Generation of an induced pluripotent stem cell line from an individual with a heterozygous RECQL4 mutation

Abstract

The DNA helicase RECQL4 is known for its roles in DNA replication and repair. RECQL4 mutations cause several genetic disorders including Rothmund-Thomson syndrome (RTS), characterized by developmental defects and predisposition to osteosarcoma. Here we reprogrammed fibroblasts with a heterozygous RECQL4 mutation (c.1878 + 32_1878 + 55del24) to induced pluripotent stem cells (iPSCs). These iPSCs are pluripotent and are able to be differentiated into all three germ layers, providing a novel tool to further interrogate the role of RECQL4 DNA helicase in vitro.

Resource Table.
Unique stem cell line identifier	CDMLi002-A
Alternative name(s) of stem cell line	FCP351G
Institution	McGovern Medical School, The University of Texas Health Science Center Houston
Contact information of distributor	Dung-Fang Lee dung-fang.lee@uth.tmc.edu
Type of cell line	iPSCs
Origin	Human
Additional origin info	Age: 24 years Sex: F Ethnicity if known: not Hispanic, White
	Ethnicity if known: not Hispanic, White
Cell source	fibroblast
Clonality	clonal
Method of reprogramming	Sendai virus
Genetic modification	N/A
Type of modification	Germline mutation
Associated disease	Rothmund-Thomson syndrome
Gene/locus	RECQL4 (c.1878 + 32_1878 + 55del24)/ 8q24.3
Method of modification	N/A
Name of transgene or resistance	N/A
Inducible/constitutive system	N/A
Date archived/stock date	3/31/2018
Cell line repository/bank	N/A
Ethical approval	The Molecular Basis of Familial Cancer Predisposition Syndromes (IRB# H-7207) provide by Baylor College of Medicine

Resource utility

We have generated an iPSC line with a heterozygous RECQL4 (c.1878 + 32_1878 + 55del24) mutation. This iPSC line will be useful to study the effects of aberrant RECQL4 protein on genomic stability.

Resource details

RECQL4, one of five human RecQ DNA helicases, is known as a guardian of the genome due to its function in multiple DNA metabolic processes, including DNA replication, recombination and repair (Van Maldergem et al., 2016; Lin et al., 2017). Compound heterozygous or homozygous mutations in the RECQL4 gene are responsible for the majority of cases of Rothmund-Thomson syndrome (RTS), an autosomal recessive disorder characterized by multiple clinical features including a poikilodermatous skin rash, small stature, skeletal dysplasias, and a striking risk for developing osteosarcoma (Van Maldergem et al., 2016; Lin et al., 2017). Here we have reprogrammed fibroblasts from an RTS heterozygous carrier of RECQL4 mutation c.1878 + 32_1878 + 55del24, a 24 base pair deletion in intron 11 of the RECQL4 gene (Fig. 1A). This mutation results in a shortened intron and has been shown to cause aberrant splicing leading to exon skipping (Wang et al., 2002; Colombo et al., 2018). The resource we describe here will be useful in characterizing the role of RECQL4 in DNA damage repair and replication and provides a valuable tool for investigating the pathogenesis of osteosarcoma.

Fig. 1.

Generation and characterization of FCP351G iPSCs. (A) Sanger sequence of RECQL4 Exons 11-12 depicting the deletion found in FCP351 fibroblasts and verified by Sanger sequencing (see chromatogram) in FCP351G iPSCs. (B) Cell morphology (left panel) and alkaline phosphatase staining (right panel) of the FCP351G line. Scale bar, 250 μm (left) and 100 μm (right). (C) PCR detection of exogenous OCT4, SOX2, KLF4 and c-MYC in FCP351G iPSCs. (D) Mycoplasma PCR assay in FCP351G iPSCs.(E) Immunofluorescence staining of pluripotency factor NANOG and hESC surface markers (SSEA4 and TRA-1-81) in the FCP351G line. Scale bar, 75 μm. (F) qRT-PCR assay for the expression of endogenous pluripotency genes (NANOG, SOX2, OCT4, DPPA4, REX1, and TERT) in the FCP351G iPSCs. (G) A representative G-banded karyotype from iPSCs (FCP351G) showing 46, XX. (H) In vivo teratoma assay of the FCP351G iPSCs. Scale bar, 50 μm.

Fibroblasts were isolated from a punch biopsy taken from the arm of an individual with a heterozygous RECQL4 (c.1878 + 32_1878 + 55del24) mutation. Primary fibroblasts were reprogrammed by Yamanaka four factors OCT4, SOX2, KLF4 and MYC using CytoTune-iPS Sendai Reprogramming kit. The emerged iPS clones were picked and cultured for approximately 15 passages. The iPS clone FCP351G exhibits hESC morphology which is evident by cell clusters with a dense, domed center and well-defined borders (Fig. 1B, left panel, Scale bar, 250 μm). PCR detection of exogenous OCT4, SOX2, KLF4 and MYC in FCP351G iPSC line verified loss of Sendai virus and transgenes (Fig. 1C). PCR-based mycoplasma detection assay further validates FCP351G iPSCs are free of mycoplasma (Fig. 1D). The short tandem repeat (STR) profile of FCP351G iPSCs were identical to that of parental FCP351 fibroblasts (data available upon request). Immunofluorescence staining of FCP351G iPSCs demonstrated ubiquitous expression of pluripotency transcription factor NANOG, hESC surface markers SSEA-4 and TRA-1-81 (Fig. 1E, Scale bar, 75 μm) and alkaline phosphatase (Fig. 1B, right panel, Scale bar, 100 μ:m). Examination of pluripotent gene expression by qRT-PCR showed that FCP351G iPSCs express pluripotency gene NANOG, OCT4, SOX2, DPPA4, REX1 and TERT at a level equal to or greater than H1 hESCs, whereas FCP351 fibroblasts do not express these genes (Fig. 1F) Higher SOX2 and TERT mRNAs in FCP351G iPSCs may reult from RECQL4 mutation-induced gene up-regulation. G-band karyotype analysis confirmed the normal karyotype of the FCP351G iPSCs (Fig. 1G). Teratoma assay indicates that FCP351 iPSCs are capable of differentiation to three germ layers including epithelium (endoderm), cartilage (mesoderm), and melanin (ectoderm) (Fig. 1H), confirming their pluripotency. The characterization of the FCP351G iPSC line is summarized in Table 1.

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography	Normal	Fig. 1 panel B
Phenotype	Qualitative analysis immunocytochemistry	Positive staining for NANOG, SSEA and TRA-1-81	Fig. 1 panel E
	Quantitative analysis RT-qPCR	Expression of pluripotency markers equivalent or greater than H1 embryonic stem cells	Fig. 1 panel F
Genotype	Karyotype (G-banding) and resolution	46; XX, Resolution 400	Fig. 1 panel G
Identity	Microsatellite PCR (mPCR) OR	DNA Profiling not performed	N/A
	STR analysis	14 sites tested, all sites match	data available with authors
Mutation analysis (IF APPLICABLE)	Sequencing	Heterozygous	Fig. 1 panel A
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Negative	Fig. 1 panel D
Differentiation potential	Teratoma formation	Differentiation to all three germ layers confirmed by H&E Staining	Fig. 1 panel H
Donor screening (OPTIONAL)	N/A	N/A	N/A
Genotype additional info	N/A	N/A	N/A
(OPTIONAL)	N/A	N/A	N/A

In summary, FCP351G iPSCs are pluripotent and demonstrate a normal karyotype. FCP351G iPSCs provide a valuable cell resource to study RECQL4 function.

Materials and methods

Cell culture

Fibroblasts were cultured in DMEM/F12 (Corning) supplemented with Glutamax (Thermo Fisher) and 10% FBS (GenDEPOT) at 37 °C with 5% CO₂ after thawing until the cells were confluent. Cells were then passaged to six well plates, where they were grown to approximately 90% confluence. Cells were then reprogrammed with OCT4, SOX2, KLF4, and MYC using the CytoTune iPS 2.0 Sendai reprogramming kit (Life Technologies) according to manufacturer's instructions. Clones were picked and seeded in 96-well plates coated with Matrigel (Corning) using hESC medium supplemented with ROCK inhibitor Thiazovivin (Millipore). After one day of culture, the medium was replaced with StemMACS iPS-Brew XF media (Miltenyi Biotech). Following growth, these clones were passaged to a six well plate and cultured in the same manner for approximately 15 passages to ensure the removal of Sendai viruses.

PCR, sequencing, and STR

Genomic DNA was isolated from one 10 cm dish of 80% confluent iPSCs according to protocol using the PureLink DNA Isolation kit (Invitrogen). PCR was performed using primers listed in Table 2 and OneTaq polymerase (New England Biolabs). PCR reaction was performed according to the following protocol: 94 °C for 1 min; 35 cycles of reaction: 94 °C for 30 s, 56 °C for 45 s and 68 °C for 1 min; and 68 °C for 5 min on a Biometra TRIO Thermal Cycler (Analytik Jena). Sanger sequencing was done by Eton Bioscience (San Diego, California). STR DNA fingerprinting was done by the CCSG-funded Characterized Cell Line Core Facility at the University of Texas M.D. Anderson Cancer Center. The STRs at 14 loci (AMEL, CSF1PO, D13S317, D16S539, D18S51, D21S11, D3S1358, D5S818, D7S820, D8S1179, FGA, TH01, TPOX and vWA) were assessed in the FCP351G iPSC line and original FCP351 fibroblast.

Table 2.

Reagents details.

Antibodies used for immunocytochemistry
	Antibody	Dilution	Company Cat # and RRID
Pluripotency Markers	Goat anti-NANOG	1:500	R and D Systems Cat# AF1997 RRID:AB_355097
Pluripotency Markers	anti-SSEA4 PE-conjugated	1:600	R and D Systems FA1435P-025
Pluripotency Markers	Mouse anti-TRA-1-85 Alexa Fluor 555-conjugated	1:600	R and D Systems Cat# FAB3195A RRID:AB_663789
Secondary antibodies	Donkey Anti-Goat IgG (Alexa Fluor488 conjugate)	1:500	Jackson ImmunoResearch Labs Cat# 705–545-003 RRID:AB_2340428

Primers
	Target	Forward/reverse primer(5′-3′)
PCR/Sequencing	RECQL4 Exons 11–12	CAGATTCGGGCAGCCCAGGTAC ACCCACCTGGTCTGTGTCCCTG
Pluripotency Marker (qPCR)	NANOG	TTTGTGGGCCTGAAGAAAACT AGGGCTGTCCTGAATAAGCAG
Pluripotency Marker (qPCR)	OCT4	AACCTGGAGTTTGTGCCAGGGTTT TGAACTTCACCTTCCCTCCAACCA
Pluripotency Marker (qPCR)	SOX2	AGAAGAGGAGAGAGAAAGAAAGGGAGAGA GAGAGAGGCAAACTGGAATCAGGATCAAA
Pluripotency Marker (qPCR)	DPPA4	GACCTCCACAGAGAAGTCGAG TGCCTTTTTCTTAGGGCAGAG
Pluripotency Marker (qPCR)	REX1	GCCTTATGTGATGGCTATGTGT ACCCCTTATGACGCATTCTATGT
Pluripotency Marker (qPCR)	TERT	TGAAAGCCAAGAACGCAGGGATG TGTCGAGTCAGCTTGAGCAGGAATG
Housekeeping Genes (qPCR)	GAPDH	CCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCA
Sendai Virus Removal (RT-PCR)	SeV	GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC
Pluripotency Marker (RT-PCR)	KOS	ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG
Pluripotency Marker (RT-PCR)	KLF4	TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA
Pluripotency Marker (qPCR)	MYC	TAACTGACTAGCAGGCTTGTCG TCCACATACAGTCCTGGATGATGATG

qRT-PCR

RNA was isolated from cells grown to 85% confluency in 6 well culture dish using Trizol (Life Technologies) according to manufacturer's instructions. 4 μg of RNA was used to make cDNA according to the reverse transcriptase protocol using iScript Reverse Transcription Supermix (BioRad). qPCR was then performed using primers described in Table 2 according to the protocol using iQ SYBR Green Supermix (Biorad) on a CFX96 machine (Bio-Rad). The reaction was performed according to the following parameters: 50 °C for 10 min, 95 °C for 5 min, 40 cycle of 95 °C for 10 s and 60 °C for 30 s, and 95 °C for 10 min. Results were calculated using the ΔΔCT method and were normalized to GAPDH expression and are displayed relative to hESC H1.

Mycoplasma testing

Mycoplasma detection was performed using PCR Mycoplasma Detection Kit (Applied Biological Materials Inc) according to the manufacturer's instructions.

Karyotyping

The cultures were harvested and G-banded using standard protocols. Clonal chromosomal changes identified by G-banding were described according to an International System for Human Cytogenetic Nomenclature ISCN (McGowan-Jordan & An, n.d.). Twenty metaphase chromosome spreads at 400 band resolution were analyzed.

Immunofluorescent staining

iPSCs were grown to 70% confluence in 12 well plates, then fixed with 4% paraformaldehyde (Affymatrix) for 10 min. Cells were then washed 2 × 500 μL in wash buffer (PBS with 1% BSA (Fisher Scientific), followed by blocking with PBS with 10% donkey serum (Jackson ImmunoResearch Labs), 1% BSA, 0.3% Triton X-100 (Sigma) for 45 min. Cells were then incubated with primary antibody diluted in dilution buffer (PBS with 1%BSA, 1% donkey serum, 0.3% Triton X-100, and 0.01% sodium azide (Sigma) at 4 °C overnight gently rocking. Cells were then washed twice. Where appropriate, secondary antibody was diluted in dilution buffer, then added to cells and incubated for 1 h at room temperature protected from light. This was followed by 2 more washes, then counterstain with DAPI diluted in dilution buffer. Cells were finally washed 2 times, then stored in PBS for visualization.

Alkaline phosphatase staining

iPSCs were grown to 70% confluence in 12 well plates, then fixed and stained using the Alkaline Phosphatase Staining Kit II (Stemgent) according to manufacturer's instructions.

Teratoma assay

Cells were grown in 10 cm dishes to 80% confluence. Cells were dissociated from the dish, then resuspended in phenol red-free Matrigel (Corning cat#354262). Immunodeficient NOD SCID mice (Charles River Laboratories) were injected subcutaneously with 2 × 10⁷ cells in each flank and observed for palpable teratoma formation. After approximately 6 weeks, teratomas were excised then fixed in 10% formalin (Sigma). Histology was performed by Histowiz (Brooklyn, New York).