Abstract
The entomopathogenic fungus Cordyceps militaris is a valuable medicinal ascomycete, which degenerates frequently during subsequent culture. To avoid economic losses during industrialized production, scratching stimuli of mycelia was introduced to improve the fruiting body production. The present results indicated that higher yields and biological efficiency were obtained from two degenerate strains (YN1-14 and YN2-7) but not from g38 (an insertional mutant in Rhf1 gene with higher yields and shorter growth periods). Furthermore, the growth periods of the fruiting bodies were at least 5 days earlier when the mycelia were scratched before stromata differentiation. Three ROS-scavenging genes including Cu/Zn superoxide dismutase (CmSod1), Glutathione peroxidase (CmGpx), and Catalase A (CmCat A) were isolated and their expression profiles against scratching were determined in degenerate strain YN1-14 and mutant strain g38. At day 5 after scratching, the expression level of CmGpx significantly decreased for strain g38, but that of CmSod1 significantly increased for YN1-14. These results indicated that scratching is an effective way to promote fruiting body production of degenerate strain, which may be related at least with Rhf1 and active oxygen scavenging genes.
KEYWORDS: Cordyceps militaris, degenerated strain, scratching, antioxidant enzyme, gene expression
Introduction
Cordyceps militaris (Cordycipitaceae, Hypocreales, Sordariomycetes, and Ascomycota) is a valuable edible and medicinal fungus [1]. The medicinal properties and pharmacological effects include antitumor [2], anti-influenza virus [3], and immunomodulation [4], which are similar to another traditional medicinal fungus, Ophiocordyceps sinensis [5]. Because of the decreasing natural populations of O. sinensis and high price in the market [6], and the success of C. militaris stromata cultivation in artificial media [7–8], C. militaris is widely used as a good substitute for O. sinensis for health supplements [9].
In artificial cultivation of C. militaris, four growth stages including mycelia culture, pigment induction, stromata stimulation, and fruiting body production are usually identified [7]. Strain, medium components, culture parameters (temperature, humidity, light, and oxygen etc.), and mating behavior influence the industrialized production of C. militarlis and optimization of culture conditions is required for each strain [10–12].
Like many other filamentous fungi, C. militaris frequently degenerates during mass production by the loss or reduction of mycelia growth, pigmentation, stromata differentiation, or fruiting body formation [13]. It is found that degeneration usually accompanies with reduced dehydrogenase activity and increased cellular accumulation of reactive oxygen species (ROS) [14,15]. The accumulation of ROS will attack many kinds of organic macromolecules and cause variety of injuries. Antioxidant enzymes can remove ROS and maintain the dynamic balance of O2− to defense against ROS [16]. Thus, reduction of the fungal cellular ROS levels could probably improve the characteristics of the degenerate strains.
Mycelia stimulus by scratching technique is one of the regular agronomic techniques to improve the cultivation yields in Agaricus bisporus and Pleurotus eryngii [17,18], but in Flammulina velutipes, this technique shows no significantly positive effect on the yield and the harvest time [19]. In Cordyceps, the effects of the scratching technique on mycelial growth, color induction, or fruiting body formation were variable [20] and even negative effects of this technique on fruiting body production were recorded [21].
To explore whether the scratching technique can induce a higher yield of fruiting bodies, and whether this induction is correlated to ROS-scavenging system in C. militaris, four strains (two degenerate strains YN1-14 and YN2-7, one normal strain YN2-11, and one insertional mutant g38 in Rhf1 gene) were used to evaluate the effects of scratching technique on the growth potentials, and the expression profiles of three antioxidant genes including Cu/Zn superoxide dismutase (CmSod1), glutathione peroxidase (CmGpx), and catalase A (CmCat A) were analyzed by using quantitative real-time PCR (qRT-PCR).
2. Materials and methods
2.1. Fungal strains
Four C. militaris strains were used in this study. Two degenerate strains YN1-14 and YN2-7 were characterized by fluffy mycelia and reduced ability of stromata formation. Strain YN2-11 was a strain with normal fruiting body production, whereas strain g38 was an insertional mutant in Rhf1 gene with faster stromata development and higher yields [22]. All the strains were preserved in Guangdong Institute of Applied Biological Resources, Guangzhou, China.
2.2. Fungal culture conditions
The culture conditions for mycelia in solid PPDA medium (200 g potato, 20 g glucose, 10 g tryptone, 1.5 g KH2PO4, 0.5 g MgSO4, 20 mg vitamin B1, 15 g agar powder, and distilled water to 1000 mL) and liguid PPDA medium (without agar powder) and for fruiting body production in rice medium were described previously [7]. All the test strains were cultured on solid PPDA at 23 °C for 7 days. Then, the mycelia from PPDA were transferred to 250 mL flasks containing 100 mL liquid PPDA medium. The flasks were then incubated at 23 °C on a 150-rpm shaker for 8 days and the resulting mycelia culture was used as a liquid inoculum. For fruiting body production, the liquid inoculum was diluted with three volumes of sterile water, and 15 mL was added into each 300 mL glass bottle containing with 20 g pearl rice, 0.5 g powder of silkworm pupae, and 25 mL nutrient solution (20 g glucose, 2 g KH2PO4, 1 g MgSO4, 1 g ammonium citrate, 5 g peptone, 20 mg vitamin B1, and distilled water to 1000 mL). The bottles with the substrates were sterilized at 121 °C for 30 min and cooled at room temperature before inoculation. After dark cultivation at 23 °C with the relative humidity of 60–70% for 12 days, the substrates were entirely colonized by the mycelia and then followed by illuminated cultivation (250 lx, 12 h/day) to induce pigmentation, stromata development and fruiting body formation. About 6–8 weeks were required for fruiting body maturation.
2.3. Mycelia scratching
The aerial mycelia of four strains on the surface of the substrates in each bottle were mechanically scratched by a metal scraper. Mycelia were scratched at different mycelia growth stages: (1) when mycelia entirely colonized the substrates 8 days post inoculation at dark (S1), (2) when the mycelia turned light yellow 3 days post illumination (S2), and (3) mycelia turned yellow and became twist 6 days post illumination (S3). The mycelia without scratching were regarded as controls (NS). Ten bottles with three replicates to each treatment were established for each strain. The culture conditions were set as described above. The production parameters (the numbers, fresh weights per bottle and mature periods of fruiting bodies) were recorded at the end of the harvest period (when the end of the fruiting body swelling to a rod and its surface covered with white powder, the fruiting body is deemed to be mature). Biological efficiency is defined as the ratio of dry weight of fruiting body per dry weight of the substrates. The fresh fruiting bodies and substrates were fieeze-dried by using Savant Mldulyo freeze drier (Thermo Fisher Scientific, Waltham, MA, USA). Data were analyzed using one-way ANOVA and paired sample t-tests. The significant differences were determined by least significance difference (LSD) test (p = 0.05) with SPSS 16.0 software (SPSS Inc., Chicago, IL, USA).
2.4. Genomic DNA and total RNA extraction
The mycelia of strains YN1-14 and g38 from liquid medium (PPDA without agar powder) at 23 °C on a 150-rpm shaker for 7 days were harvested by centrifugation and washed twice with sterile distilled water for genomic DNA and total RNA extraction. The genomic DNA was extracted based on the manual of DNeasy® Plant Mini Kit (Qiagen, Hilden, Germany). The total RNA was extracted according to the instruction of the RNeasy Plant Mini Kit (Qiagen). Extraction was followed by DNase treatment using the RNase-Free DNase Set (Qiagen). The first strand cDNA was synthesized using 1 μg total RNA, oligo-dT primer based on the manual of the instruction of the PrimeScript™ 1st Strand cDNA Synthesis Kit (TaKaRa, Shiga, Japan). The synthesized cDNA was stored at −20 °C for further use.
2.5. Isolation and sequence analysis of CmSod1, CmGpx, and CmCat A
RT-PCRs were performed to isolate CmSod1, CmGpx, and CmCat A genes using the designed primers (Table 1) with the PCR conditions: 2 min at 95 °C; 5 cycles of 30 s at 94 °C, 45 s at 62 °C, 1.5 min at 72 °C; 10 cycles of 30 s at 94 °C, 45 s at 60 °C (−0.5 °C/cycle), 1.5 min at 72 °C; 25 cycles of 30 s at 94 °C, 45 s at 55 °C, 1.5 min at 72 °C; and 7 min at 72 °C. These primers were designed on the base of the transcriptomic sequencing data (unpublished data). Homology analysis of the genes and amino acid sequences was conducted at BLAST server. Multiple sequence alignments were performed using the ClustalW program. Phylogenetic trees were reconstructed using MEGA5.1 software with the method neighbor-joining. The reliability of the resulting topologies was tested by running 1000 bootstrap replicates.
Table 1.
Primers used in this study.
| Primers | Sequences (5’–3’) | Notes |
|---|---|---|
| CmSod1-F | ATGGTCAAAGCAGTCTGCGTTCTCC | Isolation of CmSod1, CmGpx, and CmCat A |
| CmSod1-498R | CTACAAAGCAGTTAGCAAGCCTGTCG | |
| CmGpx-F | ATGTCTTCTGCCGCGTCCTTTTAC | |
| CmGpx-632R | CACTCGGCTTTTTTGTTAATCTCGG | |
| CmCatA-F | ATGAAGGCGGCGCAAATTAAAGC | |
| CmCatA-2175R | ATACGCAACAAGATCAACCAGCCCAT | |
| rpb1-F | CTGTTCCCCCTCCTCCTGTG | qRT-PCR for gene expression analysis |
| rpb1-R | ATGTTGCGGCGATCCTTCTC | |
| tef1-F | GTCAAGGAAATCCGTCGTGGTAA | |
| tef1-R | GCAGGCGATGTGAGCAGTGTG | |
| CmSod1-135F | CTTCCACATCCACACCTTT | |
| CmSod1-268R | TCTTGATGTTGCCGAGATC | |
| CmGpx-305F | ACTTTGTCATCCTCGGCTTT | |
| CmGpx-417R | CAAGATGGGAAAGGTGACG | |
| CmCatA-979F | GACGAGTACTTTACCGAGAC | |
| CmCatA-1173R | GCGGTTAAAGTTCATCATGG |
2.6. Sample collection
Mycelia were sampled for mRNA expressions at different growth stages after inoculation, including colonization of mycelia on the substrates (C0d), 5 days after scratching (S5d), and 5 days without scratching (C5d). Three samples from each developmental stage were collected and stored at −80 °C for total RNA extraction as described above. The integrity of the total RNA was checked and 1 μg total RNA was used to synthesize cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara) following the manufacturer’s instructions.
2.7. qRT-PCR analysis
Two housekeeping genes rpb1 and tef1 were selected as internal controls to normalize the mRNA expression data [23]. All primer sets (Table 1) were designed with the software Primer 3 (version 0.4.0) and Primer Premier 5.0. Primers were tested with RT-PCR to confirm amplification of the desired size products (Supplemental Figure S1). qRT-PCR was performed on a Stratagene MX3000P qPCR system (Stratagene, Santa Clara, CA, USA) and SYBR® Premix Ex Taq II (Tli RNaseH Plus; Takara, Japan). A standard curve of amplification efficiency for the primer sets was generated with a fivefold dilution series of cDNA from C5d. Samples were assayed in triplicate in a 25-mL final volume and the thermal cycling conditions were the same as described before [24]. Cycle threshold (Ct) values were averaged for each triplicate by SPSS software. Samples were normalized using the geometric mean of rpb1 and tef1 Ct values. The expression levels were calculated using the 2−△△Ct method for each biological replicate. All the data were analyzed by one-way ANOVA using SPSS 16.0. The significant differences were determined by LSD test (p = 0.05).
3. Results
3.1. Effects of scratching on fruiting body production
Higher yields and biological efficiencies, and shortened fruiting body mature periods after inoculation were obtained from three strains YN1-14, YN2-7, and YN2-11 except g38 after scratching stimuli of mycelia at three vegetative stages (Table 2; Supplemental Figure S2). The periods for harvesting mature fruiting bodies of YN1-14 and YN2-7 were shortened at least 5 days when the mycelia were scratched at S1 and S2, compared with those at S3 stage (Table 2). The fruiting body numbers per bottle were significantly higher from g38 than those from YN1-14 and YN2-7 (p < 0.01, p < 0.01). Therefore, scratching stimulus of mycelia at S1 and S2 stages was an effective way to improve fruiting body yields of C. militaris.
Table 2.
Effects of scratching on fruiting body production of C. militarlis strains at different mycelia growth stages.
| Strains | Treatmentsa | Fruiting body weight per bottle (g) | Numbers of fruiting bodies per bottle | Biological efficiencyb (%) | Fruiting body mature periods after inoculation (d) |
|---|---|---|---|---|---|
| g38 | S1 | 15.70 ± 0.18a | 95.70 ± 1.31a | 24.08 ± 0.42a | 47.00 ± 0.00a |
| S2 | 15.79 ± 0.19a | 95.50 ± 0.85a | 24.02 ± 0.27a | 47.20 ± 0.19a | |
| S3 | 15.86 ± 0.22a | 96.50 ± 1.42a | 24.29 ± 0.35a | 47.20 ± 0.24a | |
| NS | 15.74 ± 0.26a | 96.60 ± 1.78a | 23.73 ± 0.37a | 47.00 ± 0.00a | |
| YN2-11 | S1 | 15.93 ± 0.18a | 57.80 ± 2.32bc | 24.03 ± 0.43a | 50.00 ± 0.00b |
| S2 | 16.14 ± 0.24a | 64.40 ± 3.82ab | 24.13 ± 0.31a | 50.10 ± 0.18b | |
| S3 | 15.78 ± 0.12a | 69.00 ± 5.37a | 24.32 ± 0.34a | 55.30 ± 0.28a | |
| NS | 14.36 ± 0.25b | 50.90 ± 2.33c | 22.06 ± 0.48b | 55.20 ± 0.24a | |
| YN1-14 | S1 | 15.91 ± 0.31a | 69.38 ± 4.07ab | 23.91 ± 0.41a | 50.20 ± 0.19c |
| S2 | 16.11 ± 0.21a | 64.88 ± 2.47b | 24.13 ± 0.40a | 50.20 ± 0.19c | |
| S3 | 15.81 ± 0.16a | 74.63 ± 1.80a | 24.14 ± 0.34a | 57.50 ± 0.34a | |
| NS | 8.18 ± 0.93b | 22.00 ± 2.81c | 13.09 ± 1.20b | 56.20 ± 0.24b | |
| YN2-7 | S1 | 15.65 ± 0.23a | 37.40 ± 1.51b | 24.19 ± 0.33a | 48.20 ± 0.20c |
| S2 | 15.24 ± 0.46ab | 48.40 ± 0.87a | 24.18 ± 0.44a | 48.30 ± 0.21c | |
| S3 | 14.10 ± 0.31b | 50.80 ± 2.23a | 24.19 ± 0.44a | 56.50 ± 0.37a | |
| NS | 9.14 ± 0.56c | 19.70 ± 0.90c | 15.56 ± 0.91b | 52.20 ± 0.29b |
aNS: non-scratched; S1: scratched after mycelia fully grew in the substrates; S2: scratched after mycelia turned light yellow; S3: scratched after mycelia turned yellow and became twist.
bBiological efficiency, the ratio of dry weight of fruiting body (g) per dry weight of the substrates (g).
3.2. mRNA expression of CmSod1, CmGpx, and CmCatA under scratching stimuli of mycelia
The sequences of CmSod1, CmGpx, and CmCatA from C. militaris were isolated and deposited in GenBank under accession number KX911468, KX911469, and KX911470, respectively. The open reading frame of CmSod1 was 498 bp encoding a polypeptide of 165 amino acids with a predicted molecular mass of 17.1 kDa and theoretical isoelectric point of 6.07. CmGpx gene encoded a mature protein of 170 amino acids with a calculated molecular mass of 18.9 kDa and theoretical isoelectric point of 6.03. CmCat A gene was 2178 bp, encoding a protein with 725 amino acids. No signal peptide was predicted from these three sequences. CmSod1 was a cytoplasmic Cu, Zn Sod. Three cysteines (Cys 6, Cys 58, and Cys 147) were found in the mature Sod1, and two of them (Cys 58 and Cys 147) were coincided with the cysteines known to be involved in an internal disulfide bond. The CmGpx protein contained a normal cysteine residue (Cys 39) instead of a selenocysteine at the catalytic site. The CmCat A protein contained histidine residue (His 75) and asparagine residue (Asn 148) at the catalytic site and tyrosine residue (Tyr 362) at the metal binding site. Phylogenetic trees (Supplemental Figure S3) based on the amino acid sequences similarity showed CmSod1, CmGpx, and CmCat A shared the high degrees of homology to those derived from proteins from other Ascomycota fungi, suggesting that the functions of these three genes could be relatively conservative in evolution.
The expression profiles of CmSod1, CmGpx, and CmCat A at 5 days without scratching and 5 days after scratching were compared in strains g38 and YN1-14 by qRT-PCR using rpb1 and tef1 as internal controls. The correlation coefficients of all PCRs were superior to 0.99 and the amplification efficiency of five genes ranged from the lowest for rpb1 (98.5%) to the highest for CmSod1 (110.7%; Table 3). For g38 strain, the expression level of CmGpx in S5d significantly decreased (Figure 1(a)). For YN1-14, the expression level of CmSod1 significantly increased in S5d compared with C5d (Figure 1(b)). These results indicated that scratching negatively influenced the expression level of CmGpx in g38 mutant, and significantly increased that of CmSod1 in YN1-14 strain.
Table 3.
Details of the primer pairs for qRT-PCR analysis.
|
Gene name (abbreviation) |
Amplicon length (bp) | Efficiency (%) | Slope | R2 |
|---|---|---|---|---|
| RNA polymerase II large subunit (rpb1) | 152 | 98.5 | −3.358 | 0.999 |
| Translation elongation factor 1-alpha (tef1) | 162 | 99.3 | −3.339 | 0.999 |
| Copper-zinc superoxide dismutase gene (CmSod1) | 134 | 110.7 | −3.112 | 0.994 |
| Glutathione peroxidase (CmGpx) | 113 | 107.3 | −3.158 | 0.999 |
| catalase A (CmCat A) | 195 | 110 | −3.110 | 0.990 |
Figure 1.
qRT-PCR analysis of CmSod1, CmGpx, and CmCat A at 5 days after scratching stimuli of Cordyceps militaris mycelia. (a) g38 strain. (b) YN1-14 strain. C5d: 5 days without scratching. S5d: 5 days after scratching. Data represented the means of three replicates. The vertical bars represented standard errors and the asterisk indicated significant difference (p < 0.05).
4. Discussion
The insect-born fungus C. militaris is an important medicinal fungus. Degeneration is a major constraint for artificial cultivation of this valuable C. militaris fungus. Mycelia stimuli by scratching technique have been recognized as a useful agronomic behavior in A. bisporus and P. eryngii culture but not in F. velutipes [17–19]. The scratching technique has a positive effect on the total yield of fruiting bodies in A. bisporus, P. eryngii, and P. flabellatus [17,18,25]. In this study, the scratching technique was introduced to evaluate its effect on the degenerated strain with reduced ability of stromata formation and mutant strain g38 with higher yield and shorter growth period at different mycelia growth stages. The present results showed that scratching stimuli of mycelia could significantly improve fruiting body production and shorten production periods for the degenerate strains characterized by fluffy mycelia and reduced ability of stromata formation. However, scratching stimuli of mycelia did not improve fruiting body production and production period of g38 mutant. Higher yield was obtained from YN2-11 in the three scratched groups than that of g38. These results indicated that scratching was an effective way to improve the fruiting body production, especially for the degenerate strains. Therefore, scratching would be taken into consideration to reduce the economic loss when C. militaris strains exhibited reduced stromata differentiation in commercial production. In practice, scratching stimuli of mycelia should be carried out when the mycelia fully grow in the substrates or mycelia turn yellow slightly, to obtain higher yield and shorter growth period.
In A. bisporus, the scratching technique creates an open structure in the casing layer to induce the higher yield [17]. Previous studies indicate that degeneration of C. militaris cultures is related with cellular accumulation of ROS [15]. To reveal whether ROS-scavenging system was involved in the improved characteristics of YN1-14 strain by scratching stimuli of mycelia, the expression profiles of three main genes encoding antioxidant enzymes were determined. For YN1-14 strain, the expression level of CmSod1 significantly increased after 5 days of mycelia stimuli by scratching. Previous studies also indicated that transcript levels of genes encoding antioxidant enzymes could be strongly induced under various environmental stresses and the activated gene expressions could contribute to the improved stress tolerance in plants [26,27]. But for the insertional mutant g38 in Rhf1 gene, the expression pattern of CmGpx was down-regulated. The Rhf1 gene was involved in the fruiting body production of C. militaris fungus and that silencing the Rhf1 gene could improve the formation and yields of fruiting bodies during the commercialization of this medicinal fungus [22].The fruiting ability of degenerate C. militaris strain could be restored by overexpression an antioxidant glutathione peroxidase (Gpx) gene from Aspergillus nidulans to increase oxidative stress tolerance [28]. It seems that the association between Rhf1 and CmGpx in regulating the fruiting body production needs further study.
Supplementary Material
Funding Statement
This study was supported by the Guangdong Provincial Science and Technology Project (2015B070701019; 2017A050503005), Guangzhou Science and Technology Plan Projects (201604020030; 201803010087), and GDAS Special Project of Science and Technology Development (2017GDASCX-0107).
Disclosure statement
The authors declare no conflicts of interest. All the experiments undertaken in this study comply with the current laws of the country in which they were performed.
References
- 1.Sung GH, Hywel-Jones NL, Sung JM, et al. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud Mycol. 2007;57:5–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lin YW, Chiang BH. Anti-tumor activity of the fermentation broth of Cordyceps militaris cultured in the medium of Radix astragali. Process Biochem. 2008;43:244–250. [Google Scholar]
- 3.Ohta Y, Lee JB, Hayashi K, et al. In vivo anti-influenza virus activity of an immunomodulatory acidic polysaccharide isolated from Cordyceps militaris grown on germinated soybeans. J Agric Food Chem. 2007;55:10194–10199. [DOI] [PubMed] [Google Scholar]
- 4.Kim H, Yun J. A comparative study on the production of exopolysaccharides between two entomopathogenic fungi Cordyceps militaris and Cordyceps sinensis in submerged mycelial cultures. J Appl Microbiol. 2005;99:728–738. [DOI] [PubMed] [Google Scholar]
- 5.Tao Z, Cao L, Zhang Y, et al. Laboratory rearing of Thitarodes armoricanus and Thitarodes jianchuanensis (Lepidoptera: Hepialidae), hosts of the Chinese medicinal fungus Ophiocordyceps sinensis (Hypocreales: Ophiocordycipitaceae). J Econ Entomol. 2016;109:176–181. [DOI] [PubMed] [Google Scholar]
- 6.Qiu XH, Cao L, Han RC. The progress, issues and perspectives in the research of Ophiocordyceps sinensis. J Environ Entomol. 2016;38:1–23. [Google Scholar]
- 7.Zheng ZL, Huang CH, Li C, et al. Agrobacterium tumefaciens-mediated transformation as a tool for insertional mutagenesis in medicinal fungus Cordyceps militaris. Fungal Biol. 2011;115:265–274. [DOI] [PubMed] [Google Scholar]
- 8.Zheng P, Xia YL, Xiao GH, et al. Genome sequence of the insect pathogenic fungus Cordyceps militaris, a valued traditional Chinese medicine. Genome Biol. 2011;12:R116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Paterson RRM. Cordyceps–a traditional Chinese medicine and another fungal therapeutic biofactory? Phytochemistry. 2008;69:1469–1495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Shrestha B, Zhang WM, Zhang YJ, et al. The medicinal fungus Cordyceps militaris: research and development. Mycol Progress. 2012;11:599–614. [Google Scholar]
- 11.Liang ZC, Liang CH, Wu CY. Various grain substrates for the production of fruiting bodies and bioactive compounds of the medicinal caterpillar mushroom, Cordyceps militaris (Ascomycetes). Int J Med Mushrooms. 2014;16:569–578. [DOI] [PubMed] [Google Scholar]
- 12.Yang T, Dong CH. Photo morphogenesis and photo response of the blue-light receptor gene Cmwc-1 in different strains of Cordyceps militaris. FEMS Microbiol Lett. 2014;352:190–197. [DOI] [PubMed] [Google Scholar]
- 13.Zheng ZL, Qiu XH, Han RC. Identification of the genes involved in the fruiting body production and cordycepin formation of Cordyceps militaris fungus. Mycobiology. 2015;43:37–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wang C, Butt TM, St Leger RJ. Colony sectorization of Metarhizium anisopliae is a sign of ageing. Microbiology (Reading, Engl). 2005;151:3223–3236. [DOI] [PubMed] [Google Scholar]
- 15.Lin QQ, Qiu XH, Zheng ZL, et al. Characteristics of the degenerate strains of Cordyceps militaris. Mycosystema. 2010;29:670–677. [Google Scholar]
- 16.Dalton TP, Shertzer HG, Puga A. Regulation of gene expression by reactive oxygen. Annu Rev Pharmacol Toxicol. 1999;39:67–101. [DOI] [PubMed] [Google Scholar]
- 17.Pardo A, Arturo de Juan J, Emilio Pardo J. Performance of composted vine shoots as a peat alternative in casing materials for mushroom cultivation. Food Agric Environ. 2003;1:209–214. [Google Scholar]
- 18.Kim MK, Math RK, Cho KM, et al. Effect of Pseudomonas sp. P7014 on the growth of edible mushroom Pleurotus eryngii in bottle culture for commercial production. Bioresour Technol. 2008;99:3306. [DOI] [PubMed] [Google Scholar]
- 19.Xiong Y, Jia Y, Jiang L, et al. Comparison experiment and cultivation method research for 26 different Flammaline velutipes species. Southwest China J Agr Sci. 1999;2:74–79. [Google Scholar]
- 20.Wang L, Pan QL, Chen YC, et al. Effect of co-cultivation and scratching on fruit body yields of Cordyceps spp. s. l. Acta Edulis Fungi. 2013;20:35–39. [Google Scholar]
- 21.Han YF, Wang BL, Chen WH, et al. Selection of an anamorph of Cordyceps takaomontana for artificial cultivation and effect of scratching on fruit body biomass. Acta Edulis Fungi. 2012;19:39–42. [Google Scholar]
- 22.Jiang KQ, Han RC. Rhf1 gene is involved in the fruiting body production of Cordyceps militaris fungus. J Ind Microbiol Biotechnol. 2015;42:1183–1196. [DOI] [PubMed] [Google Scholar]
- 23.Lian TT, Yang T, Liu GJ, et al. Reliable reference gene selection for Cordyceps militaris gene expression studies under different developmental stages and media. FEMS Microbiol Lett. 2014;356:97–104. [DOI] [PubMed] [Google Scholar]
- 24.Liu GQ, Qiu XH, Cao L, et al. Evaluation of reference genes for reverse transcription quantitative PCR studies of physiological responses in the ghost moth, Thitarodes armoricanus (Lepidoptera, Hepialidae). PLoS One. 2016;11:e0159060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Islam MZ, Rahman MH, Hafiz F. Cultivation of oyster mushroom Pleurotus flabellatus on different substrates. Int J Sustain Crop Prod. 2009;4:45–48. [Google Scholar]
- 26.Hernandez J, Jimenez A, Mullineaux P, et al. Tolerance of pea (Pisum sativum L.) to long-term salt stress is associated with induction of antioxidant defences. Plant Cell Environ. 2000;23:853–862. [Google Scholar]
- 27.Vaidyanathan H, Sivakumar P, Chakrabarty R, et al. Scavenging of reactive oxygen species in NaCl-stressed rice (Oryza sativa L.)—differential response in salt-tolerant and sensitive varieties. Plant Sci. 2003;165:1411–1418. [Google Scholar]
- 28.Xiong CH, Xia YL, Zheng P, et al. Increasing oxidative stress tolerance and subculturing stability of Cordyceps militaris by overexpression of a glutathione peroxidase gene. Appl Microbiol Biotechnol. 2013;97:2009–2015. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.

