Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jan 4.
Published in final edited form as: Insect Biochem Mol Biol. 2017 Nov 8;92:12–20. doi: 10.1016/j.ibmb.2017.11.004

Inhibition of the complement system by saliva of Anopheles (Nyssorhynchus) aquasalis

Antonio Ferreira Mendes-Sousa a,1, Vladimir Fazito Vale a, Daniel Costa Queiroz a, Adalberto Alves Pereira-Filho a, Naylene Carvalho Sales da Silva d, Leonardo Barbosa Koerich a, Luciano Andrade Moreira b, Marcos Horácio Pereira a, Maurício Roberto Sant’Anna a, Ricardo Nascimento Araújo a, John Andersen c, Jesus Gilberto Valenzuela c, Nelder Figueiredo Gontijo a,*
PMCID: PMC6318795  NIHMSID: NIHMS1001909  PMID: 29128668

Abstract

Anopheline mosquitoes are vectors of malaria parasites. Their saliva contains anti-hemostatic and immune-modulator molecules that favor blood feeding and parasite transmission. In this study, we describe the inhibition of the alternative pathway of the complement system (AP) by Anopheles aquasalis salivary gland extracts (SGE). According to our results, the inhibitor present in SGE acts on the initial step of the AP blocking deposition of C3b on the activation surfaces. Properdin, which is a positive regulatory molecule of the AP, binds to SGE. When SGE was treated with an excess of properdin, it was unable to inhibit the AP. Through SDS-PAGE analysis, A. aquasalis presented a salivary protein with the same molecular weight as recombinant complement inhibitors belonging to the SG7 family described in the saliva of other anopheline species. At least some SG7 proteins bind to properdin and are AP inhibitors. Searching for SG7 proteins in the A. aquasalis genome, we retrieved a salivary protein that shared an 85% identity with albicin, which is the salivary alternative pathway inhibitor from A. albimanus. This A. aquasalis sequence was also very similar (81% ID) to the SG7 protein from A. darlingi, which is also an AP inhibitor. Our results suggest that the salivary complement inhibitor from A. aquasalis is an SG7 protein that can inhibit the AP by binding to properdin and abrogating its stabilizing activity. Albicin, which is the SG7 from A. albimanus, can directly inhibit AP convertase. Given the high similarity of SG7 proteins, the SG7 from A. aquasalis may also directly inhibit AP convertase in the absence of properdin.

Keywords: Anopheles aquasalis, Saliva, Complement system, Alternative pathway, Complement system inhibition, Hematophagy

1. Introduction

Anopheline mosquitoes are the natural vectors of Plasmodium parasites, which are the causative agents of human malaria. Transmission occurs when infected female mosquitoes inject the infective forms of the parasite into the vertebrate host along with saliva, which is stored in a pair of trilobed salivary glands located in the interior of the thorax (Amino et al., 2006; Jariyapan and Choochote, 2007; World Health Organization, 2014). During their solenophagic bite, the damage caused by the penetration of the mosquitoes’ mouthparts elicits host homeostatic responses, such as platelet activation, blood clotting, vascular contraction, local inflammation and immune responses. To overcome these responses and complete the blood meal, hematophagous arthropods have a repertoire of pharmacologically active molecules in their saliva, including vasodilator, anti-coagulant, anti-platelet and immune-mediator molecules (Schneider and Higgs, 2009; Fontaine et al., 2011). Complement inhibitors are some of the immune-mediator molecules present in the saliva of several blood-sucking arthropods (Schroeder et al., 2009; Ferreira et al., 2016; Franco et al., 2016; Mendes-Sousa et al., 2016; Silva et al., 2016).

The complement system is an important component of the innate immune defense that is promptly triggered by microorganisms and non-self molecules or particles. In addition to its direct action against pathogens, the complement system is involved with other functions, such as the clearance of immune complexes, removal of necrotic or apoptotic cells, release of inflammatory anaphylatoxins and optimization of antigen presentation for a humoral response (Carroll, 1998). There are three major routes to complement activation, including the classical, the alternative and the lectin pathways. These pathways converge into a single sequence of events that promote opsonization of the targets by specialized proteins (C4b or especially C3b) to facilitate phagocytosis as well as leading to the formation of the membrane attack complex (MAC) on the pathogen surface (Ricklin et al., 2010).

Unlike other complement pathways that depend on pathogen recognition molecules to become activated, the alternative pathway undergoes constant activation. This activation occurs when a small fraction of the C3 component (which is present in all body fluids) exposes a highly reactive thioester group to the medium that combines with water molecules to form C3-H2O. These hydrated molecules undergo conformational modification binding to factor B, which is activated by a specific protease called factor D that releases the portion Ba of the molecule. The soluble C3-H2O-Bb complex acts as a specific protease that is capable of specifically cleaving other C3 molecules. Each activated C3 generates a C3b with its reactive thioester group and the anaphylatoxin fragment C3a. Most of the C3b that is produced will combine with water or self-molecules that are rapidly inactivated by complement control factors. However, if a C3b randomly binds to the surface of a pathogen, it becomes a binding site for factor B. Immediately, the C3b-B that is formed will be converted to C3b-Bb by factor D (a very specific and highly active serine protease). The C3b-Bb complex, which is now linked to the surface of a pathogen, is a protease capable of efficiently activating many C3 molecules that create various C3b-Bb-C3b on the pathogen surface. These complexes are very efficient C3- and C5-convertases when stabilized by factor P, which is also called properdin, and without factor P, the convertase has a considerably shorter half-life. Activation of C5 will culminate with the assembly of the membrane attack complex (Harboe and Mollnes, 2008; Ricklin et al., 2010).

Complement inhibition seems to be essential for blood-sucking arthropods since the occurrence of salivary and intestinal inhibitors is widespread among unrelated species (Ribeiro, 1987; Valenzuela et al., 2000; Couvreur et al., 2008; Barros et al., 2009; Mendes-Sousa et al., 2013, 2016; Ferreira et al., 2016; Franco et al., 2016; Silva et al., 2016). It seems that the main role of complement inhibitors is to protect the insect intestinal cells against complement attack (Barros et al., 2009; Khattab et al., 2015). Considering the presence of complement inhibitors and other immunomodulatory molecules in arthropod’s saliva, multiple pathogens could benefit from their depressant action during transmission by the vectors (Wikel and Allen, 1978; Kamhawi et al., 2000; Rohousova and Volf, 2006; Gomes et al., 2008; Schuijt et al., 2011; Gomes and Oliveira, 2012).

We recently described anti-complement molecules in Anopheles albimanus and A. darlingi saliva, including two proteins belonging to the SG7 family that are capable of inhibiting the alternative pathway (Mendes-Sousa et al., 2016). In the present study, we investigated the inhibition of the complement system by salivary gland extract (SGE) from A. aquasalis, which is a widely distributed malaria vector in the coastal areas of Latin America. The main ac-tivity observed in this study is on the alternative pathway. Here, we present some evidence that the alternative pathway inhibitor from A. aquasalis saliva may be a protein from the SG7 family that is similar to the inhibitors described in A. albimanus and A. darlingi salivary glands (Mendes-Sousa et al., 2016). The salivary activity against the alternative pathway was partially characterized.

2. Methodology

2.1. Ethics statement

This study was conducted according to ethical principles for animal experimentation at the Universidade Federal de Minas Gerais and the procedures were approved by the Ethics Committee in Animal Experimentation at this university (CETEA/UFMG) under protocol number 087/11.

2.2. Mosquito rearing and salivary gland extract (SGE) preparation

The insects were housed in Barripel® cages covered with netting and fed a 10% sugar solution. Females were blood-fed on anesthetized mice. Eggs, larvae and pupae were reared in 1:10 diluted seawater. The insectary conditions were 27 C and 80% humidity. Salivary glands were dissected from 4- to 8-day-old non-blood-fed females and were transferred to microcentrifuge tubes containing PBS and stored on ice (each mosquito has a pair of salivary glands). Before the experiments, glands were sonicated and centrifuged at 10,000 × g for 10 min at 4 °C and the supernatants were used in the assays. SGE protein concentration was measured using the Bradford method (Bradford, 1976).

2.3. Hemolytic assays

Red blood cells and normal human serum (NHS) were prepared as described by Mendes-Sousa et al. (2016). To measure inhibition of the alternative pathway, 25 µl of 1:20 NHS in Mg-EGTA solution (1 mM HEPES, 30 mM NaCl, 10 mM EGTA, 7 mM MgCl2, 3% glucose, 0.02% gelatin, pH 7.4) was mixed with 12.5 µl of PBS containing SGE in 1.5-ml microcentrifuge tubes. Then, 25 µl of rabbit red blood cells suspended in Mg-EGTA solution at 1 × 108 cells/ml was added to the tubes and incubated at 37 °C for 30 min. Two-hundred and fifty microliters of cold PBS was added after incubation, and the tubes were centrifuged at 1700 × g for 30 s. Two hundred microliters of each supernatant was transferred to a microplate (96 wells) and read at 415 nm.

In the total hemolysis control, the serum and SGE were not present and all red blood cells were hemolyzed with the addition of 250 µl of distilled water instead of PBS. In the spontaneous hemolysis control, the added solutions had no serum or SGE (serum and SGE were, respectively, substituted by corresponding volumes of Mg-EDTA without serum and PBS without SGE). Finally, in the positive control, the mixture had serum but no SGE. When present, the serum concentration in the assays was sufficient to promote ~90% of the total hemolysis (usually 1:20 for alternative pathway assays).

For detecting inhibition of the classical pathway, IgG-sensitized sheep red blood cells were used. The assays occurred as described above, with a cell concentration at 2 × 108 cells/ml and NHS diluted 1:60 in GHB2+ solution (5 mM HEPES, 145 mM NaCl, 0.15 mM CaCl2, 0.5 mM MgCl2 and 0.1% gelatin, pH 7.4).

For both pathways, the assays were performed in duplicate with at least three independent repetitions. The absorbance values corresponding to spontaneous hemolysis was subtracted, and the means of each duplicate were calculated for each independent experiment. The final mean of all three experiments was then calculated, and the results were transformed into the percentage of hemolysis with the positive control considered to have 100% of hemolysis (the positive control corresponds to 90% of total hemolysis).

2.4. Detection of bound complement components on an agarose-coated surface

Ninety-six-well microplates (Costar) were covered with 100 µl of aqueous 0.1% agarose solution and dried overnight. Then, 20 µl of NHS diluted 1:5 in HMEBN solution (5 mM HEPES, 7 mM MgCl2, 10 mM EGTA, 5 mg/ml BSA, 140 mM NaCl, pH 7.4) was added to the wells along with 80 ml of HMEBN containing SGE (final volume 100 µl/well). The plate was incubated at 37 °C for 30 min for complement activation. The wells were washed twice with washing buffer (10 mM Tris, 140 mM NaCl and 0.1% BSA) and incubated with 50 µl of anti-C3, anti-factor B or anti-properdin antibodies (CompTech USA) diluted to 1:1,000, 1:500 and 1:1,000, respectively, in a solution containing 10 mM HEPES and 140 mM NaCl (pH 7.4). The plate was incubated at room temperature for 30 min under agitation. After two more washes, 50 µl of anti-goat peroxidase-conjugated IgG (Calbiochem) diluted to 1:1500 in the same buffer was added to the wells, and the plate was incubated for 30 min under agitation. Finally, the wells were filled with 200 µl of developing buffer (50 mM sodium citrate, 50 mM Na2HPO4, 1 mg/ml o-phenylenediamine (Sigma) and 0.075% H2O2 (Synth), pH 5.0), and the plate was read at 450 nm and 37 °C for 10 min in kinetic mode (i.e., two reads per minute). The maximal velocities (rate of absorbance increase) of the reactions were calculated using SoftMax Pro 5.2 software, and the resulting data were used for statistical analysis. The assays were performed in duplicate with at least three independent repetitions. In the negative controls, the wells had no NHS and SGE. In the positive controls, the wells had NHS but no SGE. The results were transformed into the percentage of deposition for each complement component with positive control considered to have 100% deposition.

To investigate if the SGE could dislodge previously bound complement components, agarose-coated wells were incubated at 37 °C with 100 µl of 7% NHS in HMEBN solution for alternative pathway activation. After two washes, 100 µl of HMEBN containing the amount of SGE obtained from 15 glands was added to the wells, and the plates were incubated at 37 °C for 30 min. Wells incubated without SGE were used as positive controls for complement deposition. After two more washes, the wells were treated with anti-C3 or anti-factor B antibodies, and the remainder of the assay occurred as described above.

2.5. Western blots to detect C3 and factor B activation

Alternative pathway-mediated hemolysis assays were performed as described above using the SGE from 15 glands. Tubes incubated without SGE were used as positive controls. After different incubation times at 37 °C, the tubes were centrifuged at 1700 × g for 30 s, and 5 µl of the supernatant was collected and mixed with SDS-PAGE sample buffer. The collected material was then heated in boiling water and run on a 12.5% SDS-PAGE. The proteins in the gel were blotted onto nitrocellulose membranes and blocked overnight with blocking buffer (0.05% Tween 20 and 10% non-fat milk in PBS). After two washes with 0.05% Tween 20 in PBS, the membranes were incubated for 30 min under agitation with anti-factor B or anti-C3a antibodies (CompTech, USA) diluted 1:1000 in PBS-0.05% Tween 20 + 1% BSA. The blots were washed again and then incubated with a secondary antibody conjugated with peroxidase and developed with the Peroxidase Substrate DAB kit (Vector Laboratories) according to the manufacturer’s instructions.

2.6. Binding of complement components to SGE

ELISA plates (Costar) were sensitized overnight with five micrograms of SGE in 50 µl of coating buffer (35 mM Na2CO3, 15 mM NaHCO3, pH 9.6) at 4°C. Wells incubated with 1% BSA were used as negative controls. The wells were blocked for one hour with 200 µl of blocking buffer (PBS + 1% BSA) under agitation and then incubated with 0.2 µg of each purified complement component from the alternative pathway (C3, factor B, factor D and properdin) (CompTech USA) in 50 µl of PBS for 30 min at room temperature. After two washes with 200 µl of washing buffer (PBS + 0.05% Tween 20) for two minutes, the wells were incubated for 30 min with 50 µl of blocking buffer containing a primary antibody specific to each tested component that was diluted 1:5000. After two more washes, the wells were incubated with a secondary antibody diluted 1:3000 in blocking buffer over 30 min. The plate was washed two more times and then developed as described for the deposition assays, and the absorbance was read in a microplate reader at 450 nm after 5 min of incubation at 37 °C. The assays were conducted in duplicate, and the mean absorbance for each complement component was compared to its respective negative control (BSA).

2.7. Hemolytic assay with SGE previously saturated with purified properdin

The same protocol from item 2.3 was used with modifications. Twelve and a half microliters of Mg-EGTA containing 0.5 µg of properdin was mixed with 12.5 µl of PBS containing SGE equivalent to 15 salivary glands. Then, 25 µl of NHS (1:20) and 25 µl of a red blood cell suspension were added to the mixture.

2.8. Comparing A. aquasalis salivary proteins with recombinant SG7 proteins from A. albimanus and A. darlingi

Five micrograms of A. aquasalis SGE and 0.5 µg of A. albimanus and A. darlingi recombinant salivary complement inhibitors were run on a 12.5% SDS-PAGE and silver stained gel. These recombinant proteins belonging to the SG7 family act as alternative pathway inhibitors and were previously expressed and purified according Mendes-Sousa et al. (2016). Recombinant bands were compared to the A. aquasalis SGE band profile in a search for similar salivary proteins.

2.9. Identification and annotation of SG7 genes in the A. aquasalis genome

The A. aquasalis genome was sequenced by Fiocruz-MG, and the scaffold sequences were kindly provided by Dr. Paulo F. P. Pimenta (who is the coordinator of the A. aquasalis genome project). Scaffold databases were built for Standalone BLAST+ (Camacho et al., 2009) searches. Using the A. darlingi SG7 protein (accession number ACI30142.1), we conducted tBLASTn searches for the A. aquasalis genome. CDS and the amino acid sequences of putative A. aquasalis SG7 genes were obtained using GeneWise (Birney and Durbin, 2000). The orthology relationship among anopheline SG7 genes and A. aquasalis putative SG7 genes was determined by phylogenetic analysis using MEGA 7 (Tamura et al., 2011).

2.10. Gene selection, primer design and PCR

The gene sequence of SG7 from A. aquasalis was deposited in GenBank under the accession number KY614520. The primers were designed using Primer3Plus software (http://primer3plus.com/). The primers designed for A. aquasalis SG7 (accession number KY614520) were Aaq_SG7_Fw (TGGCCGCTAGAATGACA) and Aaq_SG7_Rv (TCGTTGAACAGCTCCACCAG). One-day-old female A. aquasalis were dissected to extract their salivary glands and midgut (pools of 20 glands and 10 guts). RNA was extracted using Nucleospin RNA XS (Macherey-Nagel) according to the manufacturer’s instructions. DNAse treatment was performed according to the Nucleospin RNA XS (Macherey-Nagel) manufacturer’s instructions. Total RNA was used for cDNA synthesis with 0.5 µg of random hexamers (Promega) using the M-MLV reverse transcriptase system (Promega) at a final volume of 25 µl. PCRs were performed in 35 cycles (94 °C for 30 s, 60 °C for 30 s and 72 °C for 45 s) with 2 µl of cDNA and 200 nM of each primer, 200 µM of dNTPs and 1 U of Taq polymerase (Ludwig Biotec) at a final volume of 20 µl.

2.11. Statistics

All statistical analyses were performed with GraphPad Prism 5.0 software. In all assays, at least three independent repetitions were performed. The data normality was assessed using the Kolmogorov-Smirnov test. The data were analyzed using a T test (comparison of two groups) or ANOVA and a Tukey test (for multiple comparisons). Significance was determined at p < 0.05 (*).

3. Results

A. aquasalis salivary glands were dissected for SGE preparation. The total protein concentration in the SGE was 1.5 ± 0.1 µg/pair of glands corresponding to one insect. SGE inhibited the alternative pathway-mediated hemolysis in a dose-dependent manner. With amounts of saliva equivalent to 10 and 15 glands, the inhibition by the SGE was close to 80% and 90%, respectively (Fig. 1-A). Interestingly, the classical pathway was only slightly inhibited (less than 40% inhibition) by the highest tested SGE concentration, which was equivalent to 10 glands (p = 0.0495) (Fig. 1-B).

Fig. 1.

Fig. 1.

Open in a new tab

Effects of A. aquasalis SGE on alternative and classical pathway-mediated hemolysis. The SGE was mixed with normal human serum and rabbit red blood cells to assay the alternative pathway or with antibody-sensitized sheep red blood cells to test the classical pathway. Tubes without SGE were used as controls. After incubation, erythrocyte lysis was measured by the absorbance at 415 nm. The absorbance was transformed into the percentage of lysis with the control considered to be 100% hemolysis. The results were expressed as the mean percentage hemolysis + SD. Statistic tests were performed using ANOVA followed by Tukey test. Differences were considered significant when p < 0.05 (*).

Agarose-coated wells were used as an activating surface for the alternative pathway. Once activated, some of the complement components bound to the agarose on the plate and were quantified by antibodies. Using specific antibodies, we detected a significant decrease in the deposition of the components C3b, factor B and properdin in the presence of A. aquasalis SGE, in a dose-dependent manner (Fig. 2-A to C). In the presence of SGE from five glands, there was a significant difference in the deposition of the complement components that were tested (p < 0.05). The SGE was also tested for capacity to dislodge previously bound C3b and factor B, but no difference in the deposition of these components was observed after incubation for 30 min with SGE equivalent to 15 glands (Fig. 2-D), which indicated that the anti-alternative pathway inhibitor found in saliva acts before or during activation of these components. As expected, salivary complement inhibition occurs at the beginning of the alternative pathway before amplification occurs, which increases the efficiency of inhibition.

Fig. 2.

Fig. 2.

Open in a new tab

Effect of A. aquasalis SGE on the deposition of complement components using an agarose-coated plate for the alternative pathway assay. Normal human serum was added to the wells along with SGE and incubated at 37 °C. The deposition of C3b (A), factor B (B) and properdin (C) was evaluated using specific antibodies. To determine if the SGE could unbind previously bound C3b and factor B, the plate was first incubated with only NHS at 37 °C, which was followed by incubation with SGE (D). Wells without SGE were used as controls. The results were transformed into the percentage of deposition, considering the control to have 100% deposition. The results were expressed as the mean percentage of deposition + SD. Statistic tests were performed using ANOVA followed by the Tukey test (A, B and C) and t-test (D). Differences were considered significant when p < 0.05 (*).

The effects of SGE on C3 and factor B activation were also evaluated by Western blot. As observed in Fig. 3, in the presence of SGE, factor B was not activated after 30 min of incubation at 37 °C, and the Bb (a product of factor B activation) band was not detected (Fig. 3-A). The SGE also inhibited C3 activation because the band corresponding to the C3a product was not detected in samples incubated with SGE (Fig. 3-B).

Fig. 3.

Fig. 3.

Open in a new tab

Western blot to detect factor B (A) and C3 (B) activation in the presence of SGE. Alternative pathway-mediated hemolytic assays were performed in the presence of SGE (equivalent to 15 salivary glands) or only PBS as a control. Five microliters was collected just before or 30 min after incubation at 37 °C and submitted to SDS-PAGE. The proteins were transferred to nitrocellulose membranes, and after washing and blocking the membranes, they were treated with polyclonal anti-factor B or anti-C3a antibodies. In the presence of A. aquasalis SGE, there is no factor B activation to Bb (A) or C3a production (B), and the results were ultimately compared to the control without SGE.

ELISA assays were performed to detect binding of complement components to the SGE previously bound to the plate. Using specific antibodies, a strong binding of properdin to the immobilized SGE was significantly different (p < 0.0004) compared to the control (BSA) (Fig. 4-A). Although factors C3 and B were bound to saliva (p = 0.003 and 0.0002, respectively), this binding was considerably lower than properdin binding. Because properdin is capable of interacting with SGE bound to ELISA plates, we investigated if SGE previously saturated with properdin retains its inhibitory properties. It is possible that the salivary inhibitor of the alternative pathway is a target recognized by properdin on the plate. SGE mixed with an excess amount of properdin did not inhibit the alternative pathway in hemolytic assays (Fig. 4-B), which meant that the salivary alternative pathway inhibitor was inactive when bound to properdin.

Fig. 4.

Fig. 4.

Open in a new tab

The role of properdin in the inhibition of the alternative pathway by A. aquasalis SGE. (A) ELISA plates were sensitized with 5 µg of A. aquasalis SGE or 1% BSA, as negative controls. The wells were then incubated with purified complement components (with 0.2 µg from each component) for 30 min. Interaction of complement components to SGE was investigated by subsequent incubation with specific antibodies. Properdin presented the strongest bind to the SGE (p < 0.001). The results were expressed as the mean of absorbance þ SD from three independent experiments. (B) Hemolytic assays were performed in excess of properdin. Previously, 12.5 µl of Mg-EGTA solution containing 0.5 µg of purified properdin was mixed with 12.5 µl of PBS containing SGE. Then, 25 µl NHS and 25 µl red blood cell suspension were added to the mixture and incubated at 37 °C. At high properdin concentration, SGE presented no inhibitory activity. The results were expressed as the mean percentage hemolysis + SD. Statistical tests were performed using ANOVA followed by a Tukey test. Differences were considered significant when p < 0.05 (*).

SGE from A. aquasalis was run on an SDS-PAGE gel alongside recombinant proteins from A. albimanus and A. darlingi (data not shown). These salivary proteins from the SG7 family were recently recognized as alternative pathway inhibitors (Mendes-Sousa et al., 2016). In lanes with the recombinant proteins, only one band of approximately 13 kDa was detected. In the A. aquasalis SGE sample, eight major bands were observed, including an intense band with a molecular weight similar to recombinant proteins. Despite the molecular weight coincidence, the band observed in SDS-PAGE and appearing approximately at the same relative position as recombinant albicin may include more than one salivary protein.

The SG7 proteins are exclusive to mosquitoes from the Anophelinae subfamily (Lanfrancotti et al., 2002; Arcà et al. 2005; Mendes-Sousa et al., 2016; Arca et al. 2017). Searching for SG7 proteins in the A. aquasalis genome, we retrieved a sequence similar to sequences from A. albimanus and A. darlingi. This SG7 gene (Accession Number KY614520) is transcribed in the salivary glands but not in the midgut, which was confirmed by PCR using specific primers (data not shown). This SG7 salivary protein from A. aquasalis shares 85% identity with the SG7 salivary protein from A. albimanus (also called albicin) and 81% identity with A. darling SG7 (Fig. 5). Phylogenetic analyses (Fig. 5) strongly suggest that A. aquasalis SG7 is orthologous to SG7 genes from A. albimanus, A. darlingi, I, A. funestus and A. sinensis. We also found a second copy of A. aquasalis SG7, which is named SG7–2 (Fig. 5).

Fig. 5.

Fig. 5.

Open in a new tab

Evolutionary relationships and conservation of anopheline SG7 proteins. The evolutionary history of SG7 proteins from different Anopheles species was inferred using the Neighbor-Joining method (Panel A). The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. The blue box highlights related genes from SG7 family, while the clear orange box highlights the paralogous SG7–2 gene family. Conserved sites among SG7 genes of Anopheles aquasalis, A. albimanus and A. darlingi are shown in panel B. Evolutionary analyses were conducted in MEGA7. Sequence accession numbers are shown on the phylogenetic tree (panel A). Aaqu Anopheles aquasalis, Aalb A. albimanus, Adar A. darlingi, Agam A. gambiae, Afun A. funestus, Aste A. stephensi, Asin Anopheles sinensis, and Cqui Culex quin-quefasciatus. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

4. Discussion

Anopheles (Nyssorhynchus) aquasalis is an important malaria vector found in coastal areas of Latin America (Póvoa et al., 2003) and is actually one of the few South American anopheline species maintained in stable laboratory colonies (Silva et al., 2006). These colonies have allowed researchers to use this mosquito species in experiments designed to study insecticide resistance (Molina and Figueroa, 2009), midgut physiology (Dias-lopes et al., 2015) and the immune response against Plasmodium vivax (Bahia et al., 2011). However, despite its importance, no work has focused on salivary molecules with pharmacological activity.

Hematophagous insects have complement inhibitors in their saliva or midgut (Barros et al., 2009; Schroeder et al., 2009; Ooi et al., 2015) because the components of the complement system is present in the ingested blood and can be activated inside the midgut (Simon et al., 2013; Khattab et al., 2015), which causes damage to enterocytes (Barros et al., 2009; Khattab et al., 2015).

In this study, we demonstrate anti-complement activity in A. aquasalis salivary gland extracts (SGE) for the first time. The alternative pathway-mediated hemolysis was significantly inhibited in the presence of A. aquasalis SGE (Fig. 1-A). The inhibition was confirmed by deposition assays (Fig. 2-A-C) and Western blots (Fig. 3-A, B) in which the deposition and/or cleavage of the components C3, factor B and properdin were significantly decreased in the presence of the SGE, which indicates the inhibitor acts in the early steps of the alternative pathway cascade. This pathway presents great relevance for the complement system activity because it is independent of activating molecules (such as antibody/C1q and MBL, which are required for classical and lectin pathways, respectively) and is constantly activated at low levels in blood circulation (Dunkelberger and Song, 2010). In addition, it is known that the alternative pathway converges with the classical pathway because the C3b generated by the classical pathway can form C3 and C5 convertases of the alternative pathway activating more C3 and C5 molecules that bind to the non-self activating surface (Harboe et al., 2004).

The anti-alternative pathway activity measured with A. aquasalis SGE was lower than the activity observed in SGE from A. albimanus. On the other hand, this level of activity was similar to the activity observed with SGE collected from A. freeborni (Mendes-Sousa et al., 2016). These differences in activity could be explained by assuming that the inhibitors of A. aquasalis and A. freeborni could be more efficient against the complement systems of other host species. In fact, Mendes-Sousa et al., (2013) have already shown in their experiments that the efficiency of inhibitors from L. longipalpis varies according to the species the serum was collected from.

The lytic activity of the classical pathway was only significantly inhibited by the highest A. aquasalis SGE concentration (which contained SGE equivalent to 10 glands) (Fig. 1-B). Considering that the serum concentration that was used (1:60) was lower in the classical pathway assays compared to the amount used for the alternative pathway (1:20), it is reasonable to conclude that A. aquasalis SGE is practically ineffective against the human classical pathway. Because A. aquasalis can feed on hosts other than humans, it is a reasonable hypothesis that a putative inhibitor of the classical pathway, which is ineffective against the human complement system, may be present, and such an inhibitor would be effective against the classical pathways from hosts other than humans. Curiously, in A. albimanus, no trace of activity against the human classical pathway was observed (Mendes-Sousa et al., 2016).

In addition to salivary inhibitors, other molecules with complement inhibitory activity have been described in the midgut of hematophagous arthropods (Barros et al., 2009; Mendes-Sousa et al., 2013; Ooi et al., 2015). Because intestinal complement inhibitors have been described in other arthropods, it is possible that intestinal inhibitors are present in A. aquasalis to complete the effects of salivary inhibitors, ensuring gut protection.

To investigate the possible mechanism of inhibition, we performed deposition assays to determine if the A. aquasalis SGE could dislodge complement components from activating surfaces in a manner similar to complement inhibitor factor H and tick complement inhibitors. Some previously described salivary inhibitors from ticks can unbind factor Bb from C3b (Ferreira et al., 2010; Tyson et al., 2007; Valenzuela et al., 2000). As observed in Fig. 2-D, the SGE from A. aquasalis was not able to remove factor Bb from C3b bound to agarose-coated wells, indicating that it does not act similar to the inhibitors mentioned above.

Through an ELISA-like assay, we detected direct binding of properdin to the A. aquasalis SGE (Fig. 4-A). Properdin is a positive regulator of the alternative pathway and is responsible for the stabilization of the C3-convertase (C3b-Bb-P) by enhancing its half-life around tenfold and permitting much more effective activation of C3 molecules (Fearon and Austen, 1975). It is known that anti-properdin IgG are capable of blocking alternative pathway activation (Pauly et al., 2014). Presumably, during hematophagy, the salivary inhibitor binds to properdin molecules to prevent them from binding to and stabilizes the convertases. Without this stabilization, the function of the convertase would be compromised. In fact, some complement inhibitors act by binding to properdin to prevent it from binding to the C3 convertase and impairing the stabilization of the C3-convertase from the alternative pathway, which rapidly dissociates and disrupts the natural flow of the activating cascade. Complement inhibitor molecules from tick saliva and the scabies mite midgut inhibit this pathway by binding to properdin (Bergström et al., 2009; Couvreur et al., 2008; Tyson et al., 2008). In Fig. 4-B, an excess of properdin prevented the A. aquasalis’ inhibitor from acting on the alternative pathway. It is important to note that in this reaction mixture, many properdin molecules remain unbound to the inhibitor molecules and are consequently able to stabilize the alternative pathway convertase. Thus, sequestration of properdin by the A. aquasalis inhibitor seems to be a possible mechanism for complement inhibition.

We recently studied the anti-complement activity of A. albimanus SGE (Mendes-Sousa et al., 2016). The inhibitor of the alternative pathway, which is called albicin, was purified and identified as belonging to the SG7 family of proteins, which are present in anopheline salivary glands, including the glands of A. darlingi (Calvo et al., 2009). The SG7 proteins from new world anophelines present molecular weights of approximately 13.4 kDa and inhibit the alternative pathway by binding directly to the C3-convertases of the alternative pathway, which directly inhibits their convertase activity (Mendes-Sousa et al., 2016). Curiously, albicin also strongly binds to properdin (Mendes-Sousa et al., 2016), but we do not know if the albicin-properdin complex is unable to stabilize C3 convertases from the alternative pathway as occurs with the inhibitor collected from A. aquasalis.

Similar to the observations with albicin from A. albimanus, the alternative pathway inhibitor from A. aquasalis may also inhibit the complement system by acting directly on the alternative pathway convertases. Unfortunately, a recombinant inhibitor is not yet available to permit more detailed experiments in properdin free assays. If a direct inhibition of convertases is possible, the A. aquasalis alternative pathway inhibitor has a dual mechanism of inhibition: whereas some inhibitor molecules inactivate the stabilizing effects of properdin, others could bind directly to the convertases inhibiting them.

In SDS PAGE-analysis, the A. aquasalis SGE presented an intense band with a similar molecular weight of the recombinant SG7 proteins. Searching for proteins from the SG7 family in an A. aquasalis genomic databank (unpublished), we retrieved one sequence very similar to the SG7 inhibitors from New World anophelines. This protein presented 85% identity with albicin (the SG7 protein from A. albimanus) and 81% identity with the SG7 from A. darlingi. Interestingly, the phylogenetic tree shows a clear dichotomy between SG7 genes from new world and old world anophelines (Fig. 5). New World SG7 proteins present anti-complement activity, whereas Old World anopheline SG7 molecules show no activity against the complement (Mendes-Sousa et al., 2016).

Anophensin, an SG7 family protein from A. stephensi (an Old World anopheline), has a different pharmacological activity. According to Isawa et al. (2007), it was able to inhibit the kallikrein-kinin system, which prevented the formation of bradykinin, a peptide responsible for the stimulation of local inflammatory reactions. In addition, it can act as an anti-clothing protein. Anophensin shares 41.5% identity with the A. aquasalis SG7 complement inhibitor and 56.5% identity with the A. gambiae SG7. Given the similarity observed between Anophensin and other SG7 proteins from Old Word anophelines (Fig. 5), we could speculate that SG7 proteins from Old World anophelines may inhibit the kallikrein-kinin system as Anophensin does.

We also found a second copy of A. aquasalis SG7 (Fig. 5). The phylogenetic analysis suggests that this copy is an ancestral paralogous gene named SG7–2, which can be found in A. albimanus, A. funestus and A. stephensi (Mendes-Sousa et al., 2016). In A. albimanus and A. darlingi, the SG7–2 protein was unable to inhibit the alternative pathway of the complement (Mendes-Sousa et al., 2016).

Altogether, our results suggest that the salivary complement inhibitor from A. aquasalis is an SG7 protein that may inhibit the alternative pathway by binding to C3-convertase, similar to albicin, and/or by complexing with properdin to abrogate its stabilizing activity. A recombinant protein from A. aquasalis saliva would allow us to investigate the alternative pathway inhibition mechanism in more detail.

Acknowledgments

This work was supported by a grant from the Brazilian research agencies FAPEMIG (Fundação de Amparo à Pesquisa do Estado de Minas Gerais), INCT Entomologia Molecular - CNPq and CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior).

References

  1. Amino R, Thiberge S, Martin B, Celli S, Shorte S, Frischknecht F, Ménard R, 2006. Quantitative imaging of Plasmodium transmission from mosquito to mammal. Nat. Med 12, 220–224. [DOI] [PubMed] [Google Scholar]
  2. Arcà B, Lombardo F, Valenzuela JG, Francischetti IMB, Marinotti O, Coluzzi M, Ribeiro JMC, 2005. An updated catalogue of salivary gland tran-scripts in the adult female mosquito, Anopheles gambiae. J. Exp. Biol 208, 3971–3986. [DOI] [PubMed] [Google Scholar]
  3. Arcà B, Lombardo F, Struchiner FC, Ribeiro José M.C., 2017. Anopheline salivary protein genes and gene families: an evolutionary overview after the whole genome sequence of sixteen Anopheles species. BMC Genomics 18, 153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bahia AC, Kubota MS, Tempone AJ, Araújo HRC, Guedes BAM, Orfanó AS, Tadei WP, Ríos-Velásquez CM, Han YS, Secundino NFC, Barillas-Mury C, Pimenta PFP, Traub-Csekö YM, 2011. The JAK-STAT pathway controls Plasmodium vivax load in early stages of Anopheles aquasalis infection. PLoS Negl. Trop. Dis 5, e1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barros VC, Assumpção JG, Cadete AM, Santos VC, Cavalcante RR, Araújo RN, Pereira MH, Gontijo NF, 2009. The role of salivary and intestinal complement system inhibitors in the midgut protection of triatomines and mosquitoes. PLoS One 4, e6047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bergström FC, Reynolds S, Johnstone M, Pike RN, Buckle AM, Kemp DJ, Fischer K, Blom AM, 2009. Scabies mite inactivated serine protease paralogs inhibit the human complement system. J. Immunol 182, 7809–7817. [DOI] [PubMed] [Google Scholar]
  7. Birney E, Durbin R, 2000. Using GeneWise in the Drosophila annotation experiment. Genome Res 10, 547–548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bradford MM, 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem 72, 248–254. [DOI] [PubMed] [Google Scholar]
  9. Calvo E, Pham VM, Marinotti O, Andersen JF, Ribeiro JMC, 2009. The salivary gland transcriptome of the neotropical malaria vector Anopheles darlingi reveals accelerated evolution of genes relevant to hematophagy. BMC Genomics 10, 57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL, 2009. BLAST+: architecture and applications. BMC Bioinforma 10, 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Carroll MC, 1998. The role of complement and complement receptors in induction and regulation of immunity. Annu. Rev. Immunol 16, 545–568. [DOI] [PubMed] [Google Scholar]
  12. Couvreur B, Beaufays J, Charon C, Lahaye K, Gensale F, Denis V, Charloteaux B, Decrem Y, Prévôt P-P, Brossard M, Vanhamme L, Godfroid E, 2008. Variability and action mechanism of a family of anti-complement proteins in Ixodes ricinus. PLoS One 3, e1400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dias-lopes G, Borges-veloso A, Saboia-Vahia L, Domont GB, Britto C, Cuervo P, De Jesus JB, 2015. Expression of active trypsin-like serine peptidases in the midgut of sugar-feeding female Anopheles aquasalis. Parasit. Vectors 8, 296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dunkelberger JR, Song W, 2010. Complement and its role in innate and adaptive immune responses. Cell Res 20, 34–50. [DOI] [PubMed] [Google Scholar]
  15. Fearon DT, Austen KF, 1975. Properdin: binding to C3b and stabilization of the C3b-dependent C3 convertase. J. Exp. Med 142, 856–863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ferreira VP, Pangburn MK, Cortés C, 2010. Complement control protein factor H: the good, the bad, and the inadequate. Mol. Immunol 47, 2187–2197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ferreira VP, Vale VF, Pangburn MK, Abdeladhim M, Mendes-sousa AF, Cou-tinho-abreu IV, Rasouli M, Brandt EA, Meneses C, Lima KF, Nascimento R, Pereira MH, Kotsyfakis M, Oliveira F, Kamhawi S, Ribeiro JMC, Gontijo NF, Collin N, Valenzuela JG, 2016. SALO, a novel classical pathway complement inhibitor from saliva of the sand fly Lutzomyia longipalpis. Sci. Rep 1–13. [DOI] [PMC free article] [PubMed]
  18. Fontaine A, Diouf I, Bakkali N, Missé D, Pagès F, Fusai T, Rogier C, Almeras L, 2011. Implication of haematophagous arthropod salivary proteins in host-vector interactions. Parasit. Vectors 4, 187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Franco PF, Silva NCS, Fazito do Vale V, Abreu JF, Santos VC, Gontijo NF, Valenzuela JG, Pereira MH, Sant’Anna MRV, Gomes APS, Araujo RN, 2016. Inhibition of the classical pathway of the complement system by saliva of Amblyomma cajennense (Acari: Ixodidae). Exp. Parasitol 164, 91–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gomes R, Oliveira F, 2012. The immune response to sand fly salivary proteins and its influence on Leishmania immunity. Front. Immunol 3, 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gomes R, Teixeira C, Teixeira MJ, Oliveira F, Menezes MJ, Silva C, de Oliveira CI, Miranda JC, Elnaiem D-E, Kamhawi S, Valenzuela JG, Brodskyn CI, 2008. Immunity to a salivary protein of a sand fly vector protects against the fatal outcome of visceral leishmaniasis in a hamster model. Proc. Natl. Acad. Sci. U. S. A 105, 7845–7850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Harboe M, Mollnes TE, 2008. The alternative complement pathway revisited. J. Cell. Mol. Med 12, 1074–1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Harboe M, Ulvund G, Vien L, Fung M, Mollnes TE, 2004. The quantitative role of alternative pathway amplification in classical pathway induced terminal complement activation. Clin. Exp. Immunol 138, 439–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Isawa H, Orito Y, Iwanaga S, Jingushi N, Morita A, Chinzei Y, Yuda M, 2007. Identification and characterization of a new kallikrein-kinin system inhibitor from the salivary glands of the malaria vec. Insect biochem. Mol. Biol 37, 466–477. [DOI] [PubMed] [Google Scholar]
  25. Jariyapan N, Choochote W, 2007. Salivary gland proteins of the human malaria vector, Anopheles dirus B (Diptera: Culicidae). Rev. Inst. Med. Trop. Sao Paulo 49, 5–10. [DOI] [PubMed] [Google Scholar]
  26. Kamhawi S, Belkaid Y, Modi G, Rowton E, Sacks D, Kamhawi S, Belkaid Y, Modi G, Rowton E, Sacksl D, 2000. Protection against Cutaneous Leish-maniasis Resulting from Bites of Uninfected Sand Flies, vol. 290 American Association for the Advancement of Science Stable, pp. 1351–1354. http://www.jstor.org/stable/3078245. Protection Against Cutaneous Leishmaniasis Resulti [DOI] [PubMed] [Google Scholar]
  27. Khattab A, Barroso M, Miettinen T, Meri S, 2015. Anopheles midgut epithelium evades human complement activity by capturing factor H from the blood meal. PLoS Negl. Trop. Dis 9, e0003513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lanfrancotti A, Lombardo F, Santolamazza F, Veneri M, Castrignano T, Coluzzi M, et al. , 2002. Novel cDNAs encoding salivary proteins from the malaria vector Anopheles gambiae. FEBS Lett 517, 67–71. [DOI] [PubMed] [Google Scholar]
  29. Mendes-Sousa AF, Nascimento AAS, Queiroz DC, Vale VF, Fujiwara RT, Araújo RN, Pereira MH, Gontijo NF, 2013. Different host complement sys-tems and their interactions with saliva from Lutzomyia longipalpis (Diptera, Psychodidae) and Leishmania infantum promastigotes. PLoS One 8, e79787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mendes-Sousa AF, Queiroz DC, Vale VF, Gontijo NF, Andersen JF, 2016. An inhibitor of the alternative pathway of complement in saliva of new world anopheline mosquitoes. J. Immunol 197 (2), 599–610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Molina D, Figueroa LE, 2009. Metabolic resistance to organophosphate in-secticides in Anopheles aquasalis curry 1932, libertador municipality, Sucre state, Venezuela. Biomedica 29, 604–615. [PubMed] [Google Scholar]
  32. Ooi C-P, Haines LR, Southern DM, Lehane MJ, Acosta-Serrano A, 2015. Tsetse GmmSRPN10 has anti-complement activity and is important for successful establishment of trypanosome Infections in the fly midgut. PLoS Negl. Trop. Dis 9, e3448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Pauly D, Nagel BM, Reinders J, Killian T, Wulf M, Ackermann S, Ehrenstein B, Zipfel PF, Skerka C, Weber BHF, 2014. A novel antibody against human properdin inhibits the alternative complement system and specifically detects properdin from blood samples. PLoS One 9, e96371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Póvoa MM, Conn JE, Schlichting CD, Amaral JCOF, Segura MNO, Da Silva ANM, Dos Santos CCB, Lacerda RNL, De Souza RTL, Galiza D, Santa Rosa EP, Wirtz RA, 2003. Malaria vectors, epidemiology, and the re-emergence of Anopheles darlingi in Belém, Pará, Brazil. J. Med. Entomol 40, 379–386. 10.1603/0022-2585-40.4.379. [DOI] [PubMed] [Google Scholar]
  35. Ribeiro JM, 1987. Lxodes dammini: salivary anti-complement activity. Exp. Parasitol 353, 347–353. [DOI] [PubMed] [Google Scholar]
  36. Ricklin D, Hajishengallis G, Yang K, Lambris JD, 2010. Complement: a key system for immune surveillance and homeostasis. Nat. Immunol 11, 785–797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rohousová I, Volf P, 2006. Sand fly saliva: effects on host immune response and Leishmania transmission. Folia Parasitol. (Praha) 53, 161–171. [PubMed] [Google Scholar]
  38. Schneider B, Higgs S, 2009. The enhancement of arbovirus transmission and disease by mosquito saliva is associated with modulation of the host immune response. Trans. R. Soc. Trop. Med. Hyg 102, 400–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schroeder H, Skelly PJ, Zipfel PF, Losson B, Vanderplasschen A, 2009. Sub-version of complement by hematophagous parasites. Dev. Comp. Immunol 33, 5–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schuijt TJ, Coumou J, Narasimhan S, Dai J, Deponte K, Wouters D, Brouwer M, Oei A, Roelofs JJTH, van Dam AP, van der Poll T, Van’t Veer C, Hovius JW, Fikrig E, 2011. A tick mannose-binding lectin inhibitor interferes with the vertebrate complement cascade to enhance transmission of the lyme disease agent. Cell Host Microbe 10, 136–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Silva AN, Dos Santos CC, Lacerda RN, Santa Rosa EP, De Souza RT, Galiza D, Sucupira I, Conn JE, Póvoa MM, 2006. Laboratory colonization of Anopheles aquasalis (Diptera: Culicidae) in Belém, Pará, Brazil. J. Med. Entomol 43, 107–109. [PubMed] [Google Scholar]
  42. Silva NCS, Vale VF, Franco PF, Gontijo NF, Valenzuela JG, Pereira MH, Sant ‘anna MRV, Rodrigues DS, Lima WS, Fux B, Araujo RN, 2016. Saliva of Rhipicephalus (Boophilus) microplus (Acari: Ixodidae) inhibits classical and alternative complement pathways. Parasit. Vectors 9, 445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Simon N, Lasonder E, Scheuermayer M, Kuehn A, Tews S, Fischer R, Zipfel PF, Skerka C, Pradel G, 2013. Malaria parasites co-opt human factor h to prevent complement-mediated lysis in the mosquito midgut. Cell Host Microbe 13, 29–41. [DOI] [PubMed] [Google Scholar]
  44. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S, 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol 28, 2731–2739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tyson K, Elkins C, Patterson H, Fikrig E, de Silva A, 2007. Biochemical and functional characterization of Salp20, an Ixodes scapularis tick salivary protein that inhibits the complement pathway. Insect Mol. Biol 16, 469–479. [DOI] [PubMed] [Google Scholar]
  46. Tyson KR, Elkins C, de Silva a. M., 2008. A novel mechanism of complement inhibition unmasked by a tick salivary protein that binds to properdin. J. Immunol 180, 3964–3968. [DOI] [PubMed] [Google Scholar]
  47. Valenzuela JG, Charlab R, Mather TN, Ribeiro JM, 2000. Purification, cloning, and expression of a novel salivary anticomplement protein from the tick, Ixodes scapularis. J. Biol. Chem 275, 18717–18723. [DOI] [PubMed] [Google Scholar]
  48. Wikel SK, Allen JR, 1978. Acquired resistance to ticks. III. Cobra venom factor and the resistance response. Immunology 32, 457–465. [PMC free article] [PubMed] [Google Scholar]
  49. World Health Organization, 2014. World Malaria Report 2014 10.1007/s00108-013-3390-9. [DOI]

RESOURCES