome comparative analysis were downloaded from the NCBI database (http://www.ncbi.nlm.nih.gov). The plasmid and chromosome sequences were selected based on the comparison of the whole genome sequence (pY546) against the sequences of plasmids and chromosomes available in the NCBI database; a cutoff value (max score) of approximately 8700 was defined. For the comparative analysis of the heavy metal gene cluster regions on the pY546 plasmid, the sequences containing corresponding gene clusters with sequence identities of ≥80% with respect to those encoded on pY546 were obtained from the NCBI nucleotide database by BLASTn algorithms. Multiple sequence alignments were performed using MAFFT [20]. Comparisons of the nucleotide sequences were made using BLASTn. Insertion sequences were predicted using ISfinder [21]. Orthologous groups of genes from plasmids or chromosomes were identified using BLASTp and Inparanoid [22]. Additional bioinformatics software was written using Python (https://www.python.org/) and Biopython [23].

2.6. Pulsed-Field Gel Electrophoresis (PFGE)

The clonal relatedness of MIR-producing E. cloacae isolates was assessed by XbaI (Takara Bio Inc., China) PFGE. Briefly, genomic DNA fragments were resolved on a 1% agarose (SeaKem Gold Agarose, Lonza) gel at 14°C, and electrophoresis was conducted at 6 V/cm using a CHEF PFGE instrument (Bio-Rad, USA) at a pulse time gradient of 2.25-55.5 s and a total run time of 18 h. Salmonella enterica serovar H9812 was used as a control. Cluster analysis was performed using an unweighted pair-group method with arithmetic (UPGMA) means. Isolates were allocated into genetic similarity clusters using a similarity cutoff value of 80% [24].

2.7. Nucleotide Sequence Accession Numbers

The sequences of the chromosome and the plasmid of Y546 and the bla MIR genes in this work have been submitted to NCBI GenBank with accession numbers of CP032916 (Y546), CP032915 (pY546), MK033024 (bla MIR-CG34), MK033023 (bla MIR-Y490), MK033025 (bla MIR-CG76), MK033026 (bla MIR-Y546), MK033021 (bla MIR-CG85), and MK033022 (bla MIR-Y482), respectively.

3. Results

3.1. Mapping and Screening Results for the β-Lactamase Genes in the Sequenced Bacteria

A total of 75 β-lactamase gene sequences were collected from the database (Supplementary Table S1). The pooled genomic DNA sequences of the 212 isolated strains generated approximately 34.1 gigabases. All reads ranged from 100 to 110 nucleotides in length. The mapping of the sequencing reads onto the reference sequences yielded the identification of resistance genes; in addition, the quantity of mapped reads on a specific reference could suggest the relative abundance of the reads in the sequenced samples. This analysis showed that the samples contained a total of 12 hits related to β-lactamase resistance genes. The most abundant gene was bla TEM, which had a sequence depth of 466.15 (Supplementary Table S2). The other genotypes with a greater abundance were bla SHV, bla DHA, and bla CTX-M (especially the bla CTX-M-9 and bla CTX-M-1 subtypes), while the genotypes with a lower abundance were bla Z, bla VEB, bla KLUC, bla MIR, bla SFO , bla AZECL, bla OXA, and bla ACT. The screening results for the bla VEB, bla Z, bla AZECL, and bla MIR genotypes revealed that among the 212 strains, only 0.47% (1/212; Y412), 0.94% (2/212; CG3 and CG4), 0.94% (2/212; Y411 and CG90), and 2.83% (6/212; CG34, Y490, CG76, Y546, CG85, and Y482) carried bla VEB, bla Z, bla AZECL, and bla MIR, respectively.

3.2. Cloning and Functional Detection of the Resistance Genes

Fourteen antimicrobial agents were used to detect the MIC levels of the bla MIR -positive wild-type strains and the recombinant strains expressing the cloned bla MIR genes (pET28a-bla MIR/BL21). The MICs of the 14 antimicrobial agents against these strains are shown in Table 3. The MICs for all 6 bla MIR-positive wild-type strains (CG34, Y490, CG76, Y546, CG85, and Y482) demonstrated that they were resistant to 4 commonly used broad-spectrum beta-lactam antibiotics, including ampicillin, a first-generation cephalosporin (cefazolin), and cephamycins (cefmenoxime and cefoxitin), and E. cloacae CG76 displayed higher resistance levels than the other strains to all antibiotics tested. Like the host wild-type strains, the 6 recombinant strains expressing the cloned bla MIR genes (pET28a-bla MIR/BL21) were resistant to ampicillin, cefazolin, cefmenoxime, and cefoxitin. In addition, the recombinants with two other extended-spectrum β-lactamase (ESBL) genes, namely, bla SHV-12 and bla CTX-M-9a, encoded on the Y546 chromosome displayed higher hydrolytic activity against these four β-lactam antibiotics.

3.3. Clonal Relatedness of the bla MIR-Positive Strains and Genotypes and the Phylogenetic Tree Analysis of the bla MIR Genes

All 6 bla MIR-positive strains (Y490, Y482 CG34, CG76, CG85, and Y546) had distinct XbaI PFGE patterns (Figure 1), indicating that the prevalence of bla MIR-positive isolates was caused by disseminated gene transfer. Sequencing results showed that the bla MIR ORFs from strains CG85 and Y482 belonged to the bla MIR-17 genotype, while the ORFs from strains CG34, CG76, Y490, and Y546 matched bla MIR-5, bla MIR-21, bla MIR-3, and bla MIR-20, respectively. These ORFs had 99% amino acid similarity to their respective reference sequences. To further analyze the evolutionary relationship of the 6 bla MIR genes identified in this work with other bla MIR genes, we performed a multiple sequence alignment on a total of 30 bla MIR variants including the 6 bla MIR genes identified in this study. The multiple-sequence alignment identified the Pro380Leu variant in bla MIR-Y546, bla MIR-Y482, and bla MIR-Y490 and the Ala381Gln variant in bla MIR-CG76, bla MIR-CG85, bla MIR-Y546, bla MIR-Y482, and bla MIR-Y490. The Asn206His variant was identified only in bla MIR-CG34 (Figure 2). The phylogenetic analysis (Figure 3) showed that with the exception of 2 sequences from CG85 and Y482 that had the same amino acid sequence and were located in the same branch, the 6 MIR proteins were located in unique branches.

Figure 1.

Figure 1

Pulsed-field gel electrophoresis (PFGE) analysis of the 6 bla MIR-positive E. cloacae isolates. PFGE result showed that all 6 bla MIR-positive isolates had a totally distinct PFGE pattern.

Figure 2.

Figure 2

Comparison of the MIR amino acid sequences from 6 E. cloacae isolates.

Figure 3.

Figure 3

Phylogenetic tree of 30 MIR amino acid sequences. The “●” symbols indicate the MIRs of this study.

3.4. General Features of the Y546 Genome

The genome of E. cloacae strain Y546 consists of a chromosome and a plasmid (pY546); the general features of the Y546 genome are shown in Table 4. The chromosome is 4.78 Mb in length, harbors 4312 ORFs, and has an average GC content of 56.02%. In addition to an ampC gene bla MIR, the chromosome also encodes two other extended-spectrum β-lactamase (ESBL) genes, namely, bla CTX-M-9 and bla SHV-12. MLST determined that E. cloacae strain Y546 contains the leuS-90, rpoB-20, gyrB-127, dnaA-120, fusA-25, and rplB-12 alleles and belongs to the sequence type ST466. The pY546 plasmid, an IncHI1B plasmid, is 208,740 bp in length and encodes 232 ORFs (Supplementary Table S3), of which 56.89% (132/232) encode proteins with known functions, and it contains a number of accessory modules identified at different sites within the backbone. pY546 contained an incomplete copper resistance operon (pcoBCDE/cusRS, ORF91-96) and several clusters of genes related to resistance to other metals, including arsenic (arsABCDR, ORF100-105), tetrathionate (ttrABCDRS, ORF142-146) and tellurite (terCDEF, ORF153-156). This plasmid also encodes numerous metallic ion metabolism and transfer proteins, such as a potassium transporter (Kef, ORF109), a fluoride ion transporter (CrcB, ORF113), divalent cation transporters (ORF111 and ORF112), and voltage-gated chloride channel proteins (ORF120 and ORF121). In addition, TonB-dependent receptors (TBDRs, ORF12-14), which are involved in the uptake of essential nutrients, are identified in pY546.

Table 4.

General features of the Y546 genome.

Chromosome Plasmid
Size (bp) 4,787,919 208,741
GC content (%) 56.02 52.63
ORFs 4312 234
Known proteins 3476 (80.6%) 137 (58.5%)
Hypothetical proteins 836 (19.4%) 97 (41.5%)
Protein coding (%) 88.02 82.80
Average ORF length (bp) 977 738
Average protein length (aa) 324 245
tRNAs 85 0
rRNA operons (16S-23S-5S) 7 0
16S-23S-5S-5S

3.5. Comparative Genomic Analysis of the pY546 Plasmid Genome

A total of six sequences having greater than 40% nucleotide sequence identity to the pY546 sequence were retrieved from GenBank. Four of these were plasmid sequences, namely, pKPN-332 of K. pneumoniae strain KPNIH39 (49%, CP014763.1), pKPN-3967 of K. pneumoniae strain KPNIH49 (47%, CP026186.1), plasmid unnamed 1 of K. pneumoniae strain KSB2_1B (44%, CP024507.1), and pKPN-262 of K. pneumoniae subsp. pneumoniae KPNIH27 (44%, CP007734.1). The other two were chromosome sequences of E. coli S43 (41%, CP010237.1) and E. coli MEM (40%, CP012378.1) (Figure 4). Comparative genomics analysis showed that pY546 is approximately 80-100 kb smaller than any of the three named plasmids (pKPN-332, pKPN-3967, and pKPN-262). The sequences of 102 genes (43.4%, 102/235) on pY546 showed high similarity (>90%) with those on each of the three named plasmids. These plasmids shared a conserved backbone sequence with pY546; the backbone included the replication initiation gene (repA), stable maintenance genes (parAB or sopAB), DNA mismatch repair system genes (mutS), and so on. On the other hand, all these plasmids possessed their own variable regions, which mainly included heavy metal (cop, ars, and ter) resistance gene clusters and hypothetical genes. The tetrathionate resistance genes (ttrABCRS) encoded on pY546 were not present in the three named plasmids. The named plasmids also had multiple copies of common mobile elements, such as transposons and insertion elements (IS). In the two E. coli (S43 and MEM) chromosome sequences, the pco gene cluster (pcoABCDRSE) was detected in MEM but not in S43. Nevertheless, arsBCD, which is a part of the arsenic resistance determinants, was present in both S43 and MEM. The tetrathionate resistance genes were unique to pY546, while the chromosome of S43 carried the ter operon, but the MEM chromosome did not (Figure 4). The ter operon terCDEF was detected and in the same orientation in the three plasmids pKPN-332, pKPN-3967, and pKPN-262.

Figure 4.

Figure 4

Complete sequence of the pY546 plasmid and comparative genomic analysis of the pY546 plasmid sequence with other sequences. The circles (from innermost to outermost) represent (i) the scale in kb; (ii) the cumulative GC skew; (iii) the GC content; (iv) the annotated coding sequences with selected genes indicated according to the gene function: heavy metal resistance genes in red arrows, transposase genes, IS elements in bottle-green arrows, and hypothetical proteins in dark gray arrows; (v) circles (from inside to outside) representing three homologous plasmids (pKPN-332, CP014763.1; pKPN-3967, CP026186.1; and pKPN-262, CP007734.1) and two chromosome fragments (S43, CP010237.1, and MEM, CP012378.1), respectively.

3.6. Comparative Analysis of Copper and Arsenic Resistance Gene Regions on the pY546 Plasmid

Comparative analysis of an 8.7 kb fragment of pY546 encoding both copper (pco) and arsenic (ars) operons showed that the 5 sequence fragments with the highest similarity to that of pY546 were 4 fragments from the pKO_JKo3_1 plasmid of Klebsiella oxytoca JKo3 (100%, AP014952.1), the pKPN1705-1 plasmid of Klebsiella quasivariicola KPN1705 (100%, CP022824.1), the CSK29544_3p plasmid of Cronobacter sakazakii ATCC 29544 (100%, CP011050.1), and the pKPN-262 plasmid of Klebsiella pneumoniae subsp. pneumoniae KPNIH27 (82%, CP007734.1) and 1 fragment from the chromosome of Escherichia coli MEM (CP012378.1, 82%) (Figure 5). The fragment sharing the highest sequence identity with that of pY546 (from E. cloacae) was in the CSK29544_3p plasmid of Enterobacter sakazakii. All sequences except for pY546 contained the complete copper (pco) operon structure. pY546, however, contained an incomplete copper (pco) operon with a truncated pcoB (△pcopB) gene and without pcoA gene. Four (pY546, CSK29544_3p, pKO_Jko3_1, and pKPN1705-1) sequences contained the complete ars operon gene clusters. Moreover, the latter two plasmids (pKO_Jko3_1 and pKPN1705-1) contained an additional functional gene, namely, arsH, which encoded an organoarsenical oxidase (NADPH-dependent FMN reductase) [25] and conferred resistance to trivalent forms of organoarsenic compounds. Two of the plasmids (pKO_Jko3_1 and pKPN1705-1) were also identified to contain two copies of arsA and arsD with inverted orientations. The CSK29544_3p plasmid contained the same gene arrangement and content as pY546, but pY546 and CSK29544_3p contained fewer genes than the other two plasmids (pKO_Jko3_1 and pKPN1705-1). The pY546 and CSK29544_3p plasmids lacked arsH and contained only one copy each of arsAD, which was oriented oppositely in these two plasmids. On the other hand, the arsBCRH gene cluster was identified in pKPN-262, while the MEM chromosome contained arsBCR but lacked arsH.

Figure 5.

Figure 5

Comparative analysis of the copper and arsenic resistance gene clusters of pY546 and other sequences from different bacteria. The homologous gene clusters among plasmids pY546, CSK29544_3P (CP011050.1), pKO_JKo3_1 (AP014952.1), pKPN1705-1 (CP022824.1), pKPN-262 (CP007734.1), and MEM (CP012378.1) with the copper resistance gene clusters in bottle green, and the arsenic resistance gene cluster in orange. Annotated coding sequences are displayed as arrows. Coding sequences are colored based on their assigned gene functions.

4. Discussion

The production of β-lactamases is the predominant β-lactam resistance mechanism in gram-negative bacteria. The Ambler molecular classification categorizes these β-lactamases into four enzyme classes, namely, A, B, C, and D. Class A, C, and D enzymes all possess an active site serine, whereas class B β-lactamases are metalloenzymes with a Zn2+ ion(s) in the active site [26]. In this study, a total of 12 β-lactamase-encoding genes, including 7 class A β-lactamase genes (bla SHV, bla CTX-M, bla Z, bla VEB, bla KLUC, bla SFO, and bla TEM), 4 class C β-lactamase genes (bla MIR, bla DHA, bla ACT, and bla AZECL-29), and 1 class D β-lactamase gene (bla OXA) were identified in 212 E. cloacae isolates from a teaching hospital in South China. Over the past years, a variety of metalloenzymes (NDM- and IMP-type) have been found in E. cloacae and have contributed to infectious outbreaks in China [27] and Japan [28]. However, we did not detect any genes encoding class B metalloenzymes in these 212 E. cloacae isolates.

The class A enzymes are regarded as extended-spectrum β-lactamases (ESBLs) that can hydrolyze extended-spectrum cephalosporins; they are inhibited by clavulanic acid and are spreading widely among Enterobacteriaceae. The CTX-M enzymes are replacing the SHV and TEM enzymes as the most prevalent type of ESBL in Enterobacteriaceae [29, 30]. Additional clinically relevant types of ESBLs include the VEB, PER, GES, TLA, IBC, SFO-1, BES-1, and BEL-1 types. The SFO-1 β-lactamase was first reported in 1988 in a clinical E. cloacae isolate in Japan, and it confers resistance to third-generation cephalosporins (Matsumoto & Inoue, 1999); VEB was reported in China during an outbreak of infection caused by E. cloacae [31]. No document has yet reported the identification of the bla Z gene that encodes class A enzymes in E. cloacae, and the bla Z gene has been found only once in Staphylococcus aureus [16]. In this work, however, we isolated two E. cloacae strains (CG3 and CG4) that carried the bla Z gene.

In addition to the bla MIR and blaDHA genes identified in this work, genes encoding AmpC enzymes belonging to Ambler class C and Bush-Jacoby group 1 include bla CMY, bla FOX, bla LAT, bla ACT, bla MOX, bla ACC, and bla BIL and their derivatives (H. [32]). The emergence of AmpC-producing Enterobacter spp. has been observed globally in health care-associated settings and in the community [33]. However, unlike most of the AmpC genes, bla MIR has been found only in some strains of several Enterobacter spp., mainly in strains of E. cloacae. A total of 24 bla MIR nucleotide sequences (between the bla MIR-1 and bla MIR-21 subtypes) are available in the NCBI nucleotide database; these sequences mainly came from the ECC, such as E. cloacae and E. aerogenes, as well as strains of K. pneumoniae and E. coli. In this work, 6 MIRs belonged 5 subtypes, including bla MIR-3, bla MIR-5, bla MIR-17, bla MIR-21, and bla MIR-20. Although the bla MIR gene has been primarily identified on bacterial chromosomes, it is also encoded on plasmids. The AmpC β-lactamase bla MIR-1 was first described in K. pneumoniae plasmids [34]; bla MIR-1 confers resistance to penicillins and broad-spectrum cephalosporins, including cefoxitin and ceftibuten, but not to cefepime, cefpirome, meropenem, or imipenem. The resistance features of bla MIR genes in human and animal isolates were different from those of some plasmid-encoded AmpC-type β-lactamase genes, such as bla DHA and bla CMY, and have been reported worldwide to hydrolyze third-generation cephalosporins [35, 36]. The bla MIR gene identified in this work was encoded on the chromosome and showed high sequence identity with other homologous bla MIR genes found in other Enterobacteriaceae. Like the other previously reported MIRs, they showed resistance to ampicillin, cefazolin, cefmenoxime, and cefoxitin, but sensitive to fourth-generation cephalosporins (cefoselis) and monobactam (aztreonam).

To adapt to environmental changes, bacteria often harbor genes conferring resistance to toxic metal compounds; these genes include those encoding copper and arsenic ion transportation systems [37]. Copper sulfate is a common feed supplement for pigs, chickens, and calves worldwide. The copper-binding operon system (PcoBCDE and CusR/S), which is known to transport copper-derived compounds out of the bacterial cell to balance the concentration of copper salts, was elaborated on the pRJ1004 plasmid of E. coli isolates from piggeries in which the animals were provided food supplemented with copper sulfate [38]. Despite the identity of arsenic and arsenite compounds as high-toxicity compounds that are neither used in agriculture nor found in either the community or the hospital sector, the presence of arsenic resistance determinants on Enterobacteriaceae plasmids, especially the IncH-type plasmids, has been described before [9]. Three prototypes of ars operons, including the three-, four-, and five-gene arsenic resistance determinants, namely, arsABC, arsABCD, and arsABCDR, respectively, have been well documented, although novel resistance mechanisms have also been described [39]. The arsABCDR operon is related to resistance to arsenic-derived compounds, including arsine, arsenic, arsenite, and arsenate. Heavy metal resistance genes or gene clusters have been widely identified in different genera of both gram-positive and gram-negative bacteria and are encoded on both chromosomes and plasmids. In this work, on the plasmid pY546, we found four clusters of genes conferring resistance to heavy metals, such as arsenic (arsABCDR), tetrathionate (ttrABCDRS), and tellurite (terCDEF) as well as an incomplete copper resistance operon (pcoBCDE/cusRS). We must expect that bacteria have adapted to heavy metals with an increasing frequency.

5. Conclusion

In this work, through high-throughput sequencing, we identified twelve β-lactamase genotypes in 212 clinical E. cloacae isolates; of these, bla Z has not yet been reported in E. cloacae. Furthermore, whole genome analysis of the bla MIR-carrying E. cloacae strain Y546 demonstrated that the strain harbored a large plasmid carrying a variety of gene clusters and genes, such as heavy metal resistance gene clusters (e.g., the pco, ars, ter, and ttr operons), conferring resistance to antimicrobials. Comparative genomics analysis showed that the sequences sharing the highest similarity to pY546 were plasmids from K. pneumoniae strains (44-49% similarity) and the chromosome of E. coli (40-41% similarity) and that the sequence fragments with the highest similarity to heavy metal resistance gene clusters on pY546 were from other plasmids and other chromosome sequences. The colocalization of antibiotic resistance genes and heavy metal resistance genes in the genomes of clinical pathogens, which may facilitate the persistence, coselection, and dissemination of these genes between different bacterial species or genera, is alarming and needs further surveillance.

Acknowledgments

The work was funded by grants from the National Natural Science Foundation of China (31500109, 81501808, and 80215049) and the Science and Technology Foundation of Wenzhou City (Y20170205).

Contributor Information

Cong Cheng, Email: 113246570@qq.com.

Yunliang Hu, Email: hyl@wmu.edu.cn.

Data Availability

The data used to support the findings of this study are included within the article.

Additional Points

Highlights. Twelve β-lactamase genotypes, including bla SHV, bla TEM, bla DHA, bla CTX-M, bla Z, bla VEB, bla KLUC, bla MIR, bla SFO, bla AZECL-29, bla OXA, and bla ACT, were identified in 212 E. cloacae genomes. bla Z was found in E. cloacae for the first time. bla MIR was identified in six E. cloacae strains that were not clonally related. The gene clusters related to resistance to heavy metals (such as copper, arsenic, and tellurite) were identified to be encoded on the pY546 plasmid. The sequences with the highest similarity to pY546 were on plasmids from K. pneumoniae strains and on E. coli chromosomes; in addition, the sequence fragments with the highest similarity to the heavy metal resistance gene clusters on pY546 were from other sources.

Conflicts of Interest

The authors declare that there are no conflicts of interest in this work.

Authors' Contributions

Chongyang Wu and Chaoqin Lin contributed equally to this work.

Supplementary Materials

Supplementary Materials

Table S1: the reference β-lactamase gene sequences collected from GenBank. Table S2: the mapping result of β-lactamase resistance genes in the E. cloacae pooled genomic sequences. Table S3: annotation result of the pY546 genome.

References

  • 1.Mezzatesta M. L., Gona F., Stefani S. Enterobacter cloacae complex: clinical impact and emerging antibiotic resistance. Future Microbiology. 2012;7(7):887–902. doi: 10.2217/fmb.12.61. [DOI] [PubMed] [Google Scholar]
  • 2.Petrosillo N., Vranić-Ladavac M., Feudi C., et al. Spread of Enterobacter cloacae carrying bla NDM-1, bla CTX-M-15, bla SHV-12 and plasmid-mediated quinolone resistance genes in a surgical intensive care unit in Croatia. Journal of Global Antimicrobial Resistance. 2016;4:44–48. doi: 10.1016/j.jgar.2015.09.008. [DOI] [PubMed] [Google Scholar]
  • 3.Wang S., Xiao S.-Z., Gu F.-F., et al. Antimicrobial susceptibility and molecular epidemiology of clinical Enterobacter cloacae bloodstream isolates in Shanghai, China. Plos One. 2017;12(12, article e0189713) doi: 10.1371/journal.pone.0189713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhou K., Yu W., Cao X., et al. Characterization of the population structure, drug resistance mechanisms and plasmids of the community-associated Enterobacter cloacae complex in China. The Journal of Antimicrobial Chemotherapy. 2018;73(1):66–76. doi: 10.1093/jac/dkx361. [DOI] [PubMed] [Google Scholar]
  • 5.Balasubramanian D., Kumari H., Mathee K. Pseudomonas aeruginosa AmpR: an acute–chronic switch regulator. Pathogens and Disease. 2014;73(2):1–14. doi: 10.1111/2049-632x.12208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wales A. D., Davies R. H. Co-selection of resistance to antibiotics, biocides and heavy metals, and its relevance to foodborne pathogens. Antibiotics. 2015;4(4):567–604. doi: 10.3390/antibiotics4040567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Deus D., Krischek C., Pfeifer Y., et al. Comparative analysis of the susceptibility to biocides and heavy metals of extended-spectrum β-lactamase-producing Escherichia coli isolates of human and avian origin, Germany. Diagnostic Microbiology and Infectious Disease. 2017;88(1):88–92. doi: 10.1016/j.diagmicrobio.2017.01.023. [DOI] [PubMed] [Google Scholar]
  • 8.Slipski C. J., Zhanel G. G., Bay D. C. Biocide selective TolC-independent efflux pumps in Enterobacteriaceae. The Journal of Membrane Biology. 2018;251(1):15–33. doi: 10.1007/s00232-017-9992-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhai Y., He Z., Kang Y., et al. Complete nucleotide sequence of pH11, an IncHI2 plasmid conferring multi-antibiotic resistance and multi-heavy metal resistance genes in a clinical Klebsiella pneumoniae isolate. Plasmid. 2016;86:26–31. doi: 10.1016/j.plasmid.2016.04.001. [DOI] [PubMed] [Google Scholar]
  • 10.Argudín M. A., Lauzat B., Kraushaar B., et al. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates. Veterinary Microbiology. 2016;191:88–95. doi: 10.1016/j.vetmic.2016.06.004. [DOI] [PubMed] [Google Scholar]
  • 11.Abbas S. Z., Rafatullah M., Hossain K., Ismail N., Tajarudin H. A., Abdul Khalil H. P. S. A review on mechanism and future perspectives of cadmium-resistant bacteria. International journal of Environmental Science and Technology. 2018;15(1):243–262. doi: 10.1007/s13762-017-1400-5. [DOI] [Google Scholar]
  • 12.Waseem A., Arshad J., Iqbal F., Sajjad A., Mehmood Z., Murtaza G. Pollution status of Pakistan: a retrospective review on heavy metal contamination of water, soil, and vegetables. BioMed Research International. 2014;2014:29. doi: 10.1155/2014/813206.813206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Deng W., Quan Y., Yang S., et al. Antibiotic resistance in Salmonella from retail foods of animal origin and its association with disinfectant and heavy metal resistance. Microbial Drug Resistance. 2018;24(6):782–791. doi: 10.1089/mdr.2017.0127. [DOI] [PubMed] [Google Scholar]
  • 14.Xu T., Ying J., Yao X., et al. Identification and characterization of two novel bla(KLUC) resistance genes through large-scale resistance plasmids sequencing. PLoS One. 2012;7(10, article e47197) doi: 10.1371/journal.pone.0047197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Furlan J. P. R., Stehling E. G. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm. Environmental Monitoring and Assessment. 2018;190(2):p. 76. doi: 10.1007/s10661-017-6453-x. [DOI] [PubMed] [Google Scholar]
  • 16.Haubert L., Kroning I. S., Iglesias M. A., da Silva W. P. First report of the Staphylococcus aureus isolate from subclinical bovine mastitis in the South of Brazil harboring resistance gene dfrG and transposon family Tn916-1545. Microbial Pathogenesis. 2017;113:242–247. doi: 10.1016/j.micpath.2017.10.022. [DOI] [PubMed] [Google Scholar]
  • 17.Lahiri S. D., Johnstone M. R., Ross P. L., McLaughlin R. E., Olivier N. B., Alm R. A. Avibactam and class C β-lactamases: mechanism of inhibition, conservation of the binding pocket, and implications for resistance. Antimicrobial Agents and Chemotherapy. 2014;58(10):5704–5713. doi: 10.1128/aac.03057-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhu L. X., Zhang Z. W., Liang D., et al. Multiplex asymmetric PCR-based oligonucleotide microarray for detection of drug resistance genes containing single mutations in Enterobacteriaceae . Antimicrobial Agents and Chemotherapy. 2007;51(10):3707–3713. doi: 10.1128/aac.01461-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Van Domselaar G. H., Stothard P., Shrivastava S., et al. BASys: a web server for automated bacterial genome annotation. Nucleic Acids Research. 2005;33(Supplement 2):W455–W459. doi: 10.1093/nar/gki593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Katoh K., Standley D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution. 2013;30(4):772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Siguier P., Perochon J., Lestrade L., Mahillon J., Chandler M. ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids Research. 2006;34(90001):D32–D36. doi: 10.1093/nar/gkj014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Remm M., Storm C. E. V., Sonnhammer E. L. L. Automatic clustering of orthologs and in-paralogs from pairwise species comparisons. Journal of Molecular Biology. 2001;314(5):1041–1052. doi: 10.1006/jmbi.2000.5197. [DOI] [PubMed] [Google Scholar]
  • 23.Cock P. J. A., Antao T., Chang J. T., et al. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics. 2009;25(11):1422–1423. doi: 10.1093/bioinformatics/btp163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Roussel S., Felix B., Vingadassalon N., et al. Staphylococcus aureus strains associated with food poisoning outbreaks in France: comparison of different molecular typing methods, including MLVA. Frontiers in Microbiology. 2015;6, article 882 doi: 10.3389/fmicb.2015.00882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tsubouchi T., Kaneko Y. Draft genome sequence of the arsenic-resistant bacterium Brevundimonas denitrificans TAR-002T . Genome Announcements. 2017;5(47) doi: 10.1128/genomeA.01326-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bush K., Jacoby G. A. Updated functional classification of beta-lactamases. Antimicrobial Agents and Chemotherapy. 2010;54(3):969–976. doi: 10.1128/aac.01009-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Liu C., Qin S., Xu H., et al. New Delhi metallo-β-lactamase 1(NDM-1), the dominant carbapenemase detected in carbapenem-resistant Enterobacter cloacae from Henan Province, China. PLoS One. 2015;10(8, article e0135044) doi: 10.1371/journal.pone.0135044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hayakawa K., Miyoshi-Akiyama T., Kirikae T., et al. Molecular and epidemiological characterization of IMP-type metallo-β-lactamase-producing Enterobacter cloacae in a large tertiary care hospital in Japan. Antimicrobial Agents and Chemotherapy. 2014;58(6):3441–3450. doi: 10.1128/aac.02652-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Juhasz E., Janvari L., Toth A., Damjanova I., Nobilis A., Kristof K. Emergence of VIM-4- and SHV-12-producing Enterobacter cloacae in a neonatal intensive care unit. International Journal of Medical Microbiology. 2012;302(6):257–260. doi: 10.1016/j.ijmm.2012.05.003. [DOI] [PubMed] [Google Scholar]
  • 30.Naas T., Cuzon G., Robinson A. L., et al. Neonatal infections with multidrug-resistant ESBL-producing E. cloacae and K. pneumoniae in neonatal units of two different hospitals in Antananarivo, Madagascar. BMC Infectious Diseases. 2016;16(1):p. 275. doi: 10.1186/s12879-016-1580-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jiang X., Ni Y., Jiang Y., et al. Outbreak of infection caused by Enterobacter cloacae producing the novel VEB-3 beta-lactamase in China. Journal of Clinical Microbiology. 2005;43(2):826–831. doi: 10.1128/jcm.43.2.826-831.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Deng H., Si H.-B., Zeng S.-Y., et al. Prevalence of extended-spectrum cephalosporin-resistant Escherichia coli in a farrowing farm: ST1121 clone harboring IncHI2 plasmid contributes to the dissemination of blaCMY-2. Frontiers in Microbiology. 2015;6 doi: 10.3389/fmicb.2015.01210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mohd Khari F. I., Karunakaran R., Rosli R., Tee Tay S. Genotypic and phenotypic detection of AmpC β-lactamases in Enterobacter spp. isolated from a teaching hospital in Malaysia. PLoS One. 2016;11(3, article e0150643) doi: 10.1371/journal.pone.0150643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Papanicolaou G. A., Medeiros A. A., Jacoby G. A. Novel plasmid-mediated beta-lactamase (MIR-1) conferring resistance to oxyimino- and alpha-methoxy beta-lactams in clinical isolates of Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy. 1990;34(11):2200–2209. doi: 10.1128/AAC.34.11.2200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Maeyama Y., Taniguchi Y., Hayashi W., et al. Prevalence of ESBL/AmpC genes and specific clones among the third-generation cephalosporin-resistant Enterobacteriaceae from canine and feline clinical specimens in Japan. Veterinary Microbiology. 2018;216:183–189. doi: 10.1016/j.vetmic.2018.02.020. [DOI] [PubMed] [Google Scholar]
  • 36.Xie Y., Tian L., Li G., et al. Emergence of the third-generation cephalosporin-resistant hypervirulent Klebsiella pneumoniae due to the acquisition of a self-transferable bla DHA-1-carrying plasmid by an ST23 strain. Virulence. 2018;9(1):838–844. doi: 10.1080/21505594.2018.1456229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lawton T. J., Kenney G. E., Hurley J. D., Rosenzweig A. C. The CopC family: structural and bioinformatic insights into a diverse group of periplasmic copper binding proteins. Biochemistry. 2016;55(15):2278–2290. doi: 10.1021/acs.biochem.6b00175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Gilmour M. W., Thomson N. R., Sanders M., Parkhill J., Taylor D. E. The complete nucleotide sequence of the resistance plasmid R478: defining the backbone components of incompatibility group H conjugative plasmids through comparative genomics. Plasmid. 2004;52(3):182–202. doi: 10.1016/j.plasmid.2004.06.006. [DOI] [PubMed] [Google Scholar]
  • 39.Chauhan N. S., Nain S., Sharma R. Identification of arsenic resistance genes from marine sediment metagenome. Indian Journal of Microbiology. 2017;57(3):299–306. doi: 10.1007/s12088-017-0658-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Materials

Table S1: the reference β-lactamase gene sequences collected from GenBank. Table S2: the mapping result of β-lactamase resistance genes in the E. cloacae pooled genomic sequences. Table S3: annotation result of the pY546 genome.

Data Availability Statement

The data used to support the findings of this study are included within the article.


Articles from International Journal of Genomics are provided here courtesy of Wiley

RESOURCES